Activity and cryo-EM structure of the polymerase domain of the human norovirus ProPol precursor

Alice M McSweeney; Alice-Roza Eruera; Geena M McKenzie-Goldsmith; James C Bouwer; Simon H J Brown; Louise A Stubbing; Jonathan G Hubert; Rinu Shrestha; Kevin J Sparrow; Margaret A Brimble; Lawrence D Harris; Gary B Evans; Mihnea Bostina; Kurt L Krause; Vernon K Ward

doi:10.1128/jvi.01193-24

. 2024 Oct 30;98(11):e01193-24. doi: 10.1128/jvi.01193-24

Activity and cryo-EM structure of the polymerase domain of the human norovirus ProPol precursor

Alice M McSweeney ^1,^#, Alice-Roza Eruera ^1,^2,^#, Geena M McKenzie-Goldsmith ¹, James C Bouwer ³, Simon H J Brown ³, Louise A Stubbing ⁴, Jonathan G Hubert ⁴, Rinu Shrestha ⁵, Kevin J Sparrow ⁵, Margaret A Brimble ⁴, Lawrence D Harris ⁵, Gary B Evans ⁵, Mihnea Bostina ¹, Kurt L Krause ², Vernon K Ward ^1,^✉

Editor: Stacey Schultz-Cherry⁶

¹Department of Microbiology and Immunology, School of Biomedical Sciences, University of Otago, Dunedin, New Zealand

²Department of Biochemistry, School of Biomedical Sciences, University of Otago, Dunedin, New Zealand

³School of Chemistry and Molecular Bioscience, Molecular Horizons, and Australian Research Council Centre for Cryo-electron Microscopy of Membrane Proteins, University of Wollongong, Wollongong, New South Wales, Australia

⁴School of Chemical Sciences, The University of Auckland, Auckland, New Zealand

⁵Ferrier Research Institute, Victoria University of Wellington, Lower Hutt, New Zealand

⁶St. Jude Children's Research Hospital, Memphis, Tennessee, USA

^✉

Address correspondence to Vernon K. Ward, vernon.ward@otago.ac.nz

Alice M. McSweeney and Alice-Roza Eruera contributed equally to this article. A.M.M. and A-.R.E. had equal research input, and A.M.M. performed the majority of drafting and writing; author order was decided on this basis.

The authors declare no conflict of interest.

Contributed equally.

Roles

Alice M McSweeney: Conceptualization, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing

Alice-Roza Eruera: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing

Geena M McKenzie-Goldsmith: Investigation, Methodology, Writing – review and editing

James C Bouwer: Investigation, Methodology, Resources, Writing – review and editing

Simon H J Brown: Investigation, Methodology, Resources, Writing – review and editing

Louise A Stubbing: Investigation, Resources, Writing – review and editing

Jonathan G Hubert: Investigation, Resources, Writing – review and editing

Rinu Shrestha: Investigation, Resources, Writing – review and editing

Kevin J Sparrow: Investigation, Resources, Writing – review and editing

Margaret A Brimble: Funding acquisition, Resources, Supervision, Writing – review and editing

Lawrence D Harris: Funding acquisition, Resources, Supervision, Writing – review and editing

Gary B Evans: Funding acquisition, Resources, Supervision, Writing – review and editing

Mihnea Bostina: Resources, Supervision, Writing – review and editing

Kurt L Krause: Conceptualization, Project administration, Resources, Supervision, Writing – review and editing, Funding acquisition

Vernon K Ward: Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – review and editing

Stacey Schultz-Cherry: Editor

PMCID: PMC11575396 PMID: 39475276

ABSTRACT

Human norovirus (HuNV) is a leading cause of acute gastroenteritis worldwide with most infections caused by genogroup I and genogroup II (GII) viruses. Replication of HuNV generates both precursor and mature proteins during processing of the viral polyprotein that are essential to the viral lifecycle. One such precursor is protease-polymerase (ProPol), a multi-functional enzyme comprised of the norovirus protease and polymerase proteins. This work investigated HuNV ProPol by determining the de novo polymerase activity, protein structure, and antiviral inhibition profile. The GII ProPol de novo enzymatic efficiencies (k_cat/K_m) for RNA templates and ribonucleotides were equal or superior to those of mature GII Pol on all templates measured. Furthermore, GII ProPol was the only enzyme form active on a poly(A) template. The first structure of the polymerase domain of HuNV ProPol in the unliganded state was determined by cryo-electron microscopy at a resolution of 2.6 Å. The active site and overall architecture of ProPol are similar to those of mature Pol. In addition, both galidesivir triphosphate and PPNDS inhibited polymerase activity of GII ProPol, with respective half-maximal inhibitory concentration (IC₅₀) values of 247.5 µM and 3.8 µM. In both instances, the IC₅₀ obtained with ProPol was greater than that of mature Pol, indicating that ProPol can exhibit different responses to antivirals. This study provides evidence that HuNV ProPol possesses overlapping and unique enzyme properties compared with mature Pol and will aid our understanding of the replication cycle of the virus.

IMPORTANCE

Despite human norovirus (HuNV) being a leading cause of acute gastroenteritis, the molecular mechanisms surrounding replication are not well understood. Reports have shown that HuNV replication generates precursor proteins from the viral polyprotein, one of which is the protease-polymerase (ProPol). This precursor is important for viral replication; however, the polymerase activity and structural differences between the precursor and mature forms of the polymerase remain to be determined. We show that substrate specificity and polymerase activity of ProPol overlap with, but is distinct from, the mature polymerase. We employ cryo-electron microscopy to resolve the first structure of the polymerase domain of ProPol. This shows a polymerase architecture similar to mature Pol, indicating that the interaction of the precursor with substrates likely defines its activity. We also show that ProPol responds differently to antivirals than mature polymerase. Altogether, these findings enhance our understanding of the function of the important norovirus ProPol precursor.

KEYWORDS: norovirus, ProPol, polymerase, precursor protein

INTRODUCTION

The norovirus genus in the Caliciviridae family is classified into at least 10 genogroups (GI-GX) infecting humans, mice, cattle, pigs, and dogs (1 –5). Human norovirus (HuNV) is a leading cause of acute gastroenteritis worldwide, with an estimated 685 million cases each year, the majority of which are caused by genogroup I (GI) and genogroup II (GII) viruses (6, 7). Despite the significant burden imposed by these viruses, there are currently no approved vaccines or antivirals available to treat GI or GII HuNV. Advances in culturing of the virus in stem cell-derived human enteroids and zebrafish larvae have increased our ability to directly study HuNV (8 –10). However, the historical lack of culture systems has limited our understanding of the replication mechanisms of noroviruses.

HuNV consists of a positive-sense single-stranded ~7.5 kb RNA genome that is covalently linked to viral protein genome-linked (VPg) at the 5′-end and polyadenylated at the 3′-end. The genome is organized into three open-reading frames (ORF), which give rise to the non-structural (ORF1) and structural (ORF2 and ORF3) proteins. ORF1 is translated as a single polyprotein that is processed into the mature non-structural proteins: NS1-2 (N-term), NS3 (NTPase), NS4, NS5 (VPg), NS6 (protease, Pro), and NS7 (polymerase, Pol). Because the protease cleavage sites between these mature proteins are recognized with varying efficiencies, several precursor proteins are generated during replication, one of which is the protease-polymerase (ProPol) protein (11, 12).

Precursor proteins often perform alternate functions to mature proteins, thereby helping to maximize the limited coding capacity of the viral genome (13 –16). Norovirus ProPol possesses protease, polymerase, and nucleotidylylation activities that are all essential for viral replication (11, 17 –19). Enzymatically active ProPol proteins have been characterized in other caliciviruses including rabbit hemorrhagic disease virus (RHDV) (lagovirus) and feline calicivirus (vesivirus), indicating that the presence of the precursor protein is conserved in the Caliciviridae family (20, 21). An analogous but well-characterized protein, 3CD, is produced by viruses in the Picornaviridae family, although, 3CD is only active as a protease and does not possess polymerase activity (16).

As a protease, norovirus ProPol displays alternate substrate preferences to mature Pro, likely contributing to early and late polyprotein processing (22, 23). HuNV Pro has been shown to bind RNA sequences representing the 5′ or 3′ genome ends (24). This interaction inhibits protease activity of both Pro and ProPol, with the most potent inhibition occurring with longer lengths of RNA (24).

Norovirus ProPol and Pol are both active polymerase enzymes and can perform RNA synthesis in either a primed or de novo manner (17, 25, 26). Mature HuNV Pol has been shown to possess de novo polymerase activity on a poly(C) RNA template but was inactive with other homopolymeric templates (26). Both HuNV ProPol and Pol can perform nucleotidylylation of VPg in vitro; however, ProPol is 100-fold more active than mature Pol (18). Similarly, RHDV ProPol is up to 13-fold more active than Pol in in vitro nucleotidylylation assays (20), further illustrating functional differences between mature and precursor polymerase enzymes within the Caliciviridae family.

The closest relevant atomic structure to ProPol is a 3.4 Å resolution crystal structure of a mutant poliovirus 3CD (PDB code: 2IJD) (27). However, the proteins are functionally distinct and there is limited amino acid sequence similarity between the two enzymes (~30%); therefore the poliovirus 3CD structure is of limited utility for exploring norovirus ProPol function and activity. Structural studies on norovirus enzymes have focused on mature Pro and Pol (28 –32). Indeed, several crystal structures of HuNV mature Pol have been solved, including ligand-free and drug-bound polymerases (PDB: 4LQ3, 4NRT, and 5TSN) (33 –35). These structures reveal that HuNV Pol is highly structurally conserved with other Group 1 RNA polymerases, possessing a semi-closed right-hand architecture with thumb, palm, and fingers domains (31, 36). The fingers and thumb domains are connected by a series of loop and turn structures, which form a bridge, and the palm domain is lined with well-established motifs designated A-G, which are important for polymerase activity (37). Interestingly, the currently resolved structures of mature Pol and VPg are incompatible for nucleotidylylation without a major conformational change in one or both proteins, although ProPol is primarily responsible for nucleotidylylation (18, 38). In the absence of a ProPol structure, inhibitor design and screening studies necessarily resort to using mature Pol structures as a model (31, 36, 39, 40).

This work aimed to expand our understanding of the polymerase activity of HuNV ProPol, by investigating the ability of different RNA substrates to act as polymerase templates, determine a 3D structure of the polymerase precursor, and measure inhibition by select antivirals. Our results demonstrate that GII ProPol displays polymerase activity with a broader range of RNA templates and has kinetic parameters that are equal or superior to GII Pol, except for the k_cat for GTP. We present the first structure of the polymerase domain of GII.4 Sydney 2012 HuNV ProPol without substrate, solved by cryo-electron microscopy (cryo-EM). Finally, we show that antiviral compounds targeting mature Pol can also inhibit ProPol, albeit with different efficacies. Overall, while there are similarities between ProPol and Pol, the enzymes have distinct polymerase activities that are essential to the replication of the virus.

RESULTS

Norovirus ProPol initiates de novo RNA synthesis on homopolymeric RNA templates

ProPol and Pol proteins from GI Southampton and GII.4 Sydney 2012 HuNVs were expressed using the SUMO Cloning and Expression System (Lucigen) to obtain native ProPol and Pol without additional N- or C-terminal amino acids, at ~76 kDa and ~57 kDa, respectively (Fig. 1A and C). To investigate de novo polymerase activity on homopolymeric RNA templates, 1 µM of either ProPol or Pol from GI and GII noroviruses was incubated in a standard polymerase reaction for 60 min. The fold change in relative fluorescent units (RFU) relative to an RNA-only control was calculated to measure formation of dsRNA.

Protein gel bands for GI and GII polymerase and protease-polymerase precursor. Bar graphs of ProPol and Pol activties with different types of RNA, show as fold change relative to RNA only. — *De novo* polymerase activity on homopolymeric RNA templates. (**A and C**) SDS-PAGE analysis of purified GI and GII ProPol and Pol proteins. (**B and D**) Polymerase activity in the presence of 1 µM enzyme, 20 ng/µL template, and 0.5 mM nucleotide triphosphate (NTP) for 60 min. Fold change relative to an RNA-only control was calculated for each template. Results represent the mean and SD of three independent reactions. Data were analyzed by two-tailed unpaired t-test, **P < 0.01, *P < 0.05, and not significant (ns) = P > 0.05.

Both the GI and GII versions of ProPol and Pol were active on a poly(C) RNA template, with no statistical significance between the two enzymes (Fig. 1B and D). The GI enzymes showed negligible activity on poly(A), poly(U), and poly(G) templates that was insufficient for further kinetic analysis (Fig. 1B). In contrast, GII ProPol and Pol were both active with a poly(U) template, with a 32-fold and 18-fold increase, respectively, over RNA only (Fig. 1D). Only GII ProPol was active with a poly(A) template, GII Pol did not show activity on a poly(A) template. As with the GI proteins, GII ProPol and Pol did not show observable activity with a poly(G) template (Fig. 1D). Overall, this shows that GII ProPol and Pol have different template preferences to GI enzymes. In addition, unlike the mature GII Pol, the GII ProPol has activity on a poly(A) template.

