ABSTRACT
Co-infection with oncogenic retrovirus and herpesvirus significantly facilitates tumor metastasis in human and animals. Co-infection with avian leukosis virus subgroup J (ALV-J) and Marek’s disease virus (MDV), which are typical oncogenic retrovirus and herpesvirus, respectively, leads to enhanced oncogenicity and accelerated tumor formation, resulting in increased mortality of affected chickens. Previously, we found that ALV-J and MDV cooperatively promoted tumor metastasis. However, the molecular mechanism remains elusive. Here, we found that doublecortin-like kinase 1 (DCLK1) mediated cooperative acceleration of epithelial–mesenchymal transition (EMT) by ALV-J and MDV promoted tumor metastasis. Mechanistically, DCLK1 induced EMT via activating Wnt/β-catenin pathway by interacting with β-catenin, thereby cooperatively promoting tumor metastasis. Initially, we screened and found that DCLK1 was a potential mediator for the cooperative activation of EMT by ALV-J and MDV, and enhanced cell proliferation, migration, and invasion. Subsequently, we revealed that DCLK1 physically interacted with β-catenin to promote the formation of the β-catenin–TCF4 complex, inducing transcription of the Wnt target gene, c-Myc, promoting EMT by increasing the expression of N-cadherin, Vimentin, and Snail, and decreasing the expression of E-cadherin. Taken together, we discovered that jointly activated DCLK1 by ALV-J and MDV accelerated cell proliferation, migration and invasion, and ultimately activated EMT, paving the way for tumor metastasis. This study elucidated the molecular mechanism underlying cooperative metastasis induced by co-infection with retrovirus and herpesvirus.
IMPORTANCE
Tumor metastasis, a complex phenomenon in which tumor cells spread to new organs, is one of the greatest challenges in cancer research and is the leading cause of cancer-induced death. Numerous studies have shown that oncoviruses and their encoded proteins significantly affect metastasis, especially the EMT process. ALV-J and MDV are classic tumorigenic retrovirus and herpesvirus, respectively. We found that ALV-J and MDV synergistically promoted EMT. Further, we identified the tumor stem cell marker DCLK1 in ALV-J and MDV co-infected cells. DCLK1 directly interacted with β-catenin, promoting the formation of the β-catenin–TCF4 complex. This interaction activated the Wnt/β-catenin pathway, thereby inducing EMT and paving the way for synergistic tumor metastasis. Exploring the molecular mechanisms by which ALV-J and MDV cooperate during EMT will contribute to our understanding of tumor progression and metastasis. This study provides new insights into the cooperative induced tumor metastasis by retroviruses and herpesviruses.
KEYWORDS: avian leukosis virus subgroup J, Marek’s disease virus, doublecortin-like kinase 1, co-infection, epithelial-mesenchymal transition
INTRODUCTION
Tumor metastasis, a complex phenomenon in which tumor cells spread to new organs, is one of the greatest challenges in cancer research and is the leading cause of cancer-induced death. Numerous studies have shown that oncoviruses significantly affect metastasis, particularly epithelial–mesenchymal transition (EMT) (1). EMT is a crucial mechanism in the metastatic drive of most cases of carcinoma, leading to the loss of intercellular adhesion and increased cell mobility, allowing tumor cells to infiltrate and metastasise to distant sites (2), which is the key to tumor transformation and metastasis (3, 4). Oncoviruses, including human papillomavirus (HPV) (5), Epstein–Barr virus (EBV) (6), and hepatitis B and C viruses (HBV and HCV) (7, 8), play vital roles in cancer metastasis, particularly in EMT (9).
Co-infection with avian leukosis virus subgroup J (ALV-J) and Marek’s Disease Virus (MDV) is common in chicken flocks. ALV-J primarily induces myelocytomas by targeting cells of the myeloid lineage, while MDV mainly induces lymphomas by targeting T lymphocytes. These viruses can act as mutual activators, cooperatively enhancing pathogenicity and accelerating lymphomatosis (10–12). Avian leukosis (AL) and Marek’s disease (MD), caused by the tumorigenic retrovirus ALV-J and avian herpesvirus MDV, respectively (13, 14), are important neoplastic diseases that threaten healthy poultry farming worldwide (13, 15, 16). Tumor development and metastasis are essential factors in the death of chickens caused by ALV-J and MDV, with metastasis causing more than 90% of cancer-related mortality (17, 18). Metastasis is a multistage process involving genetically unstable tumor cells that undergo phenotypic changes that allow them to egress from the primary tumor and colonise a distant tissue site with a favourable microenvironment, such as the liver and kidney, thereby exacerbating the disease (19–21). The pathogenic characterisation of ALV-J and MDV co-infection has been intensively studied, but the molecular mechanism of viral co-induced tumor metastasis has not been reported.
Understanding the involvement of tumor viruses in EMT is beneficial for elucidating the mechanisms by which viruses cause tumor metastasis (9). HPV-encoded essential oncoproteins E6 and E7 have been reported to indirectly regulate EMT through the PI3K signalling pathway (5). HBV is involved in regulating EMT by downregulating mTOR and its targets, c-Myc and Cyclin D1, and inhibiting SFRP1 expression (22). Our previous study revealed that ALV-J promotes EMT through the interaction between surface protein (SU) and doublecortin-like kinase 1 (DCLK1) (23). It remains unclear whether the mechanism through which ALV-J and MDV cooperatively promote tumor metastasis involves EMT.
DCLK1, a key protein molecule that promotes tumor metastasis, is a member of the doublecortin family and the protein kinase superfamily, which is involved in the regulation of tumorigenesis and EMT in cancers, such as colorectal cancer (CRC), renal clear cell carcinoma (RCC), pancreatic cancer, and hepatocellular carcinoma (HCC) (24, 25). Studies have supported that DCLK1 expression is critical for cancer growth, EMT and metastasis (23, 26). In clinical studies, the upregulation of DCLK1 has been associated with aggressiveness and poor prognosis in various cancers, and targeting DCLK1 with specific monoclonal antibodies blocks cancer cell invasion and metastasis (27), suggesting that DCLK1 may be a potential therapeutic target for tumorigenesis and transformation (28). In previous studies, DCLK1 and the Wnt/β-catenin pathway have been shown to be closely related, the possible mechanism involving the induction of EMT through regulation of the Wnt/β-catenin pathway (29), but whether DCLK1 regulates EMT in ALV-J and MDV induced tumor metastasis is unknown.
In the present study, the molecular mechanism of tumor metastasis induced by the simple retrovirus ALV-J and the herpesvirus MDV was elucidated. Cooperatively activated DCLK1 by ALV-J and MDV induced EMT by activating the Wnt/β-catenin pathway through direct interaction with β-catenin, paving the way for synergistic tumor metastasis. The elucidated molecular mechanism in this study underlies the synergistic metastasis induced by co-infection with retrovirus and herpesvirus.
RESULTS
ALV-J and MDV cooperatively promote tumor metastasis
The co-infection animal model of ALV-J and MDV was successfully established. In chickens mono-infected with ALV-J, no tumors were detected, although inflammatory lesions emerged by the 7th week post-infection (wpi). Conversely, chickens mono-infected with MDV exhibited inflammatory lesions by the 5th wpi, with lymphomas predominantly observed in the liver, kidneys, and spleen by the 7th wpi. Remarkably, in co-infected chickens, inflammatory lesions appeared as early as the 3rd wpi, and lymphomas were observed by the 5th wpi (Fig. 1A).
Fig 1.
ALV-J and MDV cooperatively promoted tumor metastasis. (A) Tumorigenic timeline of co-infection with ALV-J and MDV versus mono-infection. In ALV-J mono-infected chickens, inflammatory lesions appearing by the 7th wpi. For the MDV mono-infected chickens, inflammatory lesions were observed by the 5th wpi, and lymphomata by the 7th wpi. In contrast, co-infected chickens exhibited inflammatory lesions as early as the 3rd wpi and lymphomas by the 5th wpi. (B) Histopathological observation. Co-infection resulted in more severe pathogenicity in the liver and kidneys, with metastasis of lymphoma to the heart and proventriculus, compared with mono-infected chickens. Additionally, lymphocyte loss was more pronounced in the spleen of co-infected chickens.
