Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Oct 24;103(12):104439. doi: 10.1016/j.psj.2024.104439

Selenomethionine alleviates kidney necroptosis and inflammation by restoring lipopolysaccharide-mediated mitochondrial dynamics imbalance via the TLR4/RIPK3/DRP1 signaling pathway in laying hens1

Xinzhang Chen a, Yixuan Wang a, Muyue Zhang a, Yongzhen Du a, Yujiao He b, Shu Li a,
PMCID: PMC11577205  PMID: 39504830

Abstract

Selenomethionine (SeMet) is a beneficial organic source of selenium that is extensively used as a food additive owing to its antioxidant and anti-inflammatory properties. Due to the sensitivity of the kidneys to noxious stimuli, they are more susceptible to various injuries. To investigate the protective mechanisms of SeMet supplementation against kidney injury, we established an in vivo experimental model using laying hens treated with SeMet (0.5 mg/kg diet) and/or lipopolysaccharide (LPS) (0.2 mg/kg. BW) and an in vitro model of chicken embryo primary kidney (CEK) cells treated with SeMet (0.075 mM) and with/ without LPS (60 μg/mL). SeMet treatment alleviated the LPS-induced kidney insufficiency and mitochondrial damage. Furthermore, it reduced the expression of TLR4, RIPK3, MLKL, DRP1, NLRP3, and IL-1β in the kidneys of laying hens. RIPK3 is known to induced necroptosis and inflammation by activating of the downstream factors DRP1 and MLKL. To investigate the mechanism whereby SeMet alleviates LPS-induced necroptosis in the kidney, we pretreated CEK cells with TLR4, RIPK3, and DRP1 inhibitors. The results demonstrated that RIPK3 inhibition resulted in a significantly increased in the mitochondrial membrane potential and downregulation of DRP1. Upon the inhibition of DRP1 expression, MLKL, NLRP3, and IL-1β expression also decreased. In summary, SeMet regulates the TLR4/RIPK3/DRP1 signaling pathway to restore the LPS-induced imbalances in mitochondrial dynamics, thereby alleviating necroptosis and inflammation in the kidneys of laying hen. Selenium also increases the expression of selenoproteins. This study provides valuable information for the development of new therapeutic strategies using SeMet to alleviate kidney injury.

Key words: Selenomethionine, Laying Hen, Necroptosis, Mitochondrial dynamics, Inflammation

Graphical abstract

Image, graphical abstract

Introduction

Selenium (Se) is a beneficial micronutrient for humans and animals with antioxidant, anti-inflammatory and anti-cancer functions (Ali Calik et al., 2022; Wang et al., 2024). An insufficient supply of Se affects several metabolic processes and causes diverse symptoms, such as growth reduction, loss of appetite, reproductive defects, decreased immunity, general diseases and reduced durability of meat and other livestock products (Ghassemi Nejad et al., 2023). Currently, it is recognized that an adequate Se intake is essential for maintenance of the immune, endocrine, cardiovascular, reproductive, and neurological systems(Wang, et al., 2023). Accordingly, Se is extensively added to foods that are consumed on a daily basis, such as Se-rich rice and royal jelly(Chi et al., 2021). However, ingested Se predominantly occurs in the form of selenomethionine (SeMet or organic Se). SeMet has been reported to effectively mitigate the damaging effects of diverse noxious stimuli on several organs (Chen et al., 2024). SeMet regulates cyclic GMP-AMP synthase expression and alleviates PM2.5-induced lung inflammation through the STING/NF-κB pathway (Wang et al., 2022). SeMet inhibits endometrial inflammation and necroptosis by modulating the PPAR-γ mediated NF-κB pathway (Cao et al., 2023). Thus, SeMet is more potent, bioavailable, and extensively used than inorganic Se. However, the beneficial effects of SeMet against kidney damage in laying hens require further study.