The importance of linkage of Pro to Pol in the form of ProPol upon polymerase activity was examined, with addition of GII Pro to Pol enhancing polymerase activity on a poly(U) template 25-fold over RNA only (Fig. S1). However, this is less than the fold increase observed with GII ProPol indicating that linkage in the form of ProPol is more active than a combination of independent enzymes on this template. Addition of GII Pro to Pol with a poly(A) template did not induce any changes in polymerase activity (Fig. S1).

Kinetic analysis of norovirus ProPol and Pol

To further characterize the enzymatic activity of GI and GII HuNV ProPol and Pol, the linear phase of each enzyme-substrate pair was determined, and the steady-state kinetics was established.

For both poly(C) and GTP, the data could be fit to the Michaelis-Menten model and generated K_m, k_cat, and k_cat/K_m values (Fig. 2; Table 1). On a poly(C) template, GI Pol, GII ProPol, and GII Pol displayed similar values for K_m, k_cat, and k_cat/K_m (Table 3). In contrast, there was a trend for higher K_m at 15.6 ng/µL, lower k_cat and lower k_cat/K_m at 0.4 s⁻¹ and 0.02 ng/µL⁻¹s⁻¹, respectively, for GI ProPol with poly(C) compared with the other enzymes (Table 1). With GTP, GII ProPol generated a K_m of 25.3 µM, approximately threefold lower than the corresponding K_m for GII Pol of 80.3 µM (Table 1). Although less apparent, the same trend was observed for GI ProPol, with a K_m of 91.5 μΜ and GI Pol with a K_m of 150.4 µM. The k_cat values, 0.24 s⁻¹ for GI ProPol and 0.78 s⁻¹ for GII ProPol, were lower than those of the Pol enzymes, suggesting Pol turns over molecules of GTP more efficiently (Table 1). The k_cat/K_m values for GII ProPol and Pol were similar at 0.03 µM⁻¹ s⁻¹ and 0.02 µM⁻¹ s⁻¹. However, for GI ProPol, it was 3.8-fold lower than that of GI Pol at 0.01 µM⁻¹ s⁻¹ (Table 1).

Four line graphs represent velocity of GMP production over varying concentrations of PolyC and GTP. It also includes GI Pol, ProPol, GII Pol, and ProPol. — Kinetics of poly(C) and GTP substrate utilization. Purified GI ProPol (250 nM) and Pol (75 nM) or GII ProPol (35 nM) and Pol (35 nM) were used to generate dsRNA in a PicoGreen assay. (**A and C**) Kinetics of poly(C) template utilization was analyzed by titrating template from 0 to 80 ng/µL in the presence of 0.5 mM GTP. (**B and D**) Kinetics of GTP utilization was analyzed by titrating GTP from 0 to 1,000 µM (GI) (B) or 500 µM (GII) (D) in the presence of 20 ng/µL poly(C). Following a 10-min incubation at 37°C, the reactions were stopped with 10 mM EDTA and dsRNA was quantified using PicoGreen. GI and GII Pol are represented as circles and ProPol as squares. The solid lines show the fit of the data to the Michaelis-Menten equation [R² values of GI Pol poly(C) 0.91 and GTP 0.90; GI ProPol poly(C) 0.97 and GTP 0.98; GII Pol poly(C) 0.97 and GTP 0.92; and GII ProPol poly(C) 0.98 and GTP 0.91]. Results represent the mean and SD for three independent experiments with triplicate reactions for each measurement point.

TABLE 1.

Kinetic parameters with poly(C) template RNA or GTP

	GI ProPol	GI Pol	GII ProPol	GII Pol
K_m poly(C) (ng/μL)	15.6 (12.0–20.2)^a	6.5 (5.2–8.0)	5.9 (4.7–7.3)	8.8 (6.9–11.3)
k_cat poly(C) (s⁻¹)	0.4 (0.35–0.42)	1.4 (1.3–1.6)	1.1 (1.0–1.2)	1.4 (1.3–1.5)
k_cat/K_m poly(C) (ng/μL⁻¹ s⁻¹)	0.02	0.22	0.19	0.16
K_m GTP (μM)	91.5 (75.1–111.7)	150.4 (97.7–234.9)	25.3 (17.5–38.0)	80.3 (51.6–125.8)
k_cat GTP (s⁻¹)	0.24 (0.22–1.86)	1.7 (1.47–1.96)	0.78 (0.69–0.87)	1.6 (1.40–1.96)
k_cat/K_m GTP (μM⁻¹ s⁻¹)	2.6 × 10⁻³	0.01	0.03	0.02

Open in a new tab

^{^a}

Numbers in parentheses are the 95% confidence interval for the kinetic parameter.

Next, the steady-state parameters of GII ProPol and Pol with poly(U) template RNA and ATP were assessed (Fig. 3; Table 2). GII ProPol showed a K_m for poly(U) of 7.9 ng/µL, 3.7-fold lower than that of GII Pol at 29.6 ng/µL, suggesting an increased affinity for poly(U) by ProPol. At 1.9 s⁻¹ and 1.6 s⁻¹, the k_cat values for ProPol and Pol were similar. However, the k_cat/K_m specificity constant for ProPol, 0.24 ng/µL⁻¹ s⁻¹, was 5.1-fold higher than that of Pol at 0.047 ng/µL⁻¹ s⁻¹ for poly(U). There was no difference in the K_m for ATP between GII ProPol and Pol.

Two line graphs compare velocity of AMP production against PolyU (ng/μL) and ATP (μM). GII Pol and GII ProPol enzymes are plotted for both variables. — Kinetics of poly(U) and ATP substrate utilization. Purified GII ProPol (1 µM) and Pol (2 µM) were used to generate dsRNA for 20 min in a PicoGreen assay. (A) Kinetics of poly(U) template utilization was analyzed by titrating template from 0 to 160 ng/µL in the presence of 0.5 mM ATP. (B) Kinetics of ATP utilization was analyzed by titrating ATP from 0 to 2000 µM in the presence of 80 ng/µL poly(U). GII Pol activity is shown as filled circles and ProPol activity as open squares. The solid lines show the fit of the data to the Michaelis-Menten equation [R² values of GII Pol poly(U) 0.92 and ATP 0.85; GII ProPol poly(U) 0.80 and ATP 0.90]. Results represent the mean and SD for three independent experiments with triplicate reactions for each measurement point.

TABLE 2.

Kinetic parameters with poly(U) template RNA or ATP

	GII ProPol	GII Pol
K_m poly(U) (ng/μL)	7.9 (4.7–13.2)^a	29.6 (19.7–45.0)
k_cat poly(U) (s⁻¹)	1.9 (1.6–2.2)	1.4 (1.2–1.7)
k_cat/K_m poly(U) (ng/μL⁻¹ s⁻¹)	0.24	0.047
K_m ATP (μM)	484.2 (324.8–734.0)	416.4 (270.0–649.2)
k_cat ATP (s⁻¹)	0.6 (0.5–0.7)	0.3 (0.2–0.33)
k_cat/K_m ATP (μM⁻¹ s⁻¹)	1.2 × 10⁻³	7.2 × 10⁻⁴

Open in a new tab

^{^a}

Numbers in parentheses are the 95% confidence interval for the kinetic parameter.

Finally, the steady-state kinetics of GII ProPol with a poly(A) template and UTP was tested (Fig. 4); GII Pol was not included as activity with this template could not be detected (Fig. 1). Incubation of GII ProPol with varying concentrations of poly(A) RNA generated a K_m of 23.6 ng/µL, k_cat of 0.42 s⁻¹, and k_cat/K_m of 0.017 ng/µL⁻¹ s⁻¹ (Table 3), while varying UTP concentration generated a K_m of 437.9 µM, k_cat of 0.36 s⁻¹, and k_cat/K_m of 8.2 × 10⁻⁴ µM⁻¹ s⁻¹ (Table 3). The k_cat/K_m values show that GII ProPol has the lowest specificity constant for both poly(A) and UTP compared with other substrates tested.

Two line graphs depict velocity of UMP production plotted against PolyA concentration. UMP production plotted against UTP concentration. Both plots depict saturation at higher concentrations. — GII ProPol kinetics with poly(A) RNA and UTP. GII ProPol (2 µM) was used to generate dsRNA for 60 min in a PicoGreen assay. (A) Kinetics of poly(A) template utilization was analyzed by titrating template from 0 to 400 ng/µL in the presence of 0.5 mM UTP. (B) Kinetics of ATP utilization was analyzed by titrating ATP from 0 to 2000 µM in the presence of 20 ng/µL poly(A). Data were fit with the Michaelis-Menten equation [R² values of GII ProPol poly(A) 0.97 and UTP 0.96]. Results represent the mean and SD for three independent experiments with triplicate reactions for each measurement point.

TABLE 3.

Kinetic parameters with poly(A) template RNA or UTP

	GII ProPol
K_m poly(A) (ng/μL)	23.6 (19.0–29.3)^a
k_cat poly(A) (s⁻¹)	0.42 (0.39–0.45)
k_cat/K_m poly(A) (ng/μL⁻¹ s⁻¹)	0.017
K_m UTP (μM)	437.9 (317.6–606.8)
k_cat UTP (s⁻¹)	0.36 (0.32–0.41)
k_cat/K_m UTP (μM⁻¹ s⁻¹)	8.2 × 10⁻⁴

Open in a new tab

^{^a}

Numbers in parentheses are the 95% confidence interval for the kinetic parameter.

Cryo-EM structure of the polymerase domain of GII.4 ProPol

Kinetic analysis of ProPol and Pol showed that there are differences in substrate specificity and catalytic efficiency, particularly for the GII proteins. This justified an investigation into the structural differences between the two GII enzymes. For high-yield expression, the GII.4 ProPol used in structural experiments was expressed in T.ni cells with a N-terminal His₆ tag. Purified H₆ProPol retained both protease and polymerase activities indicating that the His₆ tag does not affect the validity of a resulting structure (Fig. S2).

A cryo-EM map of the polymerase domain of ProPol was solved to a final near-atomic resolution of 2.6 Å. The protease domain (~19 kDa), which is three times smaller than the polymerase domain (~57 kDa) and separated by a flexible region, did not resolve in the map reconstruction, although SDS-PAGE gel analysis confirmed that the ProPol sample was intact at the time of vitrification (Fig. S3). In addition to cryoSPARC, both Relion and manual particle picking were utilized for 2D classification but did not resolve the protease domain. Typical computational techniques used to resolve flexible domains, such as signal subtraction and local resolution masking, were not possible due to the small size of the particles and the lack of specimen contrast in the images. Regardless, a map of the polymerase domain was solved and contains well-resolved, isotropic density for most sidechains and for one of the two metal cations in the active site (Fig. S4). The density quality varies throughout the map with the main chain clear throughout except for occasional breaks within surface loops and near the C-terminus. Regions of high resolution with fully resolved side chains were mixed with regions with less density beyond the beta carbon. The overall density was good and consistent with the reported resolution; however, the “thumb” region from residues 380 to 502 was less well resolved, especially near the C-terminus.

The precursor possesses the fingers-thumb-palm architecture typical of Group 1 RNA polymerases (Fig. 5A). The fingers domain extends, starting at the N-terminus, from residue 1 to 187, the palm from residues 188 to 394, and the thumb from residue 395 to the C-terminus. When superposed onto the crystal structure of relaxed state unliganded GII.4 Dresden Pol (PDB: 2B43, chain A), there is a root mean square deviation (RMSD) of 1.19 Å across all atom pairs indicating strong structural conservation. In particular, the inner palm domain and lower outer palm domain are highly conserved between precursor and mature polymerases (Fig. 5B), as are the common drug binding A-site and B-site (Fig. 5D and E) (33). However, small shifts in some helices and loops result in modest local structural variations between the mature and precursor polymerases, shifting up to 3.8 Å (Asp-472, fingers), 1.4 Å (Lys-139, thumb), 1.4 Å (Gln-435, fingers), 3.1 Å (Glu-499, fingers), and 2.9 Å (Gly-377, palm) (measured from α-carbon to α-carbon).