Furthermore, the lymphomas in co-infected chickens were more extensive than in the mono-infected chickens, affecting not only the liver, kidneys, and spleen, but also metastasizing to the heart and proventriculus. Statistical analysis revealed that lymphoma occurred in 40% of chickens infected with MDV and in 90% of chickens co-infected with both ALV-J and MDV. Histological examinations (Fig. 1B) indicated that co-infected chickens exhibited significantly greater splenic lymphocyte depletion, pronounced lymphocyte infiltration in the liver, kidney, heart, and proventriculus, as well as more severe lymphocytic tumor cell invasion and proliferation, compared with the mono-infected chickens. No histological alterations were observed in the mock chickens. Above data demonstrate that co-infection with ALV-J and MDV, in comparison to mono-infection, significantly increases tumor incidence, exacerbates tissue pathology, and accelerates lymphoma formation and metastasis.
ALV-J and MDV cooperatively promote EMT
EMT promotes metastasis of tumor cells. To explore whether co-infection with ALV-J and MDV was associated with EMT, the expression of EMT marker molecules in virus-infected cells and tissues was examined. The expression of mesenchymal markers, N-cadherin, vimentin, and the transcription factor Snail increased significantly in co-infected cells compared with that in mono-infected cells, in contrast, the expression of E-cadherin, an epithelial marker decreased (Fig. 2A and B).
Fig 2.
ALV-J and MDV cooperatively promoted EMT. (A) ALV-J and MDV cooperatively enhanced mRNA expression of EMT markers in DF-1 cells. The expression of the EMT epithelial marker E-cadherin, mesenchymal markers N-cadherin, vimentin, and the transcription factor Snail was detected by qPCR. Snail (B) co-infection with ALV-J and MDV significantly decreased the protein expression levels of E-cadherin and increased the protein expression levels of N-cadherin, vimentin, and Snail in DF-1 and HD11 cells. β-actin was used as an internal reference gene to calculate the relative expression of each protein. (C) ALV-J and MDV inhibit E-cadherin expression in co-infected DF-1 cells detected by laser confocal assay with FITC-labelled E-cadherin. (D) ALV-J and MDV inhibited E-cadherin expression in the liver, spleen, kidney, and duodenum, as detected by laser confocal assay. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
To clarify the effect of ALV-J and MDV co-infection on E-cadherin expression, fluorescein isothiocyanate (FITC) green fluorescent protein labeling was used to detect changes in E-cadherin expression after viral infection using a laser confocal assay. As shown in Fig. 2C, E-cadherin expression was significantly reduced in co-infected DF-1 cells compared with that in mono-infected cells, indicating that ALV-J and MDV cooperatively reduced intercellular adhesion. To further investigate whether ALV-J and MDV cooperatively alter the expression of E-cadherin in tissues, the expression of E-cadherin in different tissues was detected using a laser confocal assay with an FITC tag, as described above. Compared with that of the mono-infected tissues, E-cadherin expression was decreased in the co-infected tissues (Fig. 2D), indicating that ALV-J and MDV cooperatively suppressed E-cadherin expression in the liver, spleen, kidney, and duodenum.
ALV-J and MDV cooperatively facilitate DCLK1 expression in vitro and in vivo
To screen for key host molecules mediating the co-activation of EMT by ALV-J and MDV, chick embryo fibroblasts (CEFs) co-infected with ALV-J and MDV, mono-infected with ALV-J or MDV, and mocks were analysed using tandem mass tag (TMT) quantitative proteomic analysis. Fifteen significantly different proteins were screened in the co-infected cells compared with the ALV-J and MDV mono-infected cells (Fig. 3A), and DCLK1, a tumor stem cell marker, was significantly upregulated in the co-infected cells (P < 0.05) (Table S1). Subsequently, to confirm whether ALV-J and MDV co-activated DCLK1, the expression level of DCLK1 was detected in DF-1 cells using qPCR and Western blot. Compared with ALV-J and MDV mono-infected cells, the expression of DCLK1 in co-infection cells was significantly increased (P < 0.01) (Fig. 3B and C). To further confirm the expression of DCLK1 in vivo, a co-infected experimental animal model of ALV-J and MDV was established, and DCLK1 mRNA levels were detected using qPCR at 21 days post-infection (dpi). The results showed that compared with ALV-J- and MDV-mono-infected chickens, the relative levels of viral load and DCLK1 mRNA in the liver, kidney, and marrow were significantly increased (Fig. 2F and 3D). Taken together, these findings indicated that ALV-J and MDV cooperatively activated DCLK1 in vitro and in vivo.
Fig 3.
ALV-J and MDV cooperatively facilitated DCLK1 expression. (A) DCLK1 was upregulated in ALV-J- and MDV-co-infected cells. Differential protein clustering heat map showing significant differences between ALV-J and MDV coinfected DF-1 cells and mono-infected cells. (B) ALV-J and MDV cooperatively promoted the mRNA expression of DCLK1. DF-1 cells were coinfected with ALV-J and MDV. Total RNA was extracted from cells co-infected with ALV-J and MDV, mono-infected with ALV-J or MDV, and mock cells, as described in the Materials and Methods. Transcriptional changes in DCLK1 were detected by qPCR at 48 hpi after viral infection. (C) ALV-J and MDV cooperatively promoted the protein expression of DCLK1 in DF-1 and HD11 cells. Protein levels of DCLK1 in the above cells were detected using Western blotting analysis. β-actin was used as an internal reference gene to calculate the relative expression of each protein. (D and E) ALV-J and MDV loads in tissues. Animal models of co-infection with ALV-J and MDV were established, and ALV-J (D) and MDV (E) loads in the liver, kidney, and marrow were detected by qPCR at 21 dpi. (F) ALV-J and MDV promoted the mRNA expression of DCLK1 in vivo. RNA was extracted from tissues at 21 dpi. The copy number of DCLK1 mRNA in the liver, kidney, and marrow was measured by qPCR. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
Ectopic expression of DCLK1 promotes EMT
To assess the effect of DCLK1 on EMT, pcDNA3.1-DCLK1 was transfected into DF-1 or HD11 cells co-infected with ALV-J and MDV, and the expression of EMT biomarker proteins was examined. The mRNA and protein levels of E-cadherin were downregulated, whereas those of N-cadherin, vimentin, and Snail were upregulated after pcDNA3.1-DCLK1 transfection (Fig. 4A and B). The activation of EMT accelerated cell proliferation and facilitated tumor cell metastasis. To investigate whether DCLK1 expression affects cell proliferation, recombinant pcDNA3.1-DCLK1 plasmid and shRNA targeting DCLK1 were transfected into ALV-J- and MDV-co-infected DF-1 cells and assessed using the cell counting kit-8 (CCK-8) assay. The results showed that DCLK1 overexpression significantly increased cell proliferation (Fig. 4C), whereas DCLK1 knockdown significantly decreased cell proliferation (Fig. 4D).
Fig 4.
DCLK1 promoted EMT. (A) Overexpression of DCLK1 promoted the mRNA expression of EMT markers. Transcript levels of EMT markers were detected using qPCR after DCLK1 overexpression in DF-1 cells co-infected with ALV-J and MDV for 48 hpi. (B) Overexpression of DCLK1 promoted the protein expression of EMT markers. Changes in the levels of DCLK1 and EMT markers in the abovementioned cells were detected by Western blotting. β-actin was used as an internal reference gene to calculate the relative expression of each protein. (C) DCLK1 overexpression accelerated cell proliferation. PcDNA3.1-DCLK1 and pcDNA3.1-Mock plasmids were transfected into ALV-J and MDV co-infected cells, and the CCK-8 assay showed that DCLK1 overexpression promoted cell proliferation. (D) RNA interference of DCLK1 arrested cell proliferation. The interference vectors shDCLK1-1, shDCLK1-2, and negative control plasmid (NC) were transfected into ALV-J and MDV co-infected cells, and the CCK-8 assay showed that knockdown of DCLK1 inhibited cell proliferation. (E) Overexpression of DCLK1 promoted cell migration. PcDNA3.1-DCLK1 and pcDNA3.1-Mock plasmids were transfected into ALV-J and MDV co-infected HD11 cells, and the cell scratch assay showed that DCLK1 overexpression promoted cell migration, as well as the statistical analysis of cell migration. (F) Overexpression of DCLK1 enhanced invasion of HD11 cells. PcDNA3.1-DCLK1 and pcDNA3.1-Mock plasmids were transfected into ALV-J and MDV co-infected HD11 cells, and the transwell invasion and migration assay showed that DCLK1 overexpression promoted cell invasion and migration, as well as the statistical analysis of cell migration and invasion. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
Further immunohistochemistry experiments confirmed that co-infection with ALV-J and MDV cooperatively promotes DCLK1 expression in vivo, with notably elevated levels observed in the duodenal crypts (Fig. S1A). To investigate whether DCLK1 expression affects cell proliferation in vivo, double-immunofluorescence labeling for DCLK1 and proliferating cell nuclear antigen (PCNA), a marker for proliferation, was performed using the duodenum. The expression of DCLK1 and PCNA highly overlapped in the intestinal crypts of chickens co-infected with ALV-J and MDV as evident in the confocal imaging of immunofluorescence, the fluorescence expression level was significantly higher in the co-infected group than in the mono-infected group (Fig. S1B). We confirmed that DCLK1 accelerated the proliferation of cells in co-infected tissues, which is consistent with previous findings that DCLK1 regulates self-renewal of intestinal tumor cells (30).