Toll-like receptor 4 (TLR4) is a common receptor of lipopolysaccharide (LPS). It is closely associated with the development of several diseases via myeloid differentiation factor 88 (MyD88)-dependent and MyD88-independent (TRIF-dependent) pathways (Andrei and Vogel, 2006). The TRIF signaling pathway can directly activate necrosis by interacting with RIPK through the RHIM sequence of TRIF (Baker et al., 2022). Acetaminophen induces necroptosis in hepatocytes through the TLR4/RIPK3 signaling pathway (Minsart, et al., 2020). Chu et al. found that NETs formation exacerbates intestinal epithelial cell necroptosis through the TLR4/RIPK3/FUNDC1 signaling pathway during ischemia/reperfusion (Chu et al., 2023). In the early stages of necroptosis, RIPK3 activates phosphoglycerate mutase family member 5 (PGAM5) located in the outer mitochondrial membrane, causing DRP1 translocation to the outer mitochondrial membrane and activating its GTPase activity, which promotes mitochondrial fragmentation, increases reactive oxygen species production, and leads to cell death (Horváth. et al., 2023). Ramachandran et al. demonstrated that acetanilide induces necroptosis in mouse hepatocytes via RIPK3-mediated mitochondrial dysfunction (Ramachandran et al., 2013). Methamphetamine exposure stimulates necroptosis via activation of the RIPK3/DRP1 pathway in neuronal cells (Zhao. et al., 2021). Mitochondrial dynamics, involving mitochondrial fusion and fission (splitting) and ultrastructural remodeling of the mitochondrial membrane (Giacomello et al., 2020). Thus, mitochondrial dynamics orchestrates complex cellular signaling events, such as those involved in regulating cell pluripotency, division, differentiation, senescence, and death (Giacomello et al., 2020). Excessive activation of DRP1 causes an imbalance in the mitochondrial dynamics, leading to necroptosis. Additionally, DRP1 activation is strongly associated with inflammation. DRP1 is a key signaling molecule downstream of serine/threonine kinase 3 (RIPK3), which is involved in recombinant receptor interactions, and plays a role in receptor interactions (Guo. et al., 2014). Activation of DRP1 by RIPK3 leads to necrosis and inflammation, but whether DRP1 plays a role in inflammation is unclear. Li et al. found that metformin blocked NLRP3 activation in the adipose tissue of hyperglycemic mice by repressing DRP1-mediated mitochondrial fission (Li. et al., 2016). These studies suggest that the DRP1-mediated mitochondrial dynamics imbalance plays a key role in necroptosis and inflammation and that DRP1 inhibition may be an effective approach to alleviating the pathological processes of necroptosis and inflammatory diseases.

LPS is a bacterial endotoxin commonly used to construct inflammation models which can induces extensive tissue injury and activate signaling pathways in the TLR family. SeMet is an organic form of selenium extensively used as a food additive to mitigate bodily damage by reducing oxidative stress, necroptosis, and inflammation (Shen et al., 2015; Chen et al., 2022). To probe the specific mechanism of SeMet in easing the LPS-induced kidney damage, laying hen and chicken embryo primary kidney (CEK) cells were used as experimental models. A series of indicators, including histopathological and ultrastructural kidney observations, kidney function, necroptosis, mitochondrial dynamics, and inflammation indicators, were evaluated. Immunofluorescence, qRT-PCR, western blotting, acridine orange/ethidium bromide (AO/EB) staining, Hoechst 33342/propidium iodide (PI) staining, and JC-1 staining were used to determine the status of necroptosis, mitochondrial dynamics, and inflammation-associated factors in the kidney and CEK cells. Inhibitors of TLR4, RIPK3, and DRP1 were used to explore the mechanism whereby SeMet attenuates the LPS-stimulated necroptosis and inflammation in CEK cells. SeMet treatment inhibited LPS-induced DRP1 overactivation via the TLR4/RIPK3 pathway and restored the balance of mitochondrial dynamics, which further attenuated necroptosis and inflammation. SeMet addition significantly enhanced the expression of selenoproteins, potentially enhancing poultry immunity. This study provides valuable insights into the clinical applications of SeMet in healthy poultry breeding.