Structure of GII ProPol polymerase domain in different views highlights various domains (fingers, palm, and thumb), A-site and B-site. It also includes specific residues and binding interactions within the protein. — Structural overview of polymerase domain of HuNoV Sydney 2012 ProPol. (A) The HuNoV ProPol polymerase domain is represented as a Richardson diagram oriented down the template entry channel and color coded by catalytic motif. Black arrow indicates location of the active site. A domain schematic indicates domain names above and amino acid residue numbers below. Terminal boxes on the schematic indicate regions where density was lacking in the cryo-EM map. Domain regions in schematic are not to scale. (B) Side view of Sydney 2012 ProPol (fingers, blue; palm, green; and thumb, pink) overlayed with a ligand-free GII.4 Dresden strain norovirus polymerase crystal structure (gray, PDB: 2B43). Red arrow indicates where the linker between protease and polymerase is located. Black arrow indicates the active site. Dotted box on the palm domain indicates the putative location of the VPg binding site (28). (C) A short loop (residues 299–304) within motif B, on the interior of the palm domain, has a shift of ~4.2 Å between ProPol (colored as in A) and the mature polymerase (gray). Distances are indicated by dashed line and measured in angstroms. (D) An overlay of the A-site and B-site (E) reveals a high degree of structural conservation between mature (Dresden) and precursor (Sydney) Pol. (F) Density terminates at Gly-6 of the polymerase domain resulting in a truncated structure composed of a singular polymerase domain.

Of the conserved catalytic motifs directly involved in polymerization and substrate binding, only a loop within Motif B (Glu-296 to Cys-304) is significantly different between mature and precursor Pol, shifting the main chain by 4.2 Å and bringing Ser-300 to 6.8 Å from Arg-182, the nearest residue of the B-site of the thumb domain, relative to the 6.1 Å distance between the analogous residues reported in the mature Dresden Pol structure (Fig. 5, panel C). This shift results in the loss of a hydrogen bond between Ser-300 and both Asp-247 and Trp-185 as seen in mature Pol. In ProPol instead, we find an interaction, which is most clear in the sharpened map, between the main chain oxygen of Gly-301 and the side chain oxygen of Ser-187 and an interaction between the main chain oxygen of Asp-247 with the main chain nitrogen of Leu-298. The amino acid sequence of this loop is conserved in both Dresden and Sydney 2012 norovirus, and regions of these two structures close to Motif B are structurally conserved. Interestingly, ProPol has a similar Motif B loop arrangement as inhibitor-bound mature polymerases. This loop in mature Dresden Pol adopts the same conformation seen here in unliganded ProPol when the B-site is occupied by a PPNDS ligand, despite the B-site and the ligand being located a substantial distance away from Motif B (Fig. S5).

Comparison of antivirals targeting HuNV ProPol and Pol

Although there are several norovirus antivirals directed against polymerase activity, it is not known if these compounds are active against precursor proteins, including ProPol (8, 31, 36, 39 –44). The effect of galidesivir triphosphate (Gal-TP), a nucleotide analog, and PPNDS, a non-nucleoside inhibitor, on the de novo polymerase activity of ProPol and Pol was tested (Fig. 6). Proteins were incubated with an inhibitor before the addition of substrate, and activity was normalized with enzyme only, representing 100% activity and enzyme treated with EDTA, representing 0% activity.

Two chemical structures and inhibition assays measure enzyme activity in the presence of Galt-TP and PPNDS compounds. Dose-response curves illustrate percentage enzyme activity across varying concentrations. — Inhibition by Gal-TP and PPNDS on polymerase activity of GI and GII ProPol and Pol proteins purified from *Escherichia coli*. Chemical structures of (A) Gal-TP and (C) PPNDS. (B) Dose response curve of GII ProPol (1 µM) and GII Pol (2 µM) with Gal-TP and substrate at 8 ng/µL poly(U) template and 400 µM ATP. (D) Dose response curves of GI ProPol (250 nM) and GI Pol (75 nM) with PPNDS and substrate at 15 ng/µL poly(C) template and 90 µM GTP or 6 ng/µL poly(C) template and 150 µM for ProPol and Pol, respectively. (E) Dose-response curves of GII ProPol (35 nM) and GII Pol (35 nM) with PPNDS and substrate at 6 ng/µL poly(C) template and 25 µM GTP. Data were normalized relative to an enzyme-dimethyl sulfoxide (DMSO) vehicle control. Data represent the mean and SD of three independent experiments with triplicate reactions for each measurement point.

Gal-TP is an ATP analog; therefore, de novo polymerase inhibition could only be measured with GII and not GI enzymes, as these did not show activity with a poly(U) template (Fig. 1). In the presence of Gal-TP, polymerase activity of GII ProPol and Pol was inhibited and generated respective half-maximal inhibitory concentration (IC₅₀) values of 247.5 µM (95% CI: 201.2–302.9 μM) and 154.3 µM (95% CI: 135.8–175.1 μM) (Fig. 6B). This shows weak inhibition of polymerase activity by Gal-TP, with a subtle but significant 1.6-fold difference between the IC₅₀ values.

PPNDS generated a dose-dependent inhibition of GI and GII norovirus ProPol and Pol polymerase activities with a poly(C) RNA template. The IC₅₀ values were calculated to be 6.8 µM (95% CI: 5.5–8.9 μM) for GI ProPol and 3.4 µM (95% CI: 2.8–4.1 μM) for GI Pol (Fig. 6D). In comparison, PPNDS was more potent at inhibiting polymerase activity of GII norovirus proteins, with IC₅₀ values of 3.8 µM (95% CI: 3.2–4.4 μM) and 0.5 µM (95% CI: 0.4–0.5 μM) with ProPol and Pol, respectively (Fig. 6E).

As ProPol is a multi-functional enzyme with both protease and polymerase activities, we next investigated whether inhibition of protease activity can influence polymerase activity. NV-004, a peptidomimetic antiviral that inhibits protease activity of 3CL proteases, including norovirus Pro (IC₅₀ 0.37 µM) (45, 46), was incubated with GI and GII ProPol or Pol and the de novo polymerase activity measured (Fig. 7). The mature GI and GII Pol showed no decrease in polymerase activity in the presence of NV-004 (Fig. 7C and E). Incubation of GI ProPol with NV-004 showed a decrease in polymerase activity. Particularly with 30 µM NV-004, activity was significantly decreased to 62% compared with a 0-µM control (Fig. 7B). Although not statistically significant, a similar trend was observed for GII ProPol, with polymerase activity decreased to 76% in the presence of 30 µM NV-004 (Fig. 7D). These results indicate that inhibition of protease activity by NV-004 has a modest inhibitory effect on polymerase activity of ProPol when present at high concentrations.

NV-004 chemical structure and bar graphs depicting effect of NV-004 at different concentrations on enzyme activity. It indicates significant inhibition at 30 μM with GI ProPol and no significant change with other proteins. — Inhibitory effect of NV-004 on HuNV polymerase activity. (A) Schematic of NV-004 peptidomimetic protease inhibitor. (B) GI ProPol, (C) GI Pol, (D) GII ProPol, and (E) GII Pol purified from *E. coli* were incubated with NV-004, and *de novo* polymerase activity was monitored by the formation of dsRNA from a poly(C) template. Polymerase activity of ProPol or Pol was normalized to the 0-µM NV-004 control. Results represent the mean and SD for three independent experiments with triplicate reactions for each measurement point. Data were analyzed by one-way ANOVA, ns = P > 0.05 and **P < 0.01.

Finally, we investigated whether inhibition of polymerase activity influences protease activity (Fig. 8). Incubation of the nucleotide inhibitor Gal-TP with GII Pro or ProPol did not affect protease activity to a level of significance, although there was an observable decrease in ProPol activity with 30 µM Gal-TP (Fig. 8B and C). As the fluorescence of PPNDS interfered with the protease assay, the non-nucleotide HuNV polymerase inhibitor NF023 was used as an alternative (47). The protease activity of GII Pro was not affected by NF023. However, protease activity of GII ProPol was significantly decreased to 74% and 45% with 3 µM and 30 µM NF023, respectively (Fig. 8E and F), showing that inhibition of polymerase activity with NF023 can decrease ProPol protease activity.

Two chemical structures and bar graphs depict no significant change in protease activity with Gal-TP at different concentrations. It also depicts significant inhibition of GII ProPol with NF023 at 30 μM. — Inhibitory effect of Gal-TP and NF023 on protease activity of *E. coli*-purified GII HuNV Pro and ProPol. (**A and D**) Schematics of Gal-TP and NF023 polymerase inhibitors. (**B and C**) Protease activity of GII Pro and ProPol in the presence of Gal-TP. (**E and F**) Protease activity of GII Pro and ProPol in the presence of NF023. Protease activity was normalized to the 0-µM inhibitor control. Results represent the mean and SD for three independent experiments with triplicate reactions for each measurement point. Data were analyzed by one-way ANOVA, ns = P > 0.05, **P < 0.01, and ***P < 0.001.

DISCUSSION

The protease activity of mature and precursor norovirus proteases has been well studied; however, the polymerase function of norovirus ProPol has received limited attention. This study further characterizes the polymerase activity of GI and GII HuNV enzymes in the precursor and mature states.

There were differences in template preferences of GI and GII polymerases with homopolymeric RNA. This could influence replication of the virus and, in-part, explain the prolonged and severe symptoms and higher fecal load associated with GII.4 virus infections (48 –51).

Distinct differences were observed in the de novo template utilization between ProPol and Pol, particularly for GII enzymes. In de novo polymerase assays, GII Pol showed activity with poly(C) and poly(U) RNA templates but was not active with a poly(A) template. These results are consistent with the literature, except for activity with a poly(U) template which previously could not be detected in a de novo polymerase reaction using 50 µM of ATP (26, 52, 53). In our experiments, poly(U) polymerase activity was apparent at concentrations of ATP greater than 50 µM and a K_m for ATP of ~480 µM is consistent with concentrations available in the cell (54, 55). In contrast to Pol, we have shown that GII ProPol can utilize poly(C), poly(U), and poly(A) templates and displays equal or superior kinetic parameters to Pol, apart from the k_cat for GTP.

Kinetic experiments with poly(U) RNA template or ATP produced curves with R² values < 0.9 when fit with the Michaelis-Menten equation. Alternatively, the data can be fitted with an allosteric sigmoidal model that gives R² values > 0.95 that could be indicative of allosteric interactions. Using this model did not change the trend for the catalytic parameters between ProPol and Pol, for example, the K_m as estimated by half V_max was 6.8 ng/µL for GII ProPol with poly(U) (7.9 ng/µL using the Michaelis-Menten equation). We did not see evidence of allosteric interactions with other RNA templates or nucleotides, nor did we see evidence of ProPol multimerization by cryo-EM.

Polymerase assays with poly(G) RNA showed negligible change of fluorescence in the presence of GI or GII polymerases. This indicates that norovirus polymerases do not function on poly(G) RNA or that the template is not conducive for measuring activity, possibly due to high background fluorescence or formation of RNA quadruplex structures (56 –61). Regardless, poly(G) RNA was not pursued in kinetic experiments.

The impact of de novo polymerase activity and template preferences on initiation of GI and GII norovirus RNA replication is unknown as the precise mechanisms have not yet been clearly defined (26, 37, 53, 62). In one model, terminal transferase activity of norovirus Pol has been proposed to produce a poly(C) stretch on the 3′ terminus of the anti-genomic RNA (63). The poly(C) stretch could be used for de novo initiation by GI and/or GII norovirus ProPol and Pol during replication. In addition to poly(C) activity, our results demonstrate that GII ProPol can utilize poly(A) RNA as a de novo template. During viral replication, it is possible that GII ProPol replicates the negative-sense RNA in a primer-independent fashion using the poly(A) tail as a template from which to initiate synthesis. Future work should investigate the activity of ProPol with RNA sequences representing the viral genome to further characterize initiation of negative-strand synthesis.

To determine if structural changes might account for the differences in polymerase activity between ProPol and Pol, the structure of the polymerase domain was resolved by cryo-EM to 2.6 Å. In the consensus map, the density for the protease domain and linker region through to residue 6 of the polymerase domain could not be resolved. The interdomain region is flexible, and we hypothesize that this results in large degrees of freedom of the protease domain relative to the polymerase domain and “classing out” of the protease during image processing and 3D reconstruction. Other explanations, such as unfavorable interactions at the air-water interface during vitrification or proteolytic cleavage of the linker, were considered less likely due to a lack of preferential particle orientation and evidence that the sample was intact at the time of freezing (Fig. S3). Regardless, the ProPol structure presented in this paper represents the first structure of the norovirus polymerase domain in the context of a ProPol molecule.

The polymerase domain of GII.4 norovirus ProPol was solved in the absence of substrates but occupied with a metal cation. The active site did not contain unexplained densities within the cryo-EM map suggesting RNA was not co-purified with the protein. A modest shift was observed in the α-helix loop of Motif B, which is rather distant (~8 Å) from the nearest residue of the B-site and is on the opposite side of the internal compartment of the polymerase from the A-site. Motif B in RNA polymerases is involved in nucleotide recognition, coordinating the correct positioning of the sugar in the ribose-binding pocket, as well as template coordination and primer binding (64, 65). Although this structure is ligand free, the rearrangement of the loop is similar to the arrangement observed in PPNDS-bound mature Pol (33). Other than Motif B, the palm domain does not exhibit the variation that might be expected given the differences in activity and substrate specificity observed between the mature and precursor proteins. It may be that structural variations arise only once ProPol has progressed to a later state of catalysis or when bound to a substrate, nucleotide triphosphate (NTP) and/or VPg molecule(s). To this end, we expect a ProPol structure captured in a state of catalysis or bound with ligand or substrate, would likely be informative with regard to the difference in catalytic efficiency, and provide insights on the importance of these structural changes for viral replication.