To further investigate whether DCLK1 expression affects cell migration and invasion, recombinant pcDNA3.1-DCLK1 plasmid was transfected into ALV-J- and MDV-co-infected DF-1 cells and assessed using the transwell migration and cell invasion assay. The results showed that DCLK1 overexpression significantly increased cell migration and invasion (Fig. 4E and F).
ALV-J and MDV cooperatively activate the Wnt/β-catenin pathway
Proteomic analysis showed that co-infection of ALV-J and MDV activated the Wnt-inducible signaling pathway protein 2 (WISP2), a marker of the Wnt/β-catenin pathway (Fig. 3A). To determine whether Wnt/β-catenin signaling pathway was involved in the synergy of ALV-J and MDV, the expression of Wnt and β-catenin in the DF-1 or HD11 cells co-infected with ALV-J and MDV was detected, as shown in Fig. 5A, the expression of Wnt and β-catenin increased significantly in co-infected cells in comparison to those in mono-infected cells. The results indicated that co-infection of ALV-J and MDV further activated the expression of Wnt/β-catenin signaling pathway proteins.
Fig 5.
ALV-J and MDV cooperatively activated the Wnt/β-catenin pathway. (A) ALV-J and MDV co-infection promoted protein expression of Wnt and β-catenin. Total protein was extracted from DF-1 or HD11 cells co-infected with ALV-J and MDV, mono-infected with ALV-J or MDV, and mock cells as described in the Materials and Methods. Protein levels of DCLK1 were detected by Western blotting at 48 hpi after viral infection. β-actin was used as an internal reference gene to calculate the relative expression of each protein. (B) ALV-J and MDV cooperatively enhanced β-catenin expression in co-infected DF-1 cells detected by laser confocal assay with CY3-labeled β-catenin. (C) ALV-J and MDV cooperatively enhanced β-catenin expression in the liver, spleen, kidney, and duodenum, as detected by laser confocal assay. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
The core of the Wnt/β-catenin pathway is the stability of β-catenin. To clarify whether co-infection of ALV-J and MDV affects the nuclear translocation of β-catenin, β-catenin was labeled with CY3, and the nuclear translocation of β-catenin was observed using laser confocal microscopy. We found that the expression of β-catenin in the nuclei of co-infected cells was significantly higher than that in mono-infected cells (Fig. 5B), indicating that ALV-J and MDV co-infection promoted β-catenin nuclear translocation, thus facilitating the initiation of transcription of downstream target genes, and promoting the process of the Wnt/β-catenin signaling pathway. Subsequently, the expression of β-catenin expression was detected in tissues. The expression of β-catenin was lower in ALV-J and MDV mono-infected tissues in comparison to that in co-infection tissues (Fig. 5C), indicating that ALV-J and MDV co-infection enhanced the process of the Wnt/β-catenin signalling pathway in tissues.
DCLK1 enhances Wnt/β-catenin pathway activation in ALV-J and MDV co-infected cells
To evaluate the effect of DCLK1 on the Wnt/β-catenin pathway, recombinant pcDNA3.1-DCLK1 plasmid and shRNA targeting DCLK1 were transfected into DF-1 or HD11 cells, which were then co-infected with ALV-J and MDV. The cells were harvested to detect β-catenin and its direct downstream molecule, c-Myc, expression by qPCR and Western blot analysis at 48 hpi. The overexpression of DCLK1 significantly promoted the expression of β-catenin and c-Myc (Fig. 6A and B). Correspondingly, the knockdown of DCLK1 inhibited the expression of β-catenin and c-Myc (Fig. 6C and D). To further clarify the effect of DCLK1 on the nuclear translocation of β-catenin, using CY3 to label β-catenin, DCLK1 was knocked down in DF-1 cells co-infected with ALV-J and MDV, the results showed that β-catenin was ectopically attenuated (Fig. 6E). These results indicated that DCLK1 enhances the Wnt/β-catenin signalling pathway in ALV-J and MDV co-infected cells.
Fig 6.
DCLK1 enhanced the Wnt/β-catenin pathway. (A) Overexpression of DCLK1 upregulated the gene transcript level of β-catenin. DF-1 cells were transfected with pcDNA3.1-Mock and pcDNA3.1-DCLK1, total RNA was extracted from cells, β-catenin mRNA was measured by qPCR. (B) Overexpression of DCLK1 promoted the expression of β-catenin and c-Myc protein. Total protein was extracted from the transfected DF-1 or HD11 cells, and then DCLK1, β-catenin and c-Myc protein levels were detected by Western blotting. (C) Interference with DCLK1 inhibited the mRNA expression of β-catenin. DF-1 cells were transfected with the sh-NC, shDCLK1-1, and shDCLK1-2, total RNA was extracted from cells, and β-catenin mRNA was measured using qPCR. (D) DCLK1 knockdown inhibited the expression of β-catenin and c-Myc protein. Total protein was extracted from the transfected DF-1 or HD11 cells, and DCLK1, β-catenin, and c-Myc protein levels were detected by Western blotting. β-actin was used as an internal reference gene to calculate the relative expression of each protein. (E) Interference with DCLK1 suppressed β-catenin nuclear translocation. Transfection of interference plasmids shDCLK1-1, shDCLK1-2, and sh-NC into ALV-J and MDV co-infected DF-1 cells, CY3-labeled β-catenin, observed by laser confocal assay at 48 hpi. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
DCLK1-induced EMT was regulated by the Wnt/β-catenin pathway
To confirm whether DCLK1 regulates EMT through the Wnt/β-catenin pathway, rescue experiments were performed in DF-1 using CHIR99021 (6 µM/mL, Wnt/β-catenin activator) (31). Activation of the Wnt/β-catenin signaling pathway stimulates EMT-related transcription factors and promotes EMT. CHIR-99021 rescues the changes in expression of β-catenin and its downstream molecule, c-Myc, as well as EMT markers caused by knockdown of DCLK1 in ALV-J and MDV co-infected cells (Fig. 7A), there was no significant difference in ALV-J and MDV mono-infection groups (Fig. S2), indicating that DCLK1 regulates EMT by targeting the Wnt/β-catenin pathway during co-infection. Subsequently, double immunofluorescence assays were performed using FITC-labeled DCLK1 and CY3-labeled β-catenin, and the results revealed a partial overlap in DCLK1 and β-catenin in the liver and spleen (Fig. 7B). Co-immunoprecipitation assays demonstrated that β-catenin and DCLK1 could precipitate in the nucleus (Fig. 7C). Since LEF/TCF is a potent Wnt/β-catenin transcription factor in the nucleus, it is speculated that DCLK1 might enhance the formation of β-catenin·TCF4 complex and act as the activator of the Wnt/β-catenin pathway. Immunoprecipitation results showed that the interaction of Myc-β-catenin with Flag-TCF4 increased 1.56-fold in the nucleus when DCLK1 was co-expressed (Fig. 7D). These results suggested that DCLK1 is an activator that enhances the formation of the β-catenin and TCF4 complexes in the nuclei of DF-1 cells. Furthermore, we verified the expression of DCLK1, N-cadherin, E-cadherin, and β-catenin in the livers of four groups of test chickens, respectively. Compared with ALV-J and MDV mono-infected chickens, the DCLK1, N-cadherin, and β-catenin expression in the liver of tumors induced by ALV-J and MDV co-infection was significantly upregulated, while E-cadherin expression was significantly downregulated (Fig. 7E). These data suggest that DCLK1 and β-catenin interact to promote the transcription of the downstream target gene c-Myc, thereby inducing EMT.
Fig 7.