Materials and methods

Ethics statement

Experiments were approved by the Institutional Animal Care and Use Committee (NEAUEC20200311) of the Northeast Agricultural University (Harbin, China), and we conducted in accordance with the principles and specific guidelines.

Animal model treatment

One hundred 46-wk-old laying hens were randomly divided into control group (SeMet content of 0.2 mg kg−1·diet) and Se-enriched group (SeMet content of 0.75 mg kg−1·diet). The nutrient contents of the premixes are listed in Table 1. After 90d of feeding, half of the laying hens in each group were injected with LPS (0.2 mg/kg.BW, i.v.). After 10 h, laying hens were euthanized, kidney tissues were collected, and blood samples were collected for subsequent experiments. We referred to the study by Shen et al. for dosage selection (Shen et al., 2021; Wang et al., 2021). Animals were divided into groups as follows: control (Con), LPS, SeMet, and LPS + SeMet. In the end of experiment, chickens were euthanized. Kidney tissues and blood samples were collected.

Table 1.

Composition and nutrient content of premix.

Conventional ingredients content(%)
Crude protein 30
Crude fiber 9
Crude ash 38
calcium 6-12
Total phosphorus 0.6
Sodium chloride 0.3-2
methionine 0.6

Histopathology inspection

Specimens were prepared according to the experimental approach described by Wang et al(2023). Histopathological images of the kidneys were captured using a light microscope (Hitachi, Tokyo, Japan).

Biochemical analysis

According to the manufacturer's protocol, kidney function indicators were detected using the BUN assay kit and the CREA assay kit purchased from Nanjing Jiancheng Bio Engineering Institute (Nanjing, China). BUN assay kit: Add 0.25 mL of enzyme buffer to each centrifuge tube, dividing them into three groups: blank, standard, and test. Add distilled water to the blank tube, the standard solution to the standard tube, and the test sample to the measuring tube. Mix thoroughly and incubate at 37°C for 10 minutes. Then, add 1 mL of phenol developer and alkaline sodium hypochlorite to each tube, mix again, and incubate at 37°C for another 10 minutes. Measure the absorbance at 640 nm and calculate the urea nitrogen concentration using the provided formula. CREA assay kit: Add 180 µL of enzyme solution A to each centrifuge tube, dividing them into three groups. Add 6 µL of the test sample to the measuring tube, 6 µL of the standard solution to the standard tube, and 6 µL of water to the blank tube. Mix well and incubate at 37°C for 5 min. Measure the absorbance at 546 nm as A1. Then, add 60 µL of enzyme solution B to each tube and incubate at 37°C for another 5 min. Measure the absorbance at 546 nm as A2. Calculate the creatinine content using the provided formula.

Tissue immunofluorescence detection

Briefly, the 5 μm-thick slices of kidney tissues were incubated with TLR4 and caspase 8 antibodies at 4°C for 10 h and incubated with horse radish peroxidase-conjugated secondary antibody (Woburn, MA, USA) for 1 h at 37°C. Nuclei were then stained with DAPI. The images were captured using a Leica TCS SP2 laser confocal microscope (Wetzlar, Germany).

Cell culture

CEK cells were cultured in RPMI 1640 complete medium (Gibco, Grand Island, NY, USA) supplemented with 10 % FBS (Inner Mongolia Opcel Bio, Inner Mongolia, China) and 1 % penicillin-streptomycin (Beyotime, Shanghai, China). Different treatment groups were incubated with LPS and/or SeMet for 24 h. The LPS+TAK242, LPS+GSK872, and LPS+Mdivi-1 groups were pre-treated with TAK242 (Abmole, Shanghai, China), GSK872 (Abmole, Shanghai, China), and Mdivi-1 (Abmole, Shanghai, China), respectively, for 1 h, followed by the addition of LPS at a concentration of 60 μg/mL and incubation for 24 h. SeMet (Meilun Bio, Dalian, China) and LPS (Biotopped, Beijing, China) were dissolved in phosphate buffered saline.