The norovirus polymerase and protease represent major targets for antiviral development due to their essential role in the viral lifecycle. Both Gal-TP and PPNDS inhibited activity of ProPol and Pol, suggesting both enzymes can be targeted by a single antiviral albeit with differing efficacy. For GII Pol, IC₅₀ results for PPNDS have been reported to fall in the range of 0.45–1.5 µM, consistent with our results (34, 36, 41). Interestingly, PPNDS was ~7-fold more effective against GII Pol than GII ProPol but the reason for this discrepancy is not clear. Comparison of unliganded GII ProPol and GII Pol structures shows that there are not any major structural changes in the B-site within the thumb domain, where PPNDS binds (33, 34). Interestingly, GI Pol displayed an IC₅₀ of 3.4 µM with PPNDS, suggesting that the inhibitor may not be as effective against GI HuNV compared with GII.

In the context of ProPol, inhibition of one enzymatic activity, whether protease or polymerase, can affect the other activity. One explanation is that the binding of antivirals in the active site impacts the structural flexibility of the protease and polymerase domains relative to the other. NV-004 impacts the structure of GII.4 Pro, specifically the βeII-βfII, βbII-βcII, and βcII-βdII loops (46), and if similar changes occurred with ProPol, this could affect the structure of the polymerase domain.

Alternatively, an antiviral in the active site could influence substrate interactions of ProPol thereby impacting enzymatic functions. Picornavirus 3CD protein binds the 5′ cloverleaf RNA through the RNA binding region of the protease domain to correctly position the polymerase for replication (66, 67). Binding of NV-004 in the protease active site of ProPol could affect the RNA binding potential of the protease domain and result in decreased polymerase activity through a similar mechanism. Overall, the results with NV-004 and NF023 indicate that inhibition of protease or polymerase activity in the context of ProPol can be inhibitory to the alternate enzyme activity that is consistent with interplay between the domains.

In summary, this work shows that HuNV ProPol is an enzyme with overlapping but distinct recognition and utilization of substrates compared with mature Pol. The cryo-EM structure of the polymerase domain of GII ProPol indicates that the differences in activity are not reflected by the unliganded relaxed state structure of the enzyme. Despite the similarities in activity and structure, ProPol and Pol had differing responses to both Gal-TP and PPNDS, with higher IC₅₀ values for ProPol compared with Pol. Together, these results indicate that ProPol and Pol play different but essential roles and implicate ProPol as an important target for antiviral testing.

MATERIALS AND METHODS

Compounds

The norovirus polymerase inhibitors, pyridoxal‐5′‐phosphate‐6‐(2′‐naphthylazo‐6′‐nitro‐4′,8′‐disulfonate) tetrasodium salt (PPNDS) and 8,8′-[carbonylbis(imino-3,1-phenylenecarbonylimino)]bis-1,3,5-naphthalene-trisulphonic acid (NF023), were sourced from Tocris Bioscience (Minneapolis, MN, USA) and MedChemExpress (Monmouth Junction, NJ, USA), respectively. Gal-TP was synthesized by the Ferrier Research Institute, Victoria University of Wellington, as described in reference (68). NV-004, a known SARS-CoV-2 mPro inhibitor (45), was synthesized by the University of Auckland as described in (46).

Construction of norovirus ProPol and Pol plasmids

Synthetic genes encoding for HuNV GI Southampton and GII.4 Sydney 2012 ProPol and Pol proteins were obtained from GenBank (accession numbers L07418.1 and JX459908, respectively) and synthesized by GenScript (Piscataway, NJ, USA). ProPol sequences were modified to contain a mutation, E181A, at the Pro/Pol junction to prevent protease cleavage into the mature proteins (11, 17).

For expression of scarless proteins, the Expresso Rhamnose SUMO Cloning and Expression System was utilized (Lucigen, Middleton, WI, USA). Construction of plasmids for expression of HuNV ProPol and Pol proteins with an N-terminal His₆ tag and SUMO fusion protein was performed according to the manufacturer’s instructions (Lucigen). Briefly, flanking 5′ and 3′ SUMO sequences complementary to the pRham N-His SUMO Kan vector (pRham) were introduced to gene sequences by PCR (Table 4). The PCR products along with pre-processed pRham plasmid were co-transformed into E. coli for homologous recombination to form the SUMO_Pol or SUMO_ProPol fusion construct. All constructs were confirmed by sequencing.

TABLE 4.

Sequences of primers for generation of pRham SUMO_ProPol and SUMO_Pol plasmids

Construct	Primer sequence (5′−3′)^a
SUMO_GII.4 ProPol	F: CGCGAACAGATTGGAGGTGCACCGCCTTCTATTTGGTCCCGTA R: GTGGCGGCCGCTCTATTATTCCACACCATCCTCGTTCACG
SUMO_GII.4 Pol	F: CGCGAACAGATTGGAGGTGGAGGAGACTCAAAGGGTACTT R: GTGGCGGCCGCTCTATTATTCCACACCATCCTCGTTCACG
SUMO_GI ProPol	F: CGCGAACAGATTGGAGGTGCACCTCCTACGTTGTGGT R: GTGGCGGCCGCTCTATTAAACACCGTCATCATTAACAAAC
SUMO_GI Pol	F: CGCGAACAGATTGGAGGTGGTGGCGATAAAGGTCACTA R: GTGGCGGCCGCTCTATTAAACACCGTCATCATTAACAAAC

Open in a new tab

^{^a}

Homologous sequences for SUMO recombination are underlined; F indicates forward primers, and R indicates reverse primers.

Expression and purification of SUMO fusion proteins for enzymatic analyses

E. coli cultures containing SUMO_Pol or SUMO_ProPol constructs were grown in terrific broth until an OD₆₀₀ of approximately 0.5 was reached and expression of SUMO fusion proteins was induced with 0.2% L-rhamnose. Cultures were grown for a further 6 h at 37°C, and the bacterial pellet was collected by centrifugation. The cells were lysed by sonication in 50 mM HEPES pH 7.5, 300 mM NaCl, 15 mM imidazole, 5 mM β-mercaptoethanol, and 20% glycerol. The soluble fraction was collected following centrifugation at 14,000 × g and incubated with Ni-NTA agarose beads (Qiagen, Hilden, Germany), and the bound protein was collected by gravity flow column (Pierce, Waltham, MA, USA). Proteins were eluted in 50 mM HEPES pH 7.5, 150 mM NaCl, 150 mM imidazole, and 20% glycerol. For SUMO fusion partner removal, purified proteins were buffer exchanged using Amicon ultra-centrifugal filter units (Millipore, Burlington, MA, USA) into 50 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol, and 2 mM DTT. Cleavage reactions were incubated overnight at 4°C with 0.5 U/mg (SUMO_Pol) or 5 U/mg (SUMO_ProPol) SUMO Express Protease (Lucigen). The reaction mixture was incubated with Ni-NTA agarose to remove the His₆ tagged SUMO peptide and SUMO protease. Purified protein was collected, quantified by densitometry on SDS-PAGE gels with BSA as a protein standard, and stored at −80°C in 50 mM HEPES pH 7.5, 150 mM NaCl, and 50% glycerol. Protein identity was confirmed by mass spectrometry (Centre for Protein Research, University of Otago, NZ). Three separate batches of protein were produced and used as biological replicates in enzyme assays. Expression and purification of GII.4 Pro were performed as described previously (46).

Expression of H₆ProPol for cryo-EM

GII.4 Sydney 2012 ProPol was expressed using the commercial recombinant baculovirus system Flashback Ultra (Oxford Expression Technologies, Oxford, UK). The expression construct contained an N-terminal His₆ tag with flexible linker (DYDIPTT) followed by ProPol, termed H₆ProPol to differentiate from SUMO_ProPol. Trichoplusia ni insect cells in suspension culture were infected with recombinant baculovirus expressing H₆ProPol at a multiplicity of infection of 1 and incubated at 27°C with 125 RPM for 3 days. Cells were lysed in buffer containing 50 mM HEPES pH 8, 300 mM NaCl, and 1% Triton X-100. Soluble protein was purified as described for SUMO_ProPol, except that the elution buffer did not contain any glycerol. Samples were further purified by size exclusion chromatography using an S12 10/300 column (Cytiva, Marlborough, MA, USA) on an Äkta Purifier 10 fast protein liquid chromatography system (GE Life Sciences, Chicago, IL, USA), and the central fraction of the elution peak was collected and diluted in 50 mM HEPES pH 7.5, 150 mM NaCl, 30 mM imidazole, 2 mM MgCl₂, and 2 mM DTT to 1 mg/mL.

Protease assay with Pro and ProPol

A fluorescent resonance energy transfer assay was used to measure the activities of Pro and ProPol as described in reference (46). The peptide substrate, 5(6)-carboxyfluorescein (FAM)-LGDYELQGPEDLAK-Dabcyl utilized in reactions, was based on the NS1-2/NS3 cleavage site of HuNV GII.4 Sydney 2012, and the scissile bond is shown in bold.

Kinetics of ProPol and Pol activity

De novo polymerase activity was measured by monitoring the formation of dsRNA from a single-stranded homopolymeric RNA template using PicoGreen as described previously (69). Optimal pH (range of 7.0–8.0), concentrations of MnCl₂ (2.5 mM), and DTT (5 mM) for HuNV were previously established (17, 52). Concentrations of NaCl in the final polymerase reaction were maintained below 10 mM (17).

Standard reactions were performed in 25 µL, containing 5 mM DTT, 2.5 mM MnCl₂, 20 ng/µL RNA template, 0.5 mM NTP in 20 mM Tris pH 7.5. Reactions were initiated with the indicated concentration of enzyme and allowed to proceed for a set period at 37°C before being terminated with 10 mM EDTA. PicoGreen (1:350 dilution) (Invitrogen, Waltham, MA, USA) was added to bind the dsRNA, and fluorescence was measured on a Varioskan Flash (Thermo Fisher Scientific, Waltham, MA, USA) plate reader with excitation at 480 nm and emission at 520 nm.

Kinetics of nucleotide incorporation by polymerase proteins was analyzed by titrating NTP concentration under standard reaction conditions for the linear time period of the enzyme. Kinetics of RNA template utilization was analyzed in the same manner but with titration of the homopolymeric template. The velocity of the reaction against substrate concentration was plotted, and the kinetic parameters were determined by non-linear regression using the Michaelis-Menten model in GraphPad Prism version 9.2.0 (La Jolla, CA, USA). All enzyme kinetics was performed with three independent preparations of protein, with triplicate wells for each replicate.

Enzymatic IC₅₀ assay

For the determination of IC₅₀ values, titrations of the test compound (0–10 μM for PPNDS and 1.2–1200 μM for Gal-TP) or a vehicle control were incubated with the enzyme, for 20 min in 20 mM Tris pH 7.5, 5 mM DTT, and 2.5 mM MnCl₂. Substrate, at a concentration below the calculated K_m values, was added and incubated for the indicated time. Reactions were stopped with EDTA, dsRNA stained with PicoGreen, and fluorescence measured on a Victor Nivo (PerkinElmer, Shelton, CT, USA) plate reader. IC₅₀ values were determined by non-linear regression using the log (inhibitor) vs. normalized response—variable slope model in GraphPad Prism. In the experiments, a maximal PPNDS concentration of 10 µM was used as higher concentrations fluoresced at the same wavelength as PicoGreen.

Inhibition of polymerase activity by the protease inhibitor NV-004 (46) was determined by incubating enzyme with an inhibitor at 0, 3, and 30 µM for 20 min. Substrate was added to the reaction, and the percentage activity was calculated relative to the 0 µM control.

Cryo-EM sample preparation and data collection

UltrAUFoil R1.2/1.3 300 mesh gold grids (Electron Microscopy Sciences, PA, USA) were glow discharged for 120 s at 15 mA in a Pelco Easiglow Glow Discharge Cleaning System (Pelco, CA, USA) before 3 µL of sample was applied, and the grids were plunge frozen into liquid ethane using a FEI Mark IV Vitrobot (Thermo Scientific, Waltham, MA, USA). Data were collected using EPU software on a FEI Titan Krios G3i (Thermo Scientific) operating at a voltage of 300 kV with a Gatan BioQuantum energy filter and a K2 Gatan camera system. Exposures were collected at a nominal magnification of 215,000× for 5 s with an accumulated electron dose of 80 e/ Å² at a pixel size of 0.66 (Å/pix). Exposures were collected with a range of defoci from −2.0 to −1.0 µm. Approximately 9,300 exposures were obtained. Statistics for data collection and refinement are listed in Table 5.