DCLK1-induced EMT was regulated by the Wnt/β-catenin pathway. (A) CHIR-99021 restored gene inhibition caused by DCLK1 knockdown. ALV-J and MDV co-infected DF-1 cells with DCLK1 depletion were treated with CHIR99021 (6 µM/mL) for 24 h. The protein levels of EMT markers and Wnt/β-catenin target genes (β-catenin and c-Myc) were detected by Western blotting. β-actin was used as an internal control. (B) Immunofluorescence co-localization of FITC-labeled DCLK1 and CY3-labeled β-catenin in the liver and spleen, and partial overlap of green fluorescence of DCLK1 and red fluorescence of β-catenin revealed by laser confocal assay. (C) Co-immunoprecipitation showed the physical interaction between DCLK1 and β-catenin in DF-1 cells co-expressing Flag-DCLK1 and β-catenin or Myc-β-catenin and DCLK1. (D) DCLK1 enhanced the interaction of β-catenin and TCF4. Plasmids of Flag-TCF4, Myc-β-catenin, and DCLK1 were co-transfected into cells according to the situations indicated above. Enhanced green fluorescent protein (EGFP) plasmids were co-transfected as controls for transfection efficiency. The cell lysates were subjected to immunoprecipitation (IP) using an anti-Myc antibody. Immunoprecipitates and nuclear proteins were subjected to Western blotting using the indicated antibodies. Lamin B1 was used as a loading control for nuclear proteins. (E) Expression levels of DCLK1, N-cadherin, E-cadherin, and β-catenin in the livers of tumor-bearing chickens and normal livers of the experimental group. Data are presented as the means ± SD from at least three independent experiments. *, P ≤ 0.05. **, P ≤ 0.01.
In conclusion, when both viruses infect host cells simultaneously, compared with single infection, ALV-J and MDV cooperatively activate the host protein DCLK1 and Wnt/β catenin signaling pathway, increasing the protein expression of DCLK1 and Wnt, promoting nuclear translocation of β-catenin. High expression of DCLK1 interacts with β-catenin to enhance the functions of β-catenin and TCF4, induce transcription of Wnt target gene c-Myc, encourage the expression of mesenchymal markers N-cadherin, vimentin, and transcription factor Snail, attenuate the expression and in vivo distribution of epithelial marker E-cadherin, and induce the EMT process, thus paving the way for tumor metastasis (Fig. 8).
Fig 8.
Schematic diagram of DCLK1-mediated cooperative acceleration of EMT by ALV-J and MDV via the Wnt/β-catenin pathway promotes tumor metastasis When both viruses infect host cells simultaneously, compared with single-infection, ALV-J and MDV cooperatively activate the host protein DCLK1 and Wnt/β-catenin signaling pathway, increase the expression of the DCLK1 and Wnt proteins, and promote nuclear translocation of β-catenin. High expression of DCLK1 interacts with β-catenin to promote downstream target transcription of the gene c-Myc, encourage the expression of mesenchymal markers N-cadherin, Vimentin, and transcription factor Snail, attenuate the expression and in vivo distribution of epithelial marker E-cadherin, and induce the EMT process, thus paving the way for tumor metastasis.
DISCUSSION
Accumulating evidence has demonstrated that oncoviruses significantly affect metastasis, particularly EMT (9, 32). Early in metastasis, oncoviruses typically accelerate EMT (9, 33). Identification of the role of oncoviruses in the progression of EMT may help elucidate the mechanisms of tumor metastasis. Both ALV-J and MDV are avian oncogenic viruses that primarily cause myelocytomas and lymphocytomas (34, 35). Co-infection with these two viruses cooperatively enhances oncogenicity, resulting in increased mortality among diseased chickens (11). Our findings suggest that co-infection with ALV-J and MDV exacerbates histopathological lesions and accelerates lymphoma formation and metastasis compared with mono-infections. Mortality in diseased chickens is mainly attributed to metastasis and the resultant organ damage (19, 36).
To clarify the influence of ALV-J and MDV on EMT, the expression of EMT marker molecules was detected in cells and tissues co-infected with ALV-J and MDV. ALV-J and MDV activated EMT in vitro and in vivo, indicating that ALV-J and MDV cooperatively participate in the EMT process. E-cadherin is a Ca2+-dependent adhesion molecule that is an essential component of intercellular adhesive junctions (4, 37). One of the characteristic features of EMT is the loss of E-cadherin, which leads to the loss of the ability to maintain cell-to-cell adhesion and integrity and is collaterally linked to tumor metastasis (38, 39). In this study, the expression of E-cadherin was significantly decreased in co-infected cells or tissues compared with that in mono-infected cells or tissues, indicating that ALV-J and MDV co-infection reduces intercellular adhesion, leading to a weakening of intercellular interactions. This disrupts the dynamic balance of the tissue and allows the cells to acquire mobility and invasiveness more efficiently (37, 40), promoting EMT and making the tumor more susceptible to infiltration and metastasis (41).
One of the prerequisites for metastasis is tumor-initiating capacity, which relies on a small proportion of malignant cells, especially cancer stem cells with indefinite self-renewal capacity (19, 42). DCLK1 is a well-known tumor stem cell marker (43, 44) involved in regulating tumorigenesis, which regulates the EMT phenotype and facilitates tumor metastasis (45–49). Here, DCLK1 was highly expressed in DF-1 cells and in chickens co-infected with ALV-J and MDV, indicating that DCLK1 is a key host molecule that mediates the synergistic activation of EMT associated with ALV-J and MDV. However, it remains unclear whether DCLK1 promotes EMT in ALV-J- and MDV-co-infected cells. We found that ectopic expression of DCLK1 promoted the EMT with downregulation of E-cadherin and upregulation of N-cadherin, vimentin and Snail, and promoted the proliferation, migration and invasion of ALV-J and MDV co-infected cells. We further found that the expression of DCLK1-positive cells in the duodenum crypt is particularly obvious in co-infected tissues, whereas intestinal epithelial cell proliferation and differentiation are driven by active stem cells located at the base of crypts (50). The results of previous studies suggest that DCLK1 plays an important role in advancing intestinal tumorigenesis (30). We speculated that after ALV-J and MDV co- infection, high expression of DCLK1 in the intestinal crypt accelerates the proliferation of intestinal epithelial cells. We observed a high degree of overlap in the expression of DCLK1 and PCNA in the intestinal crypt in co-infected chickens. Intestinal crypts contain stem cells that can proliferate and differentiate (51, 52). This suggests that the proliferative potential of DCLK1-positive cells accelerates cell proliferation in tissues co-infected with ALV-J and MDV. This is consistent with previous reports indicating enhanced DCLK1 expression in intestinal tumors, leading to elevated tumor stemness and survival through regulation of prosurvival signaling pathways. Cancer stem cells thus proliferate more rapidly and are more likely to induce tumor metastasis (30). These results revealed that ALV-J and MDV promote EMT by cooperatively activating DCLK1. DCLK1 plays a metastasis-promoting role in ALV-J- and MDV-coinfected tumors.
WISP2, as a marker of classic Wnt/β-catenin activation, plays a vital role in developing the Wnt/β-catenin signaling pathway (53). WISP2 was highly expressed during ALV-J and MDV co-infection, indicating that ALV-J and MDV co-infection activated the Wnt/β-catenin pathway. Once the Wnt ligand binds to the receptor, it triggers Wnt signaling and nuclear translocation of β-catenin (54, 55). Our results show that co-infection with ALV-J and MDV enhanced the protein expression of Wnt and β-catenin in cells and promoted β-catenin transfer from the cytoplasm to the nucleus. Meanwhile, ALV-J and MDV co-infection promoted the expression of β-catenin in the liver, spleen, kidney, and duodenum. ALV-J and MDV co-infection encourages the expression of β-catenin in different tissues and promotes the Wnt/β-catenin signaling pathway. We further elucidated the downstream signaling pathway responsible for DCLK1 oncogenic function. We found that the DCLK1-mediated tumor metastasis was attributable, at least in part, to DCLK1-mediated activation of Wnt/β-catenin signaling, as DCLK1 upregulated the Wnt signaling target gene, c-Myc, in co-infected cells, which is critical for the initiation and progression of ALV-J and MDV (56). DCLK1 acts as an activator to facilitate the Wnt/β-catenin signalling pathway, inducing EMT and tumor metastasis in ALV-J and MDV co-infected cells.