Cell viability assay

CEK cells were grown to 80 %–90 % confluence and treated with LPS (0, 5, 20, 40, 60, 80, 100, and 120 μg/mL) for 24 h. Cell Counting Kit-8 solution (Meilun Bio, Dalian, China) was added to each well and cultivated for 2 h at 37°C and 5 % CO2. A microplate reader (Biotek Winooski, Vermont, USA) was employed to calculate the survival rate of CEK cells at different concentrations. Cytotoxicity assays for SeMet (0, 0.025, 0.05, 0.075, 0.1, and 0.15 mM), TAK242 (0, 4.0, 8.0, 12.0, 16.0, 20.0, and 24.0 μM), GSK872 (0, 0.5, 1.0, 1.5, 2.0, 2.5, and 3.0 μM) and Mdivi-1 (0, 40, 80, 100, 120, and 140 nM) were performed as described above. Finally, 0.075 mM SeMet, 16 μM TAK242, 1.5 μM GSK872, and 100 nM Mdivi-1 were selected for pretreatment of CEK cells (Supplementary Figure 1A-C).

Lactate dehydrogenase (LDH) release assay

CEK cells were treated as described above. The supernatant was discarded, added to an LDH releaser (Beyotime, Shanghai, China), and cultured in a cell incubator for 1h. The samples were then centrifuged at 400 × g for 5 min. Then, 120 μL of the supernatant was taken from each well and added to a newly labeled 96-well cell culture plate for immediate sample determination.

qRT-PCR

Total RNA was extracted from the tissue and cell samples using TRIzol reagent (Solarbio, Beijing, China). Reverse transcription of cDNA was performed using a first-strand cDNA synthesis kit (TransGen Biotech, Beijing, China). Gene expression levels were assessed using qRT-PCR. The primers used are presented in Table 2. GAPDH was used as a house keeping gene to complete data normalization according to the 2−ΔΔCt method.

Table 2.

Design and synthesis of primers used for qRT-PCR.