TABLE 5.

Cryo-EM data collection, refinement, and validation statistics for GII.4 Sydney 2012 ProPol polymerase domain

Data collection and processing
Magnification	215K
Voltage (kV)	300
Electron exposure (e/Å²)	80
Spherical aberration (mm)	2.7
Defocus range (μm)	−2.0 to −1.0
Pixel size (Å/pix)	0.66
Initial particle images (no.)	>5,000,000
Final particle images (no.)	997,801
Map resolution (Å)	2.6
Refinement
Initial model used (PDB code)	4LQ3
Map sharpening B factor (Å)	52.87
Bond lengths (Å)	0.012
Validation
MolProbity score	1.18
EMRinger score	2.35
Clashscore	3.79
Poor rotamers (%)	0 (0)
Ramachandran plot
Favored (%)	97.98
Allowed (%)	1.8
Disallowed (%)	0.20
C-beta outliers (%)	0

Open in a new tab

Cryo-EM data processing and model building

All data processing (motion correction, 2D and 3D classification, and ab initio reconstruction) was performed in cryoSPARC v. 3.0 (70) (Fig. S4). Particles were picked using the blob picker job and submitted to 2D classing (Fig. S6). Classes capturing multiple viewing directions were used as templates in a template picking job, and the particles were sorted via iterative 2D classification to produce well-defined classes with visible secondary features. Roughly 900,000 particles were selected after 2D classification and used for ab initio reconstruction into three classes. The best 3D class was selected based on the broadest range of particle orientations and was used as a 3D volume template for several rounds of homogeneous and non-uniform refinement with per-group CTF and per-particle defocus estimation features switched on. Refinement was performed iteratively until resolution no longer improved. A 3D variability job was performed to identify local motion at the Pro-Pol linker but ultimately did not allow for the resolution of the Pro domain. Model building was performed by manual and automated refinement residue by residue using real-space refinement in Phenix (71, 72), manual refinement in COOT (73), and ISOLDE v. 1.3 (74) and validated in Molprobity (75). The GII.4 Dresden polymerase structure (PDB: 4LQ3) was used as an initial model for the polymerase domain, mutated to the amino acid identity of GII.4 Sydney 2012 Pol, fit into the map using UCSF ChimeraX (76), and refined into the cryo-EM density map.

ACKNOWLEDGMENTS

We acknowledge the use of the University of Wollongong Cryogenic Electron Microscopy Facility at Molecular Horizons. We also acknowledge and pay respects to the indigenous Kai Tahu peoples, where the University of Otago is based. We also acknowledge and pay respects to the Dharawal peoples, who are the traditional custodians of the Wollongong land and surrounding areas where the Molecular Horizons facility is based.

This research was funded by the New Zealand Ministry for Business Innovation and Employment, grant number UOOX1904, and a Royal Society of New Zealand Catalyst Seeding Grant, 21-UOO-003-CSG.

Contributor Information

Vernon K. Ward, Email: vernon.ward@otago.ac.nz.

Stacey Schultz-Cherry, St. Jude Children's Research Hospital, Memphis, Tennessee, USA.

DATA AVAILABILITY

Maps and models for HuNV Sydney 2012 ProPol polymerase domain have been deposited in the Protein Data Bank and the Electron Microscopy Data Bank (EMDB), under accession codes 9BI9 and EMD-44577, respectively.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.01193-24.

Supplemental figures. jvi.01193-24-s0001.pdf.

Figures S1 to S6.