EMT plays a crucial role in the progression and metastasis of various cancers (33, 57, 58), and the Wnt/β-catenin pathway plays an essential role in EMT (29, 59, 60). To have a better understanding of the regulatory relationship between DCLK1, EMT and the Wnt/β-catenin signaling pathway, this study focused on transcriptional changes in β-catenin, a hallmark of the Wnt/β-catenin pathway (61), which is essential for triggering EMT (31). DCLK1 was found to enhance the Wnt/β-catenin pathway. With the altered transcription of β-catenin, the expression of c-Myc and EMT markers changed. The changes in the expression of β-catenin and its downstream molecules as well as EMT markers caused by knockdown of DCLK1 were restored by Wnt/β-catenin pathway activator CHIR99021 (31). During tumor progression, the most prominent of the Wnt/β-catenin signaling pathways is the formation of a complex between TCF/LEF and β-catenin, which is key to the activation of the pathway, thereby causing transcription of downstream target genes (62). β-catenin enters the nucleus and binds to TCF/LEF transcription factors to co-activate a series of target genes, including EMT markers (63). Immunofluorescence showed that DCLK1 and β-catenin had fluorescence overlap in vivo, co-immunoprecipitation results further indicated that DCLK1 interacts physically with β-catenin to enhance the functions of β-catenin, facilitating the formation of the β-catenin–TCF4 complex and inducing transcription of Wnt target genes to promote cell proliferation, migration, invasion, and EMT induction, paving the way for synergistic tumor metastasis, whether DCLK1 can better induce EMT and promote tumor metastasis in vivo needs further investigation.
In summary, our results suggest that ALV-J and MDV cooperatively facilitate DCLK1 expression, a potential mediator of EMT that cooperatively enhances cell proliferation, migration, and invasion, while physically interacting with β-catenin to promote the formation of the β-catenin–TCF4 complex, inducing the transcription of the Wnt target gene c-Myc, and increasing the EMT process, paving the way for tumor metastasis. This study elucidated the molecular mechanism underlying cooperative metastasis induced by co-infection with retrovirus and herpesvirus.
MATERIALS AND METHODS
Cells, viruses, and animals
The DF-1 and HD11 cells, and ALV-J NX0101 and MDV Md5 strains were stored in liquid nitrogen tanks in the laboratory. DF-1 cells were cultured in a complete medium containing 10% FBS with 1% penicillin mixture (final concentration of 100 µg/mL) in a cell culture incubator at 37°C with 5% CO2. Specific pathogen-free (SPF) chicken embryonated eggs were purchased from Jinan Spafas Animal Inc (Spafas, Jinan, China), and hatched chicks were maintained under SPF conditions.
Reverse transcription and quantitative real-time polymerase chain reaction (RT-qRCR)
Total RNA was extracted from cells and tissues and reverse-transcribed to cDNA using an Accurate Biology kit (Hunan, China) according to the manufacturer’s protocol. The PCR mixture contained 10 ng of cDNA, SYBR Green sequence detection reagents (Accurate Biology, Hunan, China), and gene-specific primers, which were assayed using an ABI 7500 sequence detection system (Applied Biosystems). glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primers were designed using Primer 6.0, and all primers were synthesised by Shanghai Sangon Biotech (Table 1). The reactions were run using the following program:1 cycle at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and at 60°C for 34 s, the melting curve was generated at 95°C for 10 s, 65°C for 60 s, and 97°C for 1 s. The primer sequences are presented in Table 1. All assays were performed in triplicates. The 2-ΔΔCt method was used to analyze the data.
TABLE 1.
Primers used for quantitative reverse transcription-PCR
| Gene target | Primer sequence | Fragment size (bp) |
|---|---|---|
| ALV-J | Forward: TGCGTGCGTGGTTATTATTTC Reverse: AATGGTGAGGTCGCTGACTGT |
144 |
| MDV | Forward: GACCGCTTCGCCAACTACATCG Reverse: CCCGCATCTCCTCCTCGTACAG |
133 |
| DCLK1 | Forward: TCAAGAAGCTGGAGTACACGAAGAATG Reverse: CAAGAGACGGCACTGAACGAGAAG |
90 |
| Snail | Forward: TGGTCTGCTCTCCAGCCTCTTC Reverse: CTCTTGCCCTCATCCTCCTCACTAG |
117 |
| Vimentin | Forward: GACCGCTTCGCCAACTACATCG Reverse: CCCGCATCTCCTCCTCGTACAG |
133 |
| N-cadherin | Forward: TGGATGAAGCGCCGTGATAA Reverse: AGGTTTGATGGCGTCTGGTT |
177 |
| E-cadherin | Forward: GAAGACAGCCAAGGGCCTG Reverse: GGGCCGTGTAGGATGTAACC |
224 |
| β-catenin | Forward: AGTCATTGGCAGCAGCAGTCATATC Reverse: TTGCGTTGTGTCCACATCTTCCTC |
120 |
| GAPDH | Forward: GAACATCATCCCAGCGTCCA Reverse: CGGCAGGTCAGGTCAACAAC | 132 |
Western blotting
The total protein lysate was prepared from treated DF-1 cells using a lysis buffer. The protein concentration was measured using a BCA Protein Assay Kit (Beyotime, Shanghai, China). Twenty micrograms of protein was separated on a 10% SDS polyacrylamide gel and transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA). The membranes were blocked in 5% Difco skim milk (Solarbio) at 37°C for 2 h and then incubated with diluted primary antibody at 4°C overnight. The primary antibodies used were rabbit polyclonal anti-DCLK1 (1:800; Abcam, Cambridge, UK), an in-house mouse monoclonal anti-ALV-J gp85 antibody, an in-house mouse monoclonal anti-MDV Meq, rabbit monoclonal anti-N-cadherin antibody (1:1000; Abcam, Cambridge, UK), rabbit monoclonal anti-E-cadherin antibody (1:1000; Abcam, Cambridge, UK), rabbit monoclonal anti-vimentin antibody (1:1000; Abcam, Cambridge, UK), rabbit monoclonal anti-β catenin antibody (1:1000; Cell Signaling Technology, Boston, USA), rabbit monoclonal anti- c-Myc antibody (1:1000; Cell Signaling Technology, Boston, USA), and rabbit monoclonal anti-TCF4 antibody (1:1000; Cell Signaling Technology, Boston, USA). The membranes were then incubated at 37°C for 1 h with a horseradish-peroxidase-conjugated secondary antibody (Abbkine, Beijing, China). The proteins were detected using ECL Western blot detection reagent (Beyotime, Shanghai, China). β-actin (1:2000; Engibody, Milwaukee, USA) was used as a loading control.
Cell proliferation assay
DF-1 cells were inoculated in 96-well plates at a density of 4 × 103 cells/well, and the recombinant pcDNA3.1-DCLK1 plasmid and shRNA targeting DCLK1 were transfected into ALV-J-infected DF-1 cells. Cell Counting Kit-8 (CCK-8; Dojindo, Tokyo, Japan) was used to detect the effect of DCLK1 expression on the proliferation of ALV-J and MDV-co-infected cells. The cells were treated at 37°C for 2 h, and 10 µL CCK-8 reagent was added. The absorbance was measured at 450 nm using a microplate reader (Bio-Rad). Each experimental group had at least nine replicates. The experiment was independently repeated three times. The cell proliferation was calculated by subtracting the absorbance of the sample from that of the medium (background). The relative cell proliferation was normalised to that of the respective controls.
Cell scratch assay
The transfected HD11 was inoculated into a 12-well plate, and when the confluence reached 90%, the culture medium was changed to serum-free DMEM, and the scratch status was recorded by microscope at 0 h, and then recorded at 24 and 48 h, and the wound healing percentage of the scratch was calculated using ImageJ software.
Transwell invasion and migration assay
The transfected HD11cells were resuspended with DMEM, inoculated with 5 × 10*5 cells (serum-free medium) in the upper chamber of the transwell. Uncoated Matrigel (Matrigel, Corning, USA) is used for migration, and coated Matrigel is used for invasion, and 500 µL of medium containing 10% fetal bovine serum was added to the lower chamber of the transwell, and cultured in an incubator for 48 h at 37°C with 5% CO2, then the cells were taken out of the transwell, and those cells that did not traverse the bottom membrane of the transwell were removed from the upper chamber with a swab. The cells in the upper chamber were wiped off with a cotton swab, and then fixed with paraformaldehyde for 30 min and stained with 0.1% crystal violet for 15 min, and three fields were randomly selected from each hole under the microscope to image and count the migrating cells and invading cells.