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
TLR4 GCCATCCCAACCCAACCACAG CCACTGAGCAGCACCAATGAGTAG
TRIF TCAGCCATTCTCCGTCCTCTTCAG GCTCTGGTGCCAATGATGCTTCC
RIPK1 AAGGGCGTTTCATCCTGGAG CGGCAGGTCTCTTCTTTGGT
RIPK3 CCCATGGACAGGGAATGGAA CCACAAGTCTCTGGTAGCGG
MLKL CCATGGGTGGTTCCTCCTTC TGGATCTTCCGCACCTTAGC
caspase 8 CATCTGTGGCACCCGATTCTCTG CTTCTGAGTTCTGGCACTGCTTCC
PGAM5 TGACGTAAAGCAGGAGGAGGACAG GAGACATTCGCAGCCAGCCTTC
DRP1 CAGAGACCTCATGCCGAAGACA TGCTGATGGTGCTGGTGTTGAT
Opa1 TCCAGCAGCACAGACAATGAACTC AAGTCTCCCACGCCACCTCTAC
Mfn2 CCATTGCCAGTTCAC TCACAGTTCAGGTCATA
NLRP3 GCTCCTTGCGTGCTCTAAGACC TTGTGCTTCCAGATGCCGTCAG
IL-1β ACTGGGCATCAAGGGCTACA GCTGTCCAGGCGGTAGAAGA
IL-6 AGCACGGCATCCTCCAGTTCC CTTCTTCGCCACTCAGCACTAAGC
IL-18
TNF-α
AGATGATGAGCTGGAATGCGATGC
CTTCCTGCTGGGGTGCATAG
ATCTGGACGAACCACAAGCAACTG
AAGAACCAACGTGGGCATTG
GAPDH AGAACATCATCCCAGCGT AGCCTTCACTACCCTCTTG
Txnrd1 TACGCCTCTGGGAAATTCGT CTTGCAAGGCTTGTCCCAGTA
Txnrd2 GCTCTTAAAGATGCCCAGCACTAC GAACAGCTTGAGCCATCACAGA
Txnrd3 CCTGGCAAAACGCTAGTTGT G CGCACCATTACTGTGACATCTAGAC
Dio1 GCGCTATACCACAGGCAGTA GGTCTTGCAAATGTCACCAC
Dio2 ATTTGCTGATCACGCTTCAG GCTCAGAAACAGCACCATGT
Dio3 CTGTGCATTCGCAAGAAGAT GCCGACTTGAAGAAGTCCAG
GPX1 ACGGCGCATCTTCCAAAG TGTTCCCCCAACCATTTCTC
GPX2 ATCGCCAAGTCCTTCTACGA ACGTTCTCGATGAGGACCAC
GPX3 CCTGCAGTACCTCGAACTGA CTTCAGTGCAGGGAG GATCT
GPX4 CTTCGTCTGCATCATCACCAA TCGACGAGCTGAGTGTAATTCC
GPX7 TCTTGGCCCATATCATTTCA ACCGTAAGTCTTTCGTGCAA
SelO CCAGCGTTAACCGGAATGAT ATGCGCCTCCTGGATTTCT
SelK GAAGAGGGCCTCCAGGAAAT CAGCCATTGGTGGTGGACTAG
SelS CCGACATGGTGGTAAGAAGACA GCTTGTGCATTCAACTCCTCTTG
SelI TGCCAGCCTCTGAACTGGAT TGCAAACCCAGACATCACCAT
SelU GATGCTTTCAGGCTTCTTCC CTGTCTTCCTGCTCCAATCA
SelH CATCGAGCACTGCCGTAG GACACCTCGAAGCTGTTCCT
SelT AGGAGTACATGCGGGTCATCA GACAGACAGGAAGGATGCTATGTG
SelW TGGTGTGGGTCTGCTTTACG CCAAAGCTGGAAGGTGCAA
SelM AAGAAGGACCACCCAGACCT GCTGTCCTGTCTCCCTCATC
SelN ACATGTACATCAGCCCCGAG CAGTTGCGGAGGCCAGACAG
SelF ACTTGGCTTCTCCAGTAACTTGCT GCCTACAGAATGGATCCAACTGA
SELP1 GAGAAGCGTTTTGGGCATGG GGAAATGTGGCTGCGGTTTT
β-actin CCGCTCTATGAAGGCTACGC CTCTCGGCTGTGGTGGTGAA

Western blotting

Protease inhibitor (Abmole, Shanghai, China) was premixed with radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China) to lyse the kidney tissue or CEK cells. Phosphatase inhibitors (Abmole, Shanghai, China) were added to extract the phosphorylated proteins. Protein concentrations were measured using a BCA kit (Meilun Bio, Dalian, China). Western blotting was performed as previously described (Li et al., 2023); however, p-MLKL was blocked with 5 % BSA. The information of primary antibodies are listed in Table 3. FluorChemRFR1045 (ProteinSimple, Silicon Vall, USA) and ImageJ were used to perform grayscale analysis of the results.

Table 3.

Information on primary antibodies.