jvi.01193-24-s0001.pdf^{(4.3MB, pdf)}

DOI: 10.1128/jvi.01193-24.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1. Chhabra P, de Graaf M, Parra GI, Chan MC-W, Green K, Martella V, Wang Q, White PA, Katayama K, Vennema H, Koopmans MPG, Vinjé J. 2019. Updated classification of norovirus genogroups and genotypes. J Gen Virol 100:1393–1406. doi: 10.1099/jgv.0.001318 [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Kapikian AZ, Wyatt RG, Dolin R, Thornhill TS, Kalica AR, Chanock RM. 1972. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol 10:1075–1081. doi: 10.1128/JVI.10.5.1075-1081.1972 [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Wolf S, Williamson W, Hewitt J, Lin S, Rivera-Aban M, Ball A, Scholes P, Savill M, Greening GE. 2009. Molecular detection of norovirus in sheep and pigs in New Zealand farms. Vet Microbiol 133:184–189. doi: 10.1016/j.vetmic.2008.06.019 [DOI] [PubMed] [Google Scholar]
4. Karst SM, Wobus CE, Lay M, Davidson J, Virgin HW 4th. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575–1578. doi: 10.1126/science.1077905 [DOI] [PubMed] [Google Scholar]
5. Liu BL, Lambden PR, Günther H, Otto P, Elschner M, Clarke IN. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J Virol 73:819–825. doi: 10.1128/JVI.73.1.819-825.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Pires SM, Fischer-Walker CL, Lanata CF, Devleesschauwer B, Hall AJ, Kirk MD, Duarte ASR, Black RE, Angulo FJ. 2015. Aetiology-specific estimates of the global and regional incidence and mortality of diarrhoeal diseases commonly transmitted through food. PLoS One 10:e0142927. doi: 10.1371/journal.pone.0142927 [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Cornejo-Sánchez T, Soldevila N, Coronas L, Alsedà M, Godoy P, Razquín E, Sabaté S, Guix S, Rodríguez Garrido V, Bartolomé R, Domínguez A, Working Group for the Study of Outbreaks of Acute Gastroenteritis in Catalonia . 2023. Epidemiology of GII.4 and GII.2 norovirus outbreaks in closed and semi-closed institutions in 2017 and 2018. Sci Rep 13:1659. doi: 10.1038/s41598-023-28448-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Van Dycke J, Ny A, Conceição-Neto N, Maes J, Hosmillo M, Cuvry A, Goodfellow I, Nogueira TC, Verbeken E, Matthijnssens J, de Witte P, Neyts J, Rocha-Pereira J. 2019. A robust human norovirus replication model in zebrafish larvae. PLoS Pathog 15:e1008009. doi: 10.1371/journal.ppat.1008009 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Estes MK, Ettayebi K, Tenge VR, Murakami K, Karandikar U, Lin S-C, Ayyar BV, Cortes-Penfield NW, Haga K, Neill FH, Opekun AR, Broughman JR, Zeng X-L, Blutt SE, Crawford SE, Ramani S, Graham DY, Atmar RL. 2019. Human norovirus cultivation in nontransformed stem cell-derived human intestinal enteroid cultures: success and challenges. Viruses 11:638. doi: 10.3390/v11070638 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Ettayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U, Tenge VR, Neill FH, Blutt SE, Zeng X-L, Qu L, Kou B, Opekun AR, Burrin D, Graham DY, Ramani S, Atmar RL, Estes MK. 2016. Replication of human noroviruses in stem cell–derived human enteroids. Science 353:1387–1393. doi: 10.1126/science.aaf5211 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Belliot G, Sosnovtsev SV, Mitra T, Hammer C, Garfield M, Green KY. 2003. In vitro proteolytic processing of the MD145 norovirus ORF1 nonstructural polyprotein yields stable precursors and products similar to those detected in calicivirus-infected cells. J Virol 77:10957–10974. doi: 10.1128/jvi.77.20.10957-10974.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Seah EL, Marshall JA, Wright PJ. 1999. Open reading frame 1 of the Norwalk-like virus Camberwell: completion of sequence and expression in mammalian cells. J Virol 73:10531–10535. doi: 10.1128/JVI.73.12.10531-10535.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Yost SA, Marcotrigiano J. 2013. Viral precursor polyproteins: keys of regulation from replication to maturation. Curr Opin Virol 3:137–142. doi: 10.1016/j.coviro.2013.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Spear A, Ogram SA, Morasco BJ, Smerage LE, Flanegan JB. 2015. Viral precursor protein P3 and its processed products perform discrete and essential functions in the poliovirus RNA replication complex. Virology (Auckl) 485:492–501. doi: 10.1016/j.virol.2015.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Moffat K, Knox C, Howell G, Clark SJ, Yang H, Belsham GJ, Ryan M, Wileman T. 2007. Inhibition of the secretory pathway by foot-and-mouth disease virus 2BC protein is reproduced by coexpression of 2B with 2C, and the site of inhibition is determined by the subcellular location of 2C. J Virol 81:1129–1139. doi: 10.1128/JVI.00393-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Harris KS, Reddigari SR, Nicklin MJ, Hämmerle T, Wimmer E. 1992. Purification and characterization of poliovirus polypeptide 3CD, a proteinase and a precursor for RNA polymerase. J Virol 66:7481–7489. doi: 10.1128/jvi.66.12.7481-7489.1992 [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Belliot G, Sosnovtsev SV, Chang KO, Babu V, Uche U, Arnold JJ, Cameron CE, Green KY. 2005. Norovirus proteinase-polymerase and polymerase are both active forms of RNA-dependent RNA polymerase. J Virol 79:2393–2403. doi: 10.1128/JVI.79.4.2393-2403.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Medvedev A, Viswanathan P, May J, Korba B. 2017. Regulation of human norovirus VPg nucleotidylylation by ProPol and nucleoside triphosphate binding by its amino terminal sequence in vitro. Virology (Auckl) 503:37–45. doi: 10.1016/j.virol.2017.01.003 [DOI] [PubMed] [Google Scholar]
19. Belliot G, Sosnovtsev SV, Chang KO, McPhie P, Green KY. 2008. Nucleotidylylation of the VPg protein of a human norovirus by its proteinase-polymerase precursor protein. Virology (Auckl) 374:33–49. doi: 10.1016/j.virol.2007.12.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Machín A, Martín Alonso JM, Dalton KP, Parra F. 2009. Functional differences between precursor and mature forms of the RNA-dependent RNA polymerase from rabbit hemorrhagic disease virus. J Gen Virol 90:2114–2118. doi: 10.1099/vir.0.011296-0 [DOI] [PubMed] [Google Scholar]
21. Wei L, Huhn JS, Mory A, Pathak HB, Sosnovtsev SV, Green KY, Cameron CE. 2001. Proteinase-polymerase precursor as the active form of feline calicivirus RNA-dependent RNA polymerase. J Virol 75:1211–1219. doi: 10.1128/JVI.75.3.1211-1219.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. May J, Korba B, Medvedev A, Viswanathan P. 2013. Enzyme kinetics of the human norovirus protease control virus polyprotein processing order. Virology (Auckl) 444:218–224. doi: 10.1016/j.virol.2013.06.013 [DOI] [PubMed] [Google Scholar]
23. Scheffler U, Rudolph W, Gebhardt J, Rohayem J. 2007. Differential cleavage of the norovirus polyprotein precursor by two active forms of the viral protease. J Gen Virol 88:2013–2018. doi: 10.1099/vir.0.82797-0 [DOI] [PubMed] [Google Scholar]
24. Viswanathan P, May J, Uhm S, Yon C, Korba B. 2013. RNA binding by human Norovirus 3C-like proteases inhibits protease activity. Virology (Auckl) 438:20–27. doi: 10.1016/j.virol.2013.01.006 [DOI] [PubMed] [Google Scholar]
25. Han KR, Choi Y, Min BS, Jeong H, Cheon D, Kim J, Jee Y, Shin S, Yang JM. 2010. Murine norovirus-1 3Dpol exhibits RNA-dependent RNA polymerase activity and nucleotidylylates on Tyr of the VPg. J Gen Virol 91:1713–1722. doi: 10.1099/vir.0.020461-0 [DOI] [PubMed] [Google Scholar]
26. Rohayem J, Robel I, Jäger K, Scheffler U, Rudolph W. 2006. Protein-primed and de novo initiation of RNA synthesis by norovirus 3Dpol. J Virol 80:7060–7069. doi: 10.1128/JVI.02195-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Marcotte LL, Wass AB, Gohara DW, Pathak HB, Arnold JJ, Filman DJ, Cameron CE, Hogle JM. 2007. Crystal structure of poliovirus 3CD protein: virally encoded protease and precursor to the RNA-dependent RNA polymerase. J Virol 81:3583–3596. doi: 10.1128/JVI.02306-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Lee JH, Park BS, Han KR, Biering SB, Kim SJ, Choi J, Seok JH, Alam I, Chung MS, Kim HM, Hwang S, Kim KH. 2018. Insight Into the interaction between RNA polymerase and VPg for murine norovirus replication. Front Microbiol 9:1466. doi: 10.3389/fmicb.2018.01466 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Fernandes H, Leen EN, Cromwell H, Pfeil MP, Curry S. 2015. Structure determination of murine norovirus NS6 proteases with C-terminal extensions designed to probe protease-substrate interactions. PeerJ 3:e798. doi: 10.7717/peerj.798 [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Zhao B, Hu L, Song Y, Patil K, Ramani S, Atmar RL, Estes MK, Prasad BVV. 2021. Norovirus protease structure and antivirals development. Viruses 13:2069. doi: 10.3390/v13102069 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Deval J, Jin Z, Chuang YC, Kao CC. 2017. Structure(s), function(s), and inhibition of the RNA-dependent RNA polymerase of noroviruses. Virus Res 234:21–33. doi: 10.1016/j.virusres.2016.12.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Muzzarelli KM, Kuiper B, Spellmon N, Brunzelle J, Hackett J, Amblard F, Zhou S, Liu P, Kovari IA, Yang Z, Schinazi RF, Kovari LC. 2019. Structural and antiviral studies of the human norovirus GII.4 protease. Biochemistry 58:900–907. doi: 10.1021/acs.biochem.8b01063 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Croci R, Tarantino D, Milani M, Pezzullo M, Rohayem J, Bolognesi M, Mastrangelo E. 2014. PPNDS inhibits murine norovirus RNA-dependent RNA-polymerase mimicking two RNA stacking bases. FEBS Lett 588:1720–1725. doi: 10.1016/j.febslet.2014.03.021 [DOI] [PubMed] [Google Scholar]
34. Tarantino D, Pezzullo M, Mastrangelo E, Croci R, Rohayem J, Robel I, Bolognesi M, Milani M. 2014. Naphthalene-sulfonate inhibitors of human norovirus RNA-dependent RNA-polymerase. Antiviral Res 102:23–28. doi: 10.1016/j.antiviral.2013.11.016 [DOI] [PubMed] [Google Scholar]
35. Shaik MM, Bhattacharjee N, Feliks M, Ng KK-S, Field MJ. 2017. Norovirus RNA-dependent RNA polymerase: a computational study of metal-binding preferences. Proteins 85:1435–1445. doi: 10.1002/prot.25304 [DOI] [PubMed] [Google Scholar]
36. Giancotti G, Rigo I, Pasqualetto G, Young MT, Neyts J, Rocha-Pereira J, Brancale A, Ferla S, Bassetto M. 2019. A new antiviral scaffold for human norovirus identified with computer-aided approaches on the viral polymerase. Sci Rep 9:18413. doi: 10.1038/s41598-019-54903-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Smertina E, Urakova N, Strive T, Frese M. 2019. Calicivirus RNA-dependent RNA polymerases: evolution, structure, protein dynamics, and function. Front Microbiol 10:1280. doi: 10.3389/fmicb.2019.01280 [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Leen EN, Kwok KYR, Birtley JR, Simpson PJ, Subba-Reddy CV, Chaudhry Y, Sosnovtsev SV, Green KY, Prater SN, Tong M, Young JC, Chung LMW, Marchant J, Roberts LO, Kao CC, Matthews S, Goodfellow IG, Curry S. 2013. Structures of the compact helical core domains of feline calicivirus and murine norovirus VPg proteins. J Virol 87:5318–5330. doi: 10.1128/JVI.03151-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Eltahla AA, Lim KL, Eden JS, Kelly AG, Mackenzie JM, White PA. 2014. Nonnucleoside inhibitors of norovirus RNA polymerase: scaffolds for rational drug design. Antimicrob Agents Chemother 58:3115–3123. doi: 10.1128/AAC.02799-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Ferla S, Netzler NE, Ferla S, Veronese S, Tuipulotu DE, Guccione S, Brancale A, White PA, Bassetto M. 2018. In silico screening for human norovirus antivirals reveals a novel non-nucleoside inhibitor of the viral polymerase. Sci Rep 8:4129. doi: 10.1038/s41598-018-22303-y [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Netzler NE, Enosi Tuipulotu D, White PA. 2019. Norovirus antivirals: where are we now? Med Res Rev 39:860–886. doi: 10.1002/med.21545 [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Yi D, Li Q, Pang L, Wang Y, Zhang Y, Duan Z, Liang C, Cen S. 2020. Identification of a broad-spectrum viral inhibitor targeting a novel allosteric site in the RNA-dependent RNA polymerases of dengue virus and norovirus. Front Microbiol 11:1440. doi: 10.3389/fmicb.2020.01440 [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Kolawole AO, Rocha-Pereira J, Elftman MD, Neyts J, Wobus CE. 2016. Inhibition of human norovirus by a viral polymerase inhibitor in the B cell culture system and in the mouse model. Antiviral Res 132:46–49. doi: 10.1016/j.antiviral.2016.05.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Rocha-Pereira J, Jochmans D, Debing Y, Verbeken E, Nascimento MSJ, Neyts J. 2013. The viral polymerase inhibitor 2’-C-methylcytidine inhibits Norwalk virus replication and protects against norovirus-induced diarrhea and mortality in a mouse model. J Virol 87:11798–11805. doi: 10.1128/JVI.02064-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Dai W, Zhang B, Jiang XM, Su H, Li J, Zhao Y, Xie X, Jin Z, Peng J, Liu F, et al. 2020. Structure-based design of antiviral drug candidates targeting the SARS-CoV-2 main protease. Science 368:1331–1335. doi: 10.1126/science.abb4489 [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Eruera A-R, McSweeney AM, McKenzie-Goldsmith GM, Opel-Reading HK, Thomas SX, Campbell AC, Stubbing L, Siow A, Hubert JG, Brimble MA, Ward VK, Krause KL. 2023. Crystal structure of inhibitor-bound GII.4 Sydney 2012 norovirus 3C-like protease. Viruses 15:2202. doi: 10.3390/v15112202 [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Mastrangelo E, Pezzullo M, Tarantino D, Petazzi R, Germani F, Kramer D, Robel I, Rohayem J, Bolognesi M, Milani M. 2012. Structure-based inhibition of norovirus RNA-dependent RNA polymerases. J Mol Biol 419:198–210. doi: 10.1016/j.jmb.2012.03.008 [DOI] [PubMed] [Google Scholar]
48. Haddadin Z, Batarseh E, Hamdan L, Stewart LS, Piya B, Rahman H, Spieker AJ, Chappell J, Wikswo ME, Dunn JR, Payne DC, Vinjé J, Hall AJ, Halasa N. 2021. Characteristics of GII.4 norovirus versus other genotypes in sporadic pediatric infections in Davidson County, Tennessee, USA. Clin Infect Dis 73:e1525–e1531. doi: 10.1093/cid/ciaa1001 [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Bhavanam S, Freedman SB, Lee BE, Zhuo R, Qiu Y, Chui L, Xie J, Ali S, Vanderkooi OG, Pang XL, On Behalf Of The Alberta Provincial Pediatric Enteric Infection Team Appetite . 2020. Differences in illness severity among circulating norovirus genotypes in a large pediatric cohort with acute gastroenteritis. Microorganisms 8:1873. doi: 10.3390/microorganisms8121873 [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Desai R, Hembree CD, Handel A, Matthews JE, Dickey BW, McDonald S, Hall AJ, Parashar UD, Leon JS, Lopman B. 2012. Severe outcomes are associated with genogroup 2 genotype 4 norovirus outbreaks: a systematic literature review. Clin Infect Dis 55:189–193. doi: 10.1093/cid/cis372 [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Chan MCW, Sung JJY, Lam RKY, Chan PKS, Lee NLS, Lai RWM, Leung WK. 2006. Fecal viral load and norovirus-associated gastroenteritis. Emerg Infect Dis 12:1278–1280. doi: 10.3201/eid1208.060081 [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Urakova N, Netzler N, Kelly AG, Frese M, White PA, Strive T. 2016. Purification and biochemical characterisation of rabbit calicivirus RNA-dependent RNA polymerases and identification of non-nucleoside inhibitors. Viruses 8:100. doi: 10.3390/v8040100 [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Fukushi S, Kojima S, Takai R, Hoshino FB, Oka T, Takeda N, Katayama K, Kageyama T. 2004. Poly(A)- and primer-independent RNA polymerase of norovirus. J Virol 78:3889–3896. doi: 10.1128/jvi.78.8.3889-3896.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Gribble FM, Loussouarn G, Tucker SJ, Zhao C, Nichols CG, Ashcroft FM. 2000. A novel method for measurement of submembrane ATP concentration. J Biol Chem 275:30046–30049. doi: 10.1074/jbc.M001010200 [DOI] [PubMed] [Google Scholar]
55. Traut TW. 1994. Physiological concentrations of purines and pyrimidines. Mol Cell Biochem 140:1–22. doi: 10.1007/BF00928361 [DOI] [PubMed] [Google Scholar]
56. Schweitzer C, Scaiano JC. 2003. Selective binding and local photophysics of the fluorescent cyanine dye PicoGreen in double-stranded and single-stranded DNA. Phys Chem Chem Phys 5:4911. doi: 10.1039/b305921a [DOI] [Google Scholar]
57. Varshney D, Spiegel J, Zyner K, Tannahill D, Balasubramanian S. 2020. The regulation and functions of DNA and RNA G-quadruplexes. Nat Rev Mol Cell Biol 21:459–474. doi: 10.1038/s41580-020-0236-x [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Huppert JL, Balasubramanian S. 2007. G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res 35:406–413. doi: 10.1093/nar/gkl1057 [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Kumari S, Bugaut A, Huppert JL, Balasubramanian S. 2007. An RNA G-quadruplex in the 5’ UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol 3:218–221. doi: 10.1038/nchembio864 [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Kwok CK, Balasubramanian S. 2015. Targeted detection of G-quadruplexes in cellular RNAs. Angew Chem Int Ed Engl 54:6751–6754. doi: 10.1002/anie.201500891 [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Creacy SD, Routh ED, Iwamoto F, Nagamine Y, Akman SA, Vaughn JP. 2008. G4 resolvase 1 binds both DNA and RNA tetramolecular quadruplex with high affinity and is the major source of tetramolecular quadruplex G4-DNA and G4-RNA resolving activity in HeLa cell lysates. J Biol Chem 283:34626–34634. doi: 10.1074/jbc.M806277200 [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Chaudhry Y, Nayak A, Bordeleau ME, Tanaka J, Pelletier J, Belsham GJ, Roberts LO, Goodfellow IG. 2006. Caliciviruses differ in their functional requirements for eIF4F components. J Biol Chem 281:25315–25325. doi: 10.1074/jbc.M602230200 [DOI] [PubMed] [Google Scholar]
63. Rohayem J, Jäger K, Robel I, Scheffler U, Temme A, Rudolph W. 2006. Characterization of norovirus 3Dpol RNA-dependent RNA polymerase activity and initiation of RNA synthesis. J Gen Virol 87:2621–2630. doi: 10.1099/vir.0.81802-0 [DOI] [PubMed] [Google Scholar]
64. Ferrer-Orta C, Arias A, Pérez-Luque R, Escarmís C, Domingo E, Verdaguer N. 2007. Sequential structures provide insights into the fidelity of RNA replication. Proc Natl Acad Sci U S A 104:9463–9468. doi: 10.1073/pnas.0700518104 [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Gohara DW, Crotty S, Arnold JJ, Yoder JD, Andino R, Cameron CE. 2000. Poliovirus RNA-dependent RNA polymerase (3Dpol): structural, biochemical, and biological analysis of conserved structural motifs A and B. J Biol Chem 275:25523–25532. doi: 10.1074/jbc.M002671200 [DOI] [PubMed] [Google Scholar]
66. Andino R, Rieckhof GE, Achacoso PL, Baltimore D. 1993. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5’-end of viral RNA. EMBO J 12:3587–3598. doi: 10.1002/j.1460-2075.1993.tb06032.x [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Gamarnik AV, Andino R. 2000. Interactions of viral protein 3CD and poly(rC) binding protein with the 5’ untranslated region of the poliovirus genome. J Virol 74:2219–2226. doi: 10.1128/jvi.74.5.2219-2226.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Deshpande S, Huo W, Shrestha R, Sparrow K, Wood JM, Evans GB, Harris LD, Kingston RL, Bulloch EMM. 2023. Galidesivir triphosphate promotes stalling of dengue-2 virus polymerase immediately prior to incorporation. ACS Infect Dis 9:1658–1673. doi: 10.1021/acsinfecdis.3c00311 [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Eltahla AA, Lackovic K, Marquis C, Eden JS, White PA. 2013. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis C virus RNA polymerase. J Biomol Screen 18:1027–1034. doi: 10.1177/1087057113489883 [DOI] [PubMed] [Google Scholar]
70. Punjani A, Rubinstein JL, Fleet DJ, Brubaker MA. 2017. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14:290–296. doi: 10.1038/nmeth.4169 [DOI] [PubMed] [Google Scholar]
71. Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung L-W, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH. 2010. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66:213–221. doi: 10.1107/S0907444909052925 [DOI] [PMC free article] [PubMed] [Google Scholar]
72. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. 2007. Phaser crystallographic software. J Appl Crystallogr 40:658–674. doi: 10.1107/S0021889807021206 [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60:2126–2132. doi: 10.1107/S0907444904019158 [DOI] [PubMed] [Google Scholar]
74. Croll TI. 2018. ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol 74:519–530. doi: 10.1107/S2059798318002425 [DOI] [PMC free article] [PubMed] [Google Scholar]
75. Davis IW, Leaver-Fay A, Chen VB, Block JN, Kapral GJ, Wang X, Murray LW, Arendall WB, Snoeyink J, Richardson JS, Richardson DC. 2007. MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res 35:W375–W383. doi: 10.1093/nar/gkm216 [DOI] [PMC free article] [PubMed] [Google Scholar]
76. Pettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE. 2021. UCSF ChimeraX: structure visualization for researchers, educators, and developers. Protein Sci 30:70–82. doi: 10.1002/pro.3943 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental figures. jvi.01193-24-s0001.pdf.