Immunohistochemistry
To determine the localization of DCLK1 in tissues and cells, IHC was performed according to the following procedure. Tissue sections were dewaxed in xylene and rehydrated in a graded series of ethanol. The slides were subjected to microwave treatment four times in 10 mM citrate buffer (pH = 6) for heat-induced antigen retrieval. After cooling, the slides were incubated in 5% BSA blocking solution at 37°C for 20 min, followed by incubation with the anti-DCLK1 antibod (1:200; Abcam, Cambridge, UK) overnight at 4°C. After washing with phosphate-buffered saline (PBS) three times, the sections were stained with corresponding biotinylated goat secondary antibody for 30 min at room temperature. The sections were again washed with PBS three times, and then incubated with streptavidin peroxidase and DAB substrate. The slides were then counterstained with hematoxylin, subjected to stepwise dehydration with alcohol, and sealed with coverslips. All images were taken under a Nikon Eclipse TE2000-S microscope using the cellSens Imaging software.
Immunofluorescence
Frozen sections of tissues were incubated with anti-DCLK1 polyclonal antibody (1:100), anti-E-cadherin rabbit monoclonal (1:200) and anti-anti-β-catenin rabbit monoclonal (1:200) at 4°C overnight. The sections were then washed three times with PBS, and incubated with FITC-labeled goat anti-rabbit IgG (H + L) (1:500) and CY3-labeled goat anti-rabbit IgG (H + L) (1:500) at 37°C for 1 h. The nuclei of the infected cells were stained with 4',6-diamidino-2-phenylindole (DAPI). Finally, the sections were examined under a laser confocal microscope (Leica SP8; Berlin, Germany).
Co-immunoprecipitation assay
The DF-1 cells were seeded in 12-well plates. After transfection with the pcDNA3.1-DCLK1 plasmid, the cells were infected with ALV-J (103.8 TCID50) and MDV (200 PFU). A pellet consisting of 4 × 106 cells was resuspended in 600 µL lysis/equilibration buffer containing 6 µL protease inhibitor cocktail. The recommended amount of antibody was incubated with clarified cell lysates for 1 h at 4°C. The immunoprecipitate was washed three times with Tris-HCl buffer solution-Tween 20 (TBST). Samples were analyzed using SDS-PAGE and Western blotting.
Overexpression and RNA interference of DCLK1
The DCLK1 overexpression vector (pcDNA3.1-DCLK1) and negative control (NC) vectors as well as the pGPU6/GFP/Neo-DCLK1 and empty pGPU6/GFP/Neo plasmids were constructed by GenePharma (Shanghai, China). Target shRNA sequences for DCLK1 were as follows:5′-GGCCTAAACTAGTCACTATCA-3′ (shDCLK1-1) and 5′- GAGTCAAGCATCCCAATATTG-3′ (shDCLK1-2). To clarify the effect of DCLK1 on ALV-J and MDV co-infection, DF-1 or HD11 cells were seeded on 12-well-plates for 12 h and transfected with pcDNA3.1-DCLK1, shDCLK1-1, shDCLK1-2, and sh-NC (150 nM) using the Lipofectamine 3000 transfection reagent, according to the manufacturer’s instructions. The mRNA and protein levels of DCLK1, ALV-J, and MDV were determined by qPCR and Western blot analysis at 72 h post co-infection with ALV-J and MDV.
Statistical analysis
Statistical analysis was performed using SPSS software. The qPCR experiments were repeated at least three times. Comparisons of more than two groups of data were performed using univariate or multivariate ANOVA, and multiple comparison correction was performed. *, P < 0.05; **, P < 0.01. All data are expressed as mean ± standard deviation (SD).
ACKNOWLEDGMENTS
The work was supported by grants from the Natural Science Foundation of China (32302836); China Postdoctoral Science Foundation (2023M742151); Natural Science Foundation project of Shandong Province (ZR2023QC151); Natural Science Foundation project of Shandong Province (ZR2023MC214); Shandong Modern Agricultural Technology & In-dustry System (No. SDAIT-11–04); and the Tibet projects (QYXTZX-RKZ2020-01).
Z.C. and J.Z. designed experiments; Z.C., J.Z., and D.Z. secured funding; J.Z. performed the experiments, analyzed data, and wrote the manuscript; Z.C. conceived the study and wrote the manuscript; Q.Z., X.Z., X.L., L.D., J.W., and X.X. provided techniques assistant. All authors read and approved the final version.
Contributor Information
Ziqiang Cheng, Email: czqsd@126.com.
Viviana Simon, Icahn School of Medicine at Mount Sinai, New York, New York, USA.
DATA AVAILABILITY
The data that support the findings of this study are available from the corresponding author upon reasonable request.
ETHICS APPROVAL
The SPF chicken model was established according to the guidelines of the Animal Protection and Utilization Committee of Shandong Agricultural University (license number 020861), SDAU 18-196, 7 July 2018.
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/jvi.01112-24.
Figures S1 and S2.
Proteomics data.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Neelakantan D, Zhou H, Oliphant MUJ, Zhang X, Simon LM, Henke DM, Shaw CA, Wu MF, Hilsenbeck SG, White LD, Lewis MT, Ford HL. 2017. EMT cells increase breast cancer metastasis via paracrine GLI activation in neighbouring tumour cells. Nat Commun 8:15773. doi: 10.1038/ncomms15773 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Shibue T, Weinberg RA. 2017. EMT, CSCs, and drug resistance: the mechanistic link and clinical implications. Nat Rev Clin Oncol 14:611–629. doi: 10.1038/nrclinonc.2017.44 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Nieto MA, Huang R-J, Jackson RA, Thiery JP. 2016. EMT: 2016. Cell 166:21–45. doi: 10.1016/j.cell.2016.06.028 [DOI] [PubMed] [Google Scholar]
- 4. Yang J, Antin P, Berx G, Blanpain C, Brabletz T, Bronner M, Campbell K, Cano A, Casanova J, Christofori G, et al. 2020. Guidelines and definitions for research on epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 21:341–352. doi: 10.1038/s41580-020-0237-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Cheng Y-M, Chou C-Y, Hsu Y-C, Chen M-J, Wing L-Y. 2012. The role of human papillomavirus type 16 E6/E7 oncoproteins in cervical epithelial-mesenchymal transition and carcinogenesis. Oncol Lett 3:667–671. doi: 10.3892/ol.2011.512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Gaur N, Gandhi J, Robertson ES, Verma SC, Kaul R. 2015. Epstein-Barr virus latent antigens EBNA3C and EBNA1 modulate epithelial to mesenchymal transition of cancer cells associated with tumor metastasis. Tumour Biol 36:3051–3060. doi: 10.1007/s13277-014-2941-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Liu L, Dong Z, Liang J, Cao C, Sun J, Ding Y, Wu D. 2014. As an independent prognostic factor, FAT10 promotes hepatitis B virus-related hepatocellular carcinoma progression via Akt/GSK3β pathway. Oncogene 33:909–920. doi: 10.1038/onc.2013.236 [DOI] [PubMed] [Google Scholar]
- 8. Akkari L, Grégoire D, Floc’h N, Moreau M, Hernandez C, Simonin Y, Rosenberg AR, Lassus P, Hibner U. 2012. Hepatitis C viral protein NS5A induces EMT and participates in oncogenic transformation of primary hepatocyte precursors. J Hepatol 57:1021–1028. doi: 10.1016/j.jhep.2012.06.027 [DOI] [PubMed] [Google Scholar]
- 9. Chen X, Bode AM, Dong Z, Cao Y. 2016. The epithelial-mesenchymal transition (EMT) is regulated by oncoviruses in cancer. FASEB J 30:3001–3010. doi: 10.1096/fj.201600388R [DOI] [PubMed] [Google Scholar]