Name Source Identifier Dilution ratio
TLR4 Wanlei WL00196 1:500
TRIF Bioss bs-16720R 1:500
RIPK1 Wanlei WL04522 1:500
RIPK3 Lab-made antibody 1:500
MLKL Lab-made antibody 1:500
p-MLKL Bioss bsm-54104R 1:500
Caspase 8 Wanlei WL03426 1:1500
PGAM5 ABclonal A22203 1:2000
DRP1 Wanlei WL03028 1:1500
Opa1 Bioss bsm-54144R 1:500
Mfn2 Bioss bs-2988R 1:500
NLRP3 Wanlei WL02635 1:1500
IL-1β Bioss bs-0812R 1:500
IL-6 Wanlei WL02841 1:1000
IL-18 Wanlei WL01127 1:1000
TNF-α Wanlei WL01581 1:500
β-actin Bioss bs-0061R 1:2000

AO/EB staining

The level of necroptosis in CEK cells was analyzed by AO/EB double staining (LeaGene, Beijing, China). CEK cells were cultured in 6-well plates for 24 h, washed, 1 mL of AO/EB was added. After 30 min, cell necrosis was visualized under a fluorescence microscope (Olympus, Tokyo, Japan).

Hoechst 33342 / PI staining

CEK cells were cultivated in 6-well plates for 24 h. After washing, Hoechst 33342 and PI (Beyotime, Shanghai, China) were added and incubated for 30 min at 37°C, and a fluorescence microscope (Olympus, Tokyo, Japan) was used for fluorescence imaging.

Mitochondrial membrane potential detection (JC-1)

JC-1 related reagents were prepared according to the manufacturer's protocol. After the CEK cells were cultured for 24 h, they were incubated with 1× JC-1 staining solution (Woburn, MA, USA) in the dark for 20 min and washed with JC-1 staining buffer. Images were captured through a fluorescence microscope (Olympus, Tokyo, Japan).

Statistical analysis

All data provided in this study were obtained from at least three independent experiments. All data in the experiment were processed using GraphPad Prism (version 8.0, GraphPad Software Inc., San Diego, CA, USA) and analyzed by ANOVA or unpaired t-test. The results are expressed as as the mean ± SD. Bars that do not share the same letter indicate significant differences. p < 0.05was considered statistically significant.

Results

SeMet treatment alleviated the LPS-induced kidney injury

To investigate whether SeMet alleviates LPS-induced kidney injury in laying hens, we established a model wherein laying hens were treated with LPS and/or SeMet (Fig. 1A). Kidney function indices (Fig. 1B) demonstrated that SeMet markedly reduced the LPS-induced elevation in the levels of BUN and CREA (p < 0.05). Subsequently, we conducted histological studies on the kidneys of the laying hens. The kidney tissue morphology of laying hens in the Con and SeMet groups was clear, and the cells were arranged regularly. In the LPS group, kidney tubules were disordered, and some kidney tubular epithelial cells showed karyolysis. Inflammatory cell infiltration is observed in the kidney interstitium. However, this damage was significantly reduced in the LPS + SeMet group (Fig. 1C).

Fig. 1.

Fig 1

Selenomethionine (SeMet) alleviated lipopolysaccharide (LPS)-induced kidney injury. (A) Schematic of the experimental design of the kidneys of laying hens treated with SeMet and LPS. (B) Changes in kidney function in different treatment groups. (C) Histopathological changes in the kidneys of laying hens (scale bars, 20 μm and 50 μm). In the LPS group, kidney tubules were disordered (black arrow), and some kidney tubular epithelial cells showed karyolysis (green arrow). Inflammatory cell infiltration is observed in the kidney interstitium (red arrows).

SeMet treatment ameliorated the LPS-stimulated necroptosis and inflammation in kidney tissue

Immunofluorescence assays were conducted for the necroptosis marker caspase 8 (Fig. 2A). The fluorescence signal of caspase 8 was weakened in the LPS group. The fluorescence signal of caspase8 was enhanced in the SeMet + LPS group compared with that in the LPS group. The results of the LDH assay (Fig. 2E) demonstrated that LDH activity was remarkably reduced in the SeMet + LPS group compared with that in the LPS group (p < 0.05). Western blotting and qRT-PCR results (Fig. 2B-D) demonstrated that SeMet treatment significantly reduced the levels of RIPK1, RIPK3, and MLKL induced by LPS (p < 0.05); additionally, it increased the expression level of caspase 8 (p < 0.05). We also examined the expression of inflammation-related factors (Fig. 2F-H) and SeMet treatment reduced the mRNA and protein levels of NLRP3, IL-1β, IL-18, IL-6, and TNF-α stimulated by LPS (p < 0.05). These results indicated that SeMet effectively counteracted the LPS-induced necroptosis and inflammation in kidney tissues.