Figures S1 to S6.

jvi.01193-24-s0001.pdf^{(4.3MB, pdf)}

DOI: 10.1128/jvi.01193-24.SuF1

Data Availability Statement

[B1] 1. Chhabra P, de Graaf M, Parra GI, Chan MC-W, Green K, Martella V, Wang Q, White PA, Katayama K, Vennema H, Koopmans MPG, Vinjé J. 2019. Updated classification of norovirus genogroups and genotypes. J Gen Virol 100:1393–1406. doi: 10.1099/jgv.0.001318 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2. Kapikian AZ, Wyatt RG, Dolin R, Thornhill TS, Kalica AR, Chanock RM. 1972. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol 10:1075–1081. doi: 10.1128/JVI.10.5.1075-1081.1972 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3. Wolf S, Williamson W, Hewitt J, Lin S, Rivera-Aban M, Ball A, Scholes P, Savill M, Greening GE. 2009. Molecular detection of norovirus in sheep and pigs in New Zealand farms. Vet Microbiol 133:184–189. doi: 10.1016/j.vetmic.2008.06.019 [DOI] [PubMed] [Google Scholar]

[B4] 4. Karst SM, Wobus CE, Lay M, Davidson J, Virgin HW 4th. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575–1578. doi: 10.1126/science.1077905 [DOI] [PubMed] [Google Scholar]

[B5] 5. Liu BL, Lambden PR, Günther H, Otto P, Elschner M, Clarke IN. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J Virol 73:819–825. doi: 10.1128/JVI.73.1.819-825.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Pires SM, Fischer-Walker CL, Lanata CF, Devleesschauwer B, Hall AJ, Kirk MD, Duarte ASR, Black RE, Angulo FJ. 2015. Aetiology-specific estimates of the global and regional incidence and mortality of diarrhoeal diseases commonly transmitted through food. PLoS One 10:e0142927. doi: 10.1371/journal.pone.0142927 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7. Cornejo-Sánchez T, Soldevila N, Coronas L, Alsedà M, Godoy P, Razquín E, Sabaté S, Guix S, Rodríguez Garrido V, Bartolomé R, Domínguez A, Working Group for the Study of Outbreaks of Acute Gastroenteritis in Catalonia . 2023. Epidemiology of GII.4 and GII.2 norovirus outbreaks in closed and semi-closed institutions in 2017 and 2018. Sci Rep 13:1659. doi: 10.1038/s41598-023-28448-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Van Dycke J, Ny A, Conceição-Neto N, Maes J, Hosmillo M, Cuvry A, Goodfellow I, Nogueira TC, Verbeken E, Matthijnssens J, de Witte P, Neyts J, Rocha-Pereira J. 2019. A robust human norovirus replication model in zebrafish larvae. PLoS Pathog 15:e1008009. doi: 10.1371/journal.ppat.1008009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Estes MK, Ettayebi K, Tenge VR, Murakami K, Karandikar U, Lin S-C, Ayyar BV, Cortes-Penfield NW, Haga K, Neill FH, Opekun AR, Broughman JR, Zeng X-L, Blutt SE, Crawford SE, Ramani S, Graham DY, Atmar RL. 2019. Human norovirus cultivation in nontransformed stem cell-derived human intestinal enteroid cultures: success and challenges. Viruses 11:638. doi: 10.3390/v11070638 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Ettayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U, Tenge VR, Neill FH, Blutt SE, Zeng X-L, Qu L, Kou B, Opekun AR, Burrin D, Graham DY, Ramani S, Atmar RL, Estes MK. 2016. Replication of human noroviruses in stem cell–derived human enteroids. Science 353:1387–1393. doi: 10.1126/science.aaf5211 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Belliot G, Sosnovtsev SV, Mitra T, Hammer C, Garfield M, Green KY. 2003. In vitro proteolytic processing of the MD145 norovirus ORF1 nonstructural polyprotein yields stable precursors and products similar to those detected in calicivirus-infected cells. J Virol 77:10957–10974. doi: 10.1128/jvi.77.20.10957-10974.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Seah EL, Marshall JA, Wright PJ. 1999. Open reading frame 1 of the Norwalk-like virus Camberwell: completion of sequence and expression in mammalian cells. J Virol 73:10531–10535. doi: 10.1128/JVI.73.12.10531-10535.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Yost SA, Marcotrigiano J. 2013. Viral precursor polyproteins: keys of regulation from replication to maturation. Curr Opin Virol 3:137–142. doi: 10.1016/j.coviro.2013.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Spear A, Ogram SA, Morasco BJ, Smerage LE, Flanegan JB. 2015. Viral precursor protein P3 and its processed products perform discrete and essential functions in the poliovirus RNA replication complex. Virology (Auckl) 485:492–501. doi: 10.1016/j.virol.2015.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Moffat K, Knox C, Howell G, Clark SJ, Yang H, Belsham GJ, Ryan M, Wileman T. 2007. Inhibition of the secretory pathway by foot-and-mouth disease virus 2BC protein is reproduced by coexpression of 2B with 2C, and the site of inhibition is determined by the subcellular location of 2C. J Virol 81:1129–1139. doi: 10.1128/JVI.00393-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. Harris KS, Reddigari SR, Nicklin MJ, Hämmerle T, Wimmer E. 1992. Purification and characterization of poliovirus polypeptide 3CD, a proteinase and a precursor for RNA polymerase. J Virol 66:7481–7489. doi: 10.1128/jvi.66.12.7481-7489.1992 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Belliot G, Sosnovtsev SV, Chang KO, Babu V, Uche U, Arnold JJ, Cameron CE, Green KY. 2005. Norovirus proteinase-polymerase and polymerase are both active forms of RNA-dependent RNA polymerase. J Virol 79:2393–2403. doi: 10.1128/JVI.79.4.2393-2403.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18. Medvedev A, Viswanathan P, May J, Korba B. 2017. Regulation of human norovirus VPg nucleotidylylation by ProPol and nucleoside triphosphate binding by its amino terminal sequence in vitro. Virology (Auckl) 503:37–45. doi: 10.1016/j.virol.2017.01.003 [DOI] [PubMed] [Google Scholar]

[B19] 19. Belliot G, Sosnovtsev SV, Chang KO, McPhie P, Green KY. 2008. Nucleotidylylation of the VPg protein of a human norovirus by its proteinase-polymerase precursor protein. Virology (Auckl) 374:33–49. doi: 10.1016/j.virol.2007.12.028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Machín A, Martín Alonso JM, Dalton KP, Parra F. 2009. Functional differences between precursor and mature forms of the RNA-dependent RNA polymerase from rabbit hemorrhagic disease virus. J Gen Virol 90:2114–2118. doi: 10.1099/vir.0.011296-0 [DOI] [PubMed] [Google Scholar]

[B21] 21. Wei L, Huhn JS, Mory A, Pathak HB, Sosnovtsev SV, Green KY, Cameron CE. 2001. Proteinase-polymerase precursor as the active form of feline calicivirus RNA-dependent RNA polymerase. J Virol 75:1211–1219. doi: 10.1128/JVI.75.3.1211-1219.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. May J, Korba B, Medvedev A, Viswanathan P. 2013. Enzyme kinetics of the human norovirus protease control virus polyprotein processing order. Virology (Auckl) 444:218–224. doi: 10.1016/j.virol.2013.06.013 [DOI] [PubMed] [Google Scholar]

[B23] 23. Scheffler U, Rudolph W, Gebhardt J, Rohayem J. 2007. Differential cleavage of the norovirus polyprotein precursor by two active forms of the viral protease. J Gen Virol 88:2013–2018. doi: 10.1099/vir.0.82797-0 [DOI] [PubMed] [Google Scholar]

[B24] 24. Viswanathan P, May J, Uhm S, Yon C, Korba B. 2013. RNA binding by human Norovirus 3C-like proteases inhibits protease activity. Virology (Auckl) 438:20–27. doi: 10.1016/j.virol.2013.01.006 [DOI] [PubMed] [Google Scholar]

[B25] 25. Han KR, Choi Y, Min BS, Jeong H, Cheon D, Kim J, Jee Y, Shin S, Yang JM. 2010. Murine norovirus-1 3Dpol exhibits RNA-dependent RNA polymerase activity and nucleotidylylates on Tyr of the VPg. J Gen Virol 91:1713–1722. doi: 10.1099/vir.0.020461-0 [DOI] [PubMed] [Google Scholar]

[B26] 26. Rohayem J, Robel I, Jäger K, Scheffler U, Rudolph W. 2006. Protein-primed and de novo initiation of RNA synthesis by norovirus 3Dpol. J Virol 80:7060–7069. doi: 10.1128/JVI.02195-05 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Marcotte LL, Wass AB, Gohara DW, Pathak HB, Arnold JJ, Filman DJ, Cameron CE, Hogle JM. 2007. Crystal structure of poliovirus 3CD protein: virally encoded protease and precursor to the RNA-dependent RNA polymerase. J Virol 81:3583–3596. doi: 10.1128/JVI.02306-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Lee JH, Park BS, Han KR, Biering SB, Kim SJ, Choi J, Seok JH, Alam I, Chung MS, Kim HM, Hwang S, Kim KH. 2018. Insight Into the interaction between RNA polymerase and VPg for murine norovirus replication. Front Microbiol 9:1466. doi: 10.3389/fmicb.2018.01466 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Fernandes H, Leen EN, Cromwell H, Pfeil MP, Curry S. 2015. Structure determination of murine norovirus NS6 proteases with C-terminal extensions designed to probe protease-substrate interactions. PeerJ 3:e798. doi: 10.7717/peerj.798 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30. Zhao B, Hu L, Song Y, Patil K, Ramani S, Atmar RL, Estes MK, Prasad BVV. 2021. Norovirus protease structure and antivirals development. Viruses 13:2069. doi: 10.3390/v13102069 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Deval J, Jin Z, Chuang YC, Kao CC. 2017. Structure(s), function(s), and inhibition of the RNA-dependent RNA polymerase of noroviruses. Virus Res 234:21–33. doi: 10.1016/j.virusres.2016.12.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32. Muzzarelli KM, Kuiper B, Spellmon N, Brunzelle J, Hackett J, Amblard F, Zhou S, Liu P, Kovari IA, Yang Z, Schinazi RF, Kovari LC. 2019. Structural and antiviral studies of the human norovirus GII.4 protease. Biochemistry 58:900–907. doi: 10.1021/acs.biochem.8b01063 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Croci R, Tarantino D, Milani M, Pezzullo M, Rohayem J, Bolognesi M, Mastrangelo E. 2014. PPNDS inhibits murine norovirus RNA-dependent RNA-polymerase mimicking two RNA stacking bases. FEBS Lett 588:1720–1725. doi: 10.1016/j.febslet.2014.03.021 [DOI] [PubMed] [Google Scholar]

[B34] 34. Tarantino D, Pezzullo M, Mastrangelo E, Croci R, Rohayem J, Robel I, Bolognesi M, Milani M. 2014. Naphthalene-sulfonate inhibitors of human norovirus RNA-dependent RNA-polymerase. Antiviral Res 102:23–28. doi: 10.1016/j.antiviral.2013.11.016 [DOI] [PubMed] [Google Scholar]

[B35] 35. Shaik MM, Bhattacharjee N, Feliks M, Ng KK-S, Field MJ. 2017. Norovirus RNA-dependent RNA polymerase: a computational study of metal-binding preferences. Proteins 85:1435–1445. doi: 10.1002/prot.25304 [DOI] [PubMed] [Google Scholar]