- 10. Zhou J, Zhao GL, Wang XM, Du XS, Su S, Li CG, Nair V, Yao YX, Cheng ZQ. 2018. Synergistic viral replication of Marek's disease virus and avian leukosis virus subgroup J is responsible for the enhanced pathogenicity in the superinfection of chickens. Viruses 10:271. doi: 10.3390/v10050271 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Li H, Wang P, Lin L, Shi M, Gu Z, Huang T, Mo M-L, Wei T, Zhang H, Wei P. 2019. The emergence of the infection of subgroup J avian leucosis virus escalated the tumour incidence in commercial Yellow chickens in Southern China in recent years. Transbound Emerg Dis 66:312–316. doi: 10.1111/tbed.13023 [DOI] [PubMed] [Google Scholar]
- 12. Li T, Xie J, Liang G, Ren D, Sun S, Lv L, Xie Q, Shao H, Gao W, Qin A, Ye J. 2019. Co-infection of vvMDV with multiple subgroups of avian leukosis viruses in indigenous chicken flocks in China. BMC Vet Res 15:288. doi: 10.1186/s12917-019-2041-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Payne LN, Nair V. 2012. The long view: 40 years of avian leukosis research. Avian Pathol 41:11–19. doi: 10.1080/03079457.2011.646237 [DOI] [PubMed] [Google Scholar]
- 14. Calnek BW. 2001. Pathogenesis of Marek's disease virus infection. Curr Top Microbiol Immunol 255:25–55. doi: 10.1007/978-3-642-56863-3_2 [DOI] [PubMed] [Google Scholar]
- 15. Payne LN, Gillespie AM, Howes K. 1992. Myeloid leukaemogenicity and transmission of the HPRS-103 strain of avian leukosis virus. Leukemia 6:1167–1176. [PubMed] [Google Scholar]
- 16. Osterrieder N, Kamil JP, Schumacher D, Tischer BK, Trapp S. 2006. Marek’s disease virus: from miasma to model. Nat Rev Microbiol 4:283–294. doi: 10.1038/nrmicro1382 [DOI] [PubMed] [Google Scholar]
- 17. Wang Y, Li J, Gao Y, Luo Y, Luo H, Wang L, Yi Y, Yuan Z, Jim Xiao ZX. 2019. Hippo kinases regulate cell junctions to inhibit tumor metastasis in response to oxidative stress. Redox Biol 26:101233. doi: 10.1016/j.redox.2019.101233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Li X, Li Y, Lu W, Chen M, Ye W, Zhang D. 2019. The tumor vessel targeting strategy: a double-edged sword in tumor metastasis. Cells 8:1602. doi: 10.3390/cells8121602 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Gupta GP, Massagué J. 2006. Cancer metastasis: building a framework. Cell 127:679–695. doi: 10.1016/j.cell.2006.11.001 [DOI] [PubMed] [Google Scholar]
- 20. Hanahan D, Weinberg RA. 2011. Hallmarks of cancer: the next generation. Cell 144:646–674. doi: 10.1016/j.cell.2011.02.013 [DOI] [PubMed] [Google Scholar]
- 21. Echeverria GV, Powell E, Seth S, Ge Z, Carugo A, Bristow C, Peoples M, Robinson F, Qiu H, Shao J, Jeter-Jones SL, Zhang X, Ramamoorthy V, Cai S, Wu W, Draetta G, Moulder SL, Symmans WF, Chang JT, Heffernan TP, Piwnica-Worms H. 2018. High-resolution clonal mapping of multi-organ metastasis in triple negative breast cancer. Nat Commun 9:5079. doi: 10.1038/s41467-018-07406-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Xie Q, Chen L, Shan X, Shan X, Tang J, Zhou F, Chen Q, Quan H, Nie D, Zhang W, Huang AL, Tang N. 2014. Epigenetic silencing of SFRP1 and SFRP5 by hepatitis B virus X protein enhances hepatoma cell tumorigenicity through Wnt signaling pathway. Int J Cancer 135:635–646. doi: 10.1002/ijc.28697 [DOI] [PubMed] [Google Scholar]
- 23. Zhou J, Zhou D, Du X, Xue J, Yang J, Wang G, Cheng Z. 2022. Interaction between avian leukosis virus subgroup J surface protein and doublecortin-like kinase 1 accelerates cell proliferation and epithelial-mesenchymal transition. J Virol 96:e0165721. doi: 10.1128/JVI.01657-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Chandrakesan P, Panneerselvam J, Qu D, Weygant N, May R, Bronze MS, Houchen CW. 2016. Regulatory roles of Dclk1 in epithelial mesenchymal transition and cancer stem cells. J Carcinog Mutagen 7:257. doi: 10.4172/2157-2518.1000257 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Ding L, Yang Y, Ge Y, Lu Q, Yan Z, Chen X, Du J, Hafizi S, Xu X, Yao J, Liu J, Cao Z, Weygant N. 2021. Inhibition of DCLK1 with DCLK1-IN-1 suppresses renal cell carcinoma invasion and stemness and promotes cytotoxic T-cell-mediated anti-tumor immunity. Cancers (Basel) 13:5729. doi: 10.3390/cancers13225729 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Weygant N, Qu D, Berry WL, May R, Chandrakesan P, Owen DB, Sureban SM, Ali N, Janknecht R, Houchen CW. 2014. Small molecule kinase inhibitor LRRK2-IN-1 demonstrates potent activity against colorectal and pancreatic cancer through inhibition of doublecortin-like kinase 1. Mol Cancer 13:103. doi: 10.1186/1476-4598-13-103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Dai T, Hu Y, Lv F, Ozawa T, Sun X, Huang J, Han X, Kishi H, Muraguchi A, Jin A. 2018. Analysis of the clinical significance of DCLK1+ colorectal cancer using novel monoclonal antibodies against DCLK1. Onco Targets Ther 11:5047–5057. doi: 10.2147/OTT.S169928 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Ferguson FM, Nabet B, Raghavan S, Liu Y, Leggett AL, Kuljanin M, Kalekar RL, Yang A, He S, Wang J, et al. 2020. Discovery of a selective inhibitor of doublecortin like kinase 1. Nat Chem Biol 16:635–643. doi: 10.1038/s41589-020-0506-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Li Q, Lai Q, He C, Fang Y, Yan Q, Zhang Y, Wang X, Gu C, Wang Y, Ye L, Han L, Lin X, Chen J, Cai J, Li A, Liu S. 2019. RUNX1 promotes tumour metastasis by activating the Wnt/β-catenin signalling pathway and EMT in colorectal cancer. J Exp Clin Cancer Res 38:334. doi: 10.1186/s13046-019-1330-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Chandrakesan P, Yao J, Qu D, May R, Weygant N, Ge Y, Ali N, Sureban SM, Gude M, Vega K, Bannerman-Menson E, Xia L, Bronze M, An G, Houchen CW. 2017. Dclk1, a tumor stem cell marker, regulates pro-survival signaling and self-renewal of intestinal tumor cells. Mol Cancer 16:30. doi: 10.1186/s12943-017-0594-y [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 31. Liu F, Xia Z, Zhang M, Ding J, Feng Y, Wu J, Dong Y, Gao W, Han Z, Liu Y, Yao Y, Li D. 2019. SMARCAD1 promotes pancreatic cancer cell growth and metastasis through Wnt/β-catenin-mediated EMT. Int J Biol Sci 15:636–646. doi: 10.7150/ijbs.29562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Jha HC, Sun Z, Upadhyay SK, El-Naccache DW, Singh RK, Sahu SK, Robertson ES. 2016. KSHV-mediated regulation of Par3 and SNAIL contributes to B-cell proliferation. PLoS Pathog 12:e1005801. doi: 10.1371/journal.ppat.1005801 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Bakir B, Chiarella AM, Pitarresi JR, Rustgi AK. 2020. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol 30:764–776. doi: 10.1016/j.tcb.2020.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Duan Y, Cao L, Yuan C, Suo X, Kong X, Gao Y, Li X, Zheng H, Wang X, Wang Q. 2022. Novel function of avian p53 in binding to ALV-J LTR contributes to its antiviral roles. mBio 13:e0328721. doi: 10.1128/mbio.03287-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Liao Y, Lupiani B, Bajwa K, Khan OA, Izumiya Y, Reddy SM. 2020. Role of Marek's disease virus (MDV)-encoded US3 serine/threonine protein kinase in regulating MDV Meq and cellular CREB phosphorylation. J Virol 94:e00892-20. doi: 10.1128/JVI.00892-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Steeg PS. 2006. Tumor metastasis: mechanistic insights and clinical challenges. Nat Med 12:895–904. doi: 10.1038/nm1469 [DOI] [PubMed] [Google Scholar]
- 37. Gheldof A, Berx G. 2013. Cadherins and epithelial-to-mesenchymal transition. Prog Mol Biol Transl Sci 116:317–336. doi: 10.1016/B978-0-12-394311-8.00014-5 [DOI] [PubMed] [Google Scholar]