[B36] 36. Giancotti G, Rigo I, Pasqualetto G, Young MT, Neyts J, Rocha-Pereira J, Brancale A, Ferla S, Bassetto M. 2019. A new antiviral scaffold for human norovirus identified with computer-aided approaches on the viral polymerase. Sci Rep 9:18413. doi: 10.1038/s41598-019-54903-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Smertina E, Urakova N, Strive T, Frese M. 2019. Calicivirus RNA-dependent RNA polymerases: evolution, structure, protein dynamics, and function. Front Microbiol 10:1280. doi: 10.3389/fmicb.2019.01280 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Leen EN, Kwok KYR, Birtley JR, Simpson PJ, Subba-Reddy CV, Chaudhry Y, Sosnovtsev SV, Green KY, Prater SN, Tong M, Young JC, Chung LMW, Marchant J, Roberts LO, Kao CC, Matthews S, Goodfellow IG, Curry S. 2013. Structures of the compact helical core domains of feline calicivirus and murine norovirus VPg proteins. J Virol 87:5318–5330. doi: 10.1128/JVI.03151-12 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Eltahla AA, Lim KL, Eden JS, Kelly AG, Mackenzie JM, White PA. 2014. Nonnucleoside inhibitors of norovirus RNA polymerase: scaffolds for rational drug design. Antimicrob Agents Chemother 58:3115–3123. doi: 10.1128/AAC.02799-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Ferla S, Netzler NE, Ferla S, Veronese S, Tuipulotu DE, Guccione S, Brancale A, White PA, Bassetto M. 2018. In silico screening for human norovirus antivirals reveals a novel non-nucleoside inhibitor of the viral polymerase. Sci Rep 8:4129. doi: 10.1038/s41598-018-22303-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41. Netzler NE, Enosi Tuipulotu D, White PA. 2019. Norovirus antivirals: where are we now? Med Res Rev 39:860–886. doi: 10.1002/med.21545 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Yi D, Li Q, Pang L, Wang Y, Zhang Y, Duan Z, Liang C, Cen S. 2020. Identification of a broad-spectrum viral inhibitor targeting a novel allosteric site in the RNA-dependent RNA polymerases of dengue virus and norovirus. Front Microbiol 11:1440. doi: 10.3389/fmicb.2020.01440 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Kolawole AO, Rocha-Pereira J, Elftman MD, Neyts J, Wobus CE. 2016. Inhibition of human norovirus by a viral polymerase inhibitor in the B cell culture system and in the mouse model. Antiviral Res 132:46–49. doi: 10.1016/j.antiviral.2016.05.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Rocha-Pereira J, Jochmans D, Debing Y, Verbeken E, Nascimento MSJ, Neyts J. 2013. The viral polymerase inhibitor 2’-C-methylcytidine inhibits Norwalk virus replication and protects against norovirus-induced diarrhea and mortality in a mouse model. J Virol 87:11798–11805. doi: 10.1128/JVI.02064-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45. Dai W, Zhang B, Jiang XM, Su H, Li J, Zhao Y, Xie X, Jin Z, Peng J, Liu F, et al. 2020. Structure-based design of antiviral drug candidates targeting the SARS-CoV-2 main protease. Science 368:1331–1335. doi: 10.1126/science.abb4489 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Eruera A-R, McSweeney AM, McKenzie-Goldsmith GM, Opel-Reading HK, Thomas SX, Campbell AC, Stubbing L, Siow A, Hubert JG, Brimble MA, Ward VK, Krause KL. 2023. Crystal structure of inhibitor-bound GII.4 Sydney 2012 norovirus 3C-like protease. Viruses 15:2202. doi: 10.3390/v15112202 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Mastrangelo E, Pezzullo M, Tarantino D, Petazzi R, Germani F, Kramer D, Robel I, Rohayem J, Bolognesi M, Milani M. 2012. Structure-based inhibition of norovirus RNA-dependent RNA polymerases. J Mol Biol 419:198–210. doi: 10.1016/j.jmb.2012.03.008 [DOI] [PubMed] [Google Scholar]

[B48] 48. Haddadin Z, Batarseh E, Hamdan L, Stewart LS, Piya B, Rahman H, Spieker AJ, Chappell J, Wikswo ME, Dunn JR, Payne DC, Vinjé J, Hall AJ, Halasa N. 2021. Characteristics of GII.4 norovirus versus other genotypes in sporadic pediatric infections in Davidson County, Tennessee, USA. Clin Infect Dis 73:e1525–e1531. doi: 10.1093/cid/ciaa1001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49. Bhavanam S, Freedman SB, Lee BE, Zhuo R, Qiu Y, Chui L, Xie J, Ali S, Vanderkooi OG, Pang XL, On Behalf Of The Alberta Provincial Pediatric Enteric Infection Team Appetite . 2020. Differences in illness severity among circulating norovirus genotypes in a large pediatric cohort with acute gastroenteritis. Microorganisms 8:1873. doi: 10.3390/microorganisms8121873 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50. Desai R, Hembree CD, Handel A, Matthews JE, Dickey BW, McDonald S, Hall AJ, Parashar UD, Leon JS, Lopman B. 2012. Severe outcomes are associated with genogroup 2 genotype 4 norovirus outbreaks: a systematic literature review. Clin Infect Dis 55:189–193. doi: 10.1093/cid/cis372 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51. Chan MCW, Sung JJY, Lam RKY, Chan PKS, Lee NLS, Lai RWM, Leung WK. 2006. Fecal viral load and norovirus-associated gastroenteritis. Emerg Infect Dis 12:1278–1280. doi: 10.3201/eid1208.060081 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52. Urakova N, Netzler N, Kelly AG, Frese M, White PA, Strive T. 2016. Purification and biochemical characterisation of rabbit calicivirus RNA-dependent RNA polymerases and identification of non-nucleoside inhibitors. Viruses 8:100. doi: 10.3390/v8040100 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53. Fukushi S, Kojima S, Takai R, Hoshino FB, Oka T, Takeda N, Katayama K, Kageyama T. 2004. Poly(A)- and primer-independent RNA polymerase of norovirus. J Virol 78:3889–3896. doi: 10.1128/jvi.78.8.3889-3896.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54. Gribble FM, Loussouarn G, Tucker SJ, Zhao C, Nichols CG, Ashcroft FM. 2000. A novel method for measurement of submembrane ATP concentration. J Biol Chem 275:30046–30049. doi: 10.1074/jbc.M001010200 [DOI] [PubMed] [Google Scholar]

[B55] 55. Traut TW. 1994. Physiological concentrations of purines and pyrimidines. Mol Cell Biochem 140:1–22. doi: 10.1007/BF00928361 [DOI] [PubMed] [Google Scholar]

[B56] 56. Schweitzer C, Scaiano JC. 2003. Selective binding and local photophysics of the fluorescent cyanine dye PicoGreen in double-stranded and single-stranded DNA. Phys Chem Chem Phys 5:4911. doi: 10.1039/b305921a [DOI] [Google Scholar]

[B57] 57. Varshney D, Spiegel J, Zyner K, Tannahill D, Balasubramanian S. 2020. The regulation and functions of DNA and RNA G-quadruplexes. Nat Rev Mol Cell Biol 21:459–474. doi: 10.1038/s41580-020-0236-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58. Huppert JL, Balasubramanian S. 2007. G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res 35:406–413. doi: 10.1093/nar/gkl1057 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Kumari S, Bugaut A, Huppert JL, Balasubramanian S. 2007. An RNA G-quadruplex in the 5’ UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol 3:218–221. doi: 10.1038/nchembio864 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60. Kwok CK, Balasubramanian S. 2015. Targeted detection of G-quadruplexes in cellular RNAs. Angew Chem Int Ed Engl 54:6751–6754. doi: 10.1002/anie.201500891 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Creacy SD, Routh ED, Iwamoto F, Nagamine Y, Akman SA, Vaughn JP. 2008. G4 resolvase 1 binds both DNA and RNA tetramolecular quadruplex with high affinity and is the major source of tetramolecular quadruplex G4-DNA and G4-RNA resolving activity in HeLa cell lysates. J Biol Chem 283:34626–34634. doi: 10.1074/jbc.M806277200 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62. Chaudhry Y, Nayak A, Bordeleau ME, Tanaka J, Pelletier J, Belsham GJ, Roberts LO, Goodfellow IG. 2006. Caliciviruses differ in their functional requirements for eIF4F components. J Biol Chem 281:25315–25325. doi: 10.1074/jbc.M602230200 [DOI] [PubMed] [Google Scholar]

[B63] 63. Rohayem J, Jäger K, Robel I, Scheffler U, Temme A, Rudolph W. 2006. Characterization of norovirus 3Dpol RNA-dependent RNA polymerase activity and initiation of RNA synthesis. J Gen Virol 87:2621–2630. doi: 10.1099/vir.0.81802-0 [DOI] [PubMed] [Google Scholar]

[B64] 64. Ferrer-Orta C, Arias A, Pérez-Luque R, Escarmís C, Domingo E, Verdaguer N. 2007. Sequential structures provide insights into the fidelity of RNA replication. Proc Natl Acad Sci U S A 104:9463–9468. doi: 10.1073/pnas.0700518104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65. Gohara DW, Crotty S, Arnold JJ, Yoder JD, Andino R, Cameron CE. 2000. Poliovirus RNA-dependent RNA polymerase (3Dpol): structural, biochemical, and biological analysis of conserved structural motifs A and B. J Biol Chem 275:25523–25532. doi: 10.1074/jbc.M002671200 [DOI] [PubMed] [Google Scholar]

[B66] 66. Andino R, Rieckhof GE, Achacoso PL, Baltimore D. 1993. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5’-end of viral RNA. EMBO J 12:3587–3598. doi: 10.1002/j.1460-2075.1993.tb06032.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67. Gamarnik AV, Andino R. 2000. Interactions of viral protein 3CD and poly(rC) binding protein with the 5’ untranslated region of the poliovirus genome. J Virol 74:2219–2226. doi: 10.1128/jvi.74.5.2219-2226.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B68] 68. Deshpande S, Huo W, Shrestha R, Sparrow K, Wood JM, Evans GB, Harris LD, Kingston RL, Bulloch EMM. 2023. Galidesivir triphosphate promotes stalling of dengue-2 virus polymerase immediately prior to incorporation. ACS Infect Dis 9:1658–1673. doi: 10.1021/acsinfecdis.3c00311 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69. Eltahla AA, Lackovic K, Marquis C, Eden JS, White PA. 2013. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis C virus RNA polymerase. J Biomol Screen 18:1027–1034. doi: 10.1177/1087057113489883 [DOI] [PubMed] [Google Scholar]

[B70] 70. Punjani A, Rubinstein JL, Fleet DJ, Brubaker MA. 2017. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14:290–296. doi: 10.1038/nmeth.4169 [DOI] [PubMed] [Google Scholar]

[B71] 71. Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung L-W, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH. 2010. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66:213–221. doi: 10.1107/S0907444909052925 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. 2007. Phaser crystallographic software. J Appl Crystallogr 40:658–674. doi: 10.1107/S0021889807021206 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] 73. Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60:2126–2132. doi: 10.1107/S0907444904019158 [DOI] [PubMed] [Google Scholar]

[B74] 74. Croll TI. 2018. ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol 74:519–530. doi: 10.1107/S2059798318002425 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 75. Davis IW, Leaver-Fay A, Chen VB, Block JN, Kapral GJ, Wang X, Murray LW, Arendall WB, Snoeyink J, Richardson JS, Richardson DC. 2007. MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res 35:W375–W383. doi: 10.1093/nar/gkm216 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B76] 76. Pettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE. 2021. UCSF ChimeraX: structure visualization for researchers, educators, and developers. Protein Sci 30:70–82. doi: 10.1002/pro.3943 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Activity and cryo-EM structure of the polymerase domain of the human norovirus ProPol precursor

Alice M McSweeney

Alice-Roza Eruera

Geena M McKenzie-Goldsmith

James C Bouwer

Simon H J Brown

Louise A Stubbing

Jonathan G Hubert

Rinu Shrestha

Kevin J Sparrow

Margaret A Brimble

Lawrence D Harris

Gary B Evans

Mihnea Bostina

Kurt L Krause

Vernon K Ward

Roles

ABSTRACT

IMPORTANCE

INTRODUCTION

RESULTS

Norovirus ProPol initiates de novo RNA synthesis on homopolymeric RNA templates

Fig 1.

Kinetic analysis of norovirus ProPol and Pol

Fig 2.

TABLE 1.

Fig 3.

TABLE 2.

Fig 4.

TABLE 3.

Cryo-EM structure of the polymerase domain of GII.4 ProPol

Fig 5.

Comparison of antivirals targeting HuNV ProPol and Pol

Fig 6.

Fig 7.

Fig 8.

DISCUSSION

MATERIALS AND METHODS

Compounds

Construction of norovirus ProPol and Pol plasmids

TABLE 4.

Expression and purification of SUMO fusion proteins for enzymatic analyses

Expression of H6ProPol for cryo-EM

Protease assay with Pro and ProPol

Kinetics of ProPol and Pol activity

Enzymatic IC50 assay

Cryo-EM sample preparation and data collection

TABLE 5.

Cryo-EM data processing and model building

ACKNOWLEDGMENTS

Contributor Information

DATA AVAILABILITY

SUPPLEMENTAL MATERIAL

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Expression of H₆ProPol for cryo-EM

Enzymatic IC₅₀ assay