- 38. Zhang H, Tang QF, Sun MY, Zhang CY, Zhu JY, Shen YL, Zhao B, Shao ZY, Zhang LJ, Zhang H. 2018. ARHGAP9 suppresses the migration and invasion of hepatocellular carcinoma cells through up-regulating FOXJ2/E-cadherin. Cell Death Dis 9:916. doi: 10.1038/s41419-018-0976-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Thiery JP, Acloque H, Huang RYJ, Nieto MA. 2009. Epithelial-mesenchymal transitions in development and disease. Cell 139:871–890. doi: 10.1016/j.cell.2009.11.007 [DOI] [PubMed] [Google Scholar]
- 40. Kaszak I, Witkowska-Piłaszewicz O, Niewiadomska Z, Dworecka-Kaszak B, Ngosa Toka F, Jurka P. 2020. Role of cadherins in cancer-a review. Int J Mol Sci 21:7624. doi: 10.3390/ijms21207624 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Loh CY, Chai JY, Tang TF, Wong WF, Sethi G, Shanmugam MK, Chong PP, Looi CY. 2019. The E-cadherin and N-cadherin switch in epithelial-to-mesenchymal transition: signaling, therapeutic implications, and challenges. Cells 8:1118. doi: 10.3390/cells8101118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Pardal R, Clarke MF, Morrison SJ. 2003. Applying the principles of stem-cell biology to cancer. Nat Rev Cancer 3:895–902. doi: 10.1038/nrc1232 [DOI] [PubMed] [Google Scholar]
- 43. Mirzaei A, Tavoosidana G, Modarressi MH, Rad AA, Fazeli MS, Shirkoohi R, Tavakoli-Yaraki M, Madjd Z. 2015. Upregulation of circulating cancer stem cell marker, DCLK1 but not Lgr5, in chemoradiotherapy-treated colorectal cancer patients. Tumour Biol 36:4801–4810. doi: 10.1007/s13277-015-3132-9 [DOI] [PubMed] [Google Scholar]
- 44. Mohammadi Y, Tavangar SM, Saidijam M, Amini R, Etemadi K, Karimi Dermani F, Najafi R. 2018. DCLK1 plays an important role in colorectal cancer tumorgenesis through the regulation of miR-200c. Biomed Pharmacother 103:301–307. doi: 10.1016/j.biopha.2018.04.042 [DOI] [PubMed] [Google Scholar]
- 45. Zhao H, Duan Q, Zhang Z, Li H, Wu H, Shen Q, Wang C, Yin T. 2017. Up-regulation of glycolysis promotes the stemness and EMT phenotypes in gemcitabine-resistant pancreatic cancer cells. J Cell Mol Med 21:2055–2067. doi: 10.1111/jcmm.13126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Sureban SM, May R, Lightfoot SA, Hoskins AB, Lerner M, Brackett DJ, Postier RG, Ramanujam R, Mohammed A, Rao CV, Wyche JH, Anant S, Houchen CW. 2011. DCAMKL-1 regulates epithelial-mesenchymal transition in human pancreatic cells through a miR-200a-dependent mechanism. Cancer Res 71:2328–2338. doi: 10.1158/0008-5472.CAN-10-2738 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Ito H, Tanaka S, Akiyama Y, Shimada S, Adikrisna R, Matsumura S, Aihara A, Mitsunori Y, Ban D, Ochiai T, Kudo A, Arii S, Yamaoka S, Tanabe M. 2016. Dominant expression of DCLK1 in human pancreatic cancer stem cells accelerates tumor invasion and metastasis. PLoS One 11:e0146564. doi: 10.1371/journal.pone.0146564 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Chandrakesan P, Roy B, Jakkula L, Ahmed I, Ramamoorthy P, Tawfik O, Papineni R, Houchen C, Anant S, Umar S. 2014. Utility of a bacterial infection model to study epithelial-mesenchymal transition, mesenchymal-epithelial transition or tumorigenesis. Oncogene 33:2639–2654. doi: 10.1038/onc.2013.210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Cao Z, Weygant N, Chandrakesan P, Houchen CW, Peng J, Qu D. 2020. Tuft and cancer stem cell marker DCLK1: a new target to enhance anti-tumor immunity in the tumor microenvironment. Cancers (Basel) 12:3801. doi: 10.3390/cancers12123801 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Fitzgerald SF, Beckett AE, Palarea-Albaladejo J, McAteer S, Shaaban S, Morgan J, Ahmad NI, Young R, Mabbott NA, Morrison L, Bono JL, Gally DL, McNeilly TN. 2019. Shiga toxin sub-type 2a increases the efficiency of Escherichia coli O157 transmission between animals and restricts epithelial regeneration in bovine enteroids. PLoS Pathog 15:e1008003. doi: 10.1371/journal.ppat.1008003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. McCarthy N, Manieri E, Storm EE, Saadatpour A, Luoma AM, Kapoor VN, Madha S, Gaynor LT, Cox C, Keerthivasan S, Wucherpfennig K, Yuan G-C, de Sauvage FJ, Turley SJ, Shivdasani RA. 2020. Distinct mesenchymal cell populations generate the essential intestinal BMP signaling gradient. Cell Stem Cell 26:391–402. doi: 10.1016/j.stem.2020.01.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Couesnon A, Molgó J, Connan C, Popoff MR, Blanke SR. 2012. Preferential entry of botulinum neurotoxin A Hc domain through intestinal crypt cells and targeting to cholinergic neurons of the mouse intestine. PLoS Pathog 8:e1002583. doi: 10.1371/journal.ppat.1002583 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Grünberg JR, Hammarstedt A, Hedjazifar S, Smith U. 2014. The novel secreted adipokine WNT1-inducible signaling pathway protein 2 (WISP2) is a mesenchymal cell activator of canonical WNT. J Biol Chem 289:6899–6907. doi: 10.1074/jbc.M113.511964 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Zhan T, Rindtorff N, Boutros M. 2017. Wnt signaling in cancer. Oncogene 36:1461–1473. doi: 10.1038/onc.2016.304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. MacDonald BT, Tamai K, He X. 2009. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17:9–26. doi: 10.1016/j.devcel.2009.06.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Xu Y, Yu Q, Wang P, Wu Z, Zhang L, Wu S, Li M, Wu B, Li H, Zhuang H, Zhang X, Huang Y, Gan X, Xu R. 2022. A selective small-molecule c-Myc degrader potently regresses lethal c-Myc overexpressing tumors. Adv Sci (Weinh) 9:e2104344. doi: 10.1002/advs.202104344 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Rhim AD, Mirek ET, Aiello NM, Maitra A, Bailey JM, McAllister F, Reichert M, Beatty GL, Rustgi AK, Vonderheide RH, Leach SD, Stanger BZ. 2012. EMT and dissemination precede pancreatic tumor formation. Cell 148:349–361. doi: 10.1016/j.cell.2011.11.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Liu Y, Xue M, Du S, Feng W, Zhang K, Zhang L, Liu H, Jia G, Wu L, Hu X, Chen L, Wang P. 2019. Competitive endogenous RNA is an intrinsic component of EMT regulatory circuits and modulates EMT. Nat Commun 10:1637. doi: 10.1038/s41467-019-09649-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Liu CC, Cai DL, Sun F, Wu ZH, Yue B, Zhao SL, Wu XS, Zhang M, Zhu XW, Peng ZH, Yan DW. 2017. FERMT1 mediates epithelial-mesenchymal transition to promote colon cancer metastasis via modulation of β-catenin transcriptional activity. Oncogene 36:1779–1792. doi: 10.1038/onc.2016.339 [DOI] [PubMed] [Google Scholar]
- 60. Yang S, Liu Y, Li MY, Ng CSH, Yang SL, Wang S, Zou C, Dong Y, Du J, Long X, Liu LZ, Wan IYP, Mok T, Underwood MJ, Chen GG. 2017. FOXP3 promotes tumor growth and metastasis by activating Wnt/β-catenin signaling pathway and EMT in non-small cell lung cancer. Mol Cancer 16:124. doi: 10.1186/s12943-017-0700-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Clevers H, Nusse R. 2012. Wnt/β-catenin signaling and disease. Cell 149:1192–1205. doi: 10.1016/j.cell.2012.05.012 [DOI] [PubMed] [Google Scholar]
- 62. Narasipura SD, Henderson LJ, Fu SW, Chen L, Kashanchi F, Al-Harthi L. 2012. Role of β-catenin and TCF/LEF family members in transcriptional activity of HIV in astrocytes. J Virol 86:1911–1921. doi: 10.1128/JVI.06266-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Doumpas N, Lampart F, Robinson MD, Lentini A, Nestor CE, Cantù C, Basler K. 2019. TCF/LEF dependent and independent transcriptional regulation of Wnt/β-catenin target genes. EMBO J 38:e98873. doi: 10.15252/embj.201798873 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figures S1 and S2.
Proteomics data.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.