Fig. 2.

Fig 2

SeMet ameliorated LPS-stimulated necroptosis and inflammation in kidney tissue. (A) Immunofluorescence detection of caspase 8 in kidneys. Scale bar = 50 μm. (B) mRNA expression of necroptosis markers in kidneys. (C) Protein levels of necroptosis markers in kidney. (D) Analysis of necroptosis-related proteins in the kidneys. (E) Changes in LDH activity in different treatment groups. (F) Protein expression of the inflammatory markers in the kidneys. (G) mRNA expression of inflammatory markers in the kidneys. (H) Analysis of inflammation-related proteins in the kidneys. Significant differences were observed among columns with different letters (p < 0.05). Data are presented as the mean ± SD (n = 5).

SeMet attenuated LPS-induced TLR4 overactivation in the kidney

To clarify the role of TLR4 in SeMet-mediated reduction in the LPS-induced kidney necroptosis, we used immunofluorescence to examine TLR4 expression in the kidney tissue (Fig. 3A). Compared to the LPS group, the LPS + SeMet group demonstrated a notable reduction in TLR4 fluorescence intensity (p < 0.05). The expression trends of TLR4 and TRIF were consistent with the immunofluorescence results (Fig. 3B-D). Owing to the complexity and specificity of the in vivo assay, we established a CEK cell model treated with LPS and/or SeMet for further validation (Fig. 3E). According to the results of the survival rate of CEK cells (Fig. 3F-H), 60 μg/mL LPS and 0.075 mM SeMet were selected to treat CEK cells for 24 h for further experiments. Subsequently, the protein and mRNA levels of TLR4 and TRIF were markedly lower in the TAK242 pre-treatment group than in the LPS group (Fig. 3I-K). These data indicate that SeMet treatment inhibited the LPS-stimulated TLR4 overexpression in the kidneys.

Fig. 3.

Fig 3

SeMet attenuates LPS-spiked TLR4 overactivation in the kidneys. (A) Immunofluorescence analysis of TLR4 in the kidneys. Scale bar = 50 μm. (B) Western blotting results for related proteins in the kidney. (C) Analysis of related proteins in the kidneys. (D) mRNA expression of the related factors in the kidneys. (E) Grouping of in vitro experiments. (F) Cell viability of chicken embryo primary kidney (CEK) cells treated with of LPS (0, 5, 20, 40, 60, 80, 100, and 120 μg/mL) for 24 h. (* p < 0.05, ** p < 0.01) (G) The effect of different concentrations of LPS on LDH release from CEK cells. (* p < 0.05, ** p < 0.01). (H) Cell viability of CEK cells treated with SeMet (0, 0.025, 0.05, 0.075, 0.1, and 0.15 mM) for 24 h. (* p < 0.05, ** p < 0.01) (I) Western blotting results of related proteins in CEK cells. (G) Analysis of related proteins in the CEK cells. (K) mRNA expression of related factors in CEK cells. Significant differences were observed among columns with different letters (p < 0.05). Data are presented as the mean ± SD (n = 5).

SeMet treatment mitigated the LPS-spiked imbalance in mitochondrial dynamics through the TLR4/RIPK3 pathway

We examined factors associated with the balance of mitochondrial dynamics to determine whether SeMet can restore the LPS-induced imbalance in kidney mitochondrial dynamics. The results (Fig. 4A-C) displayed that the protein and mRNA expression levels of PGAM5 and DRP1 were markedly reduced in the SeMet + LPS group (p < 0.05). However, the protein and mRNA expression levels of Opa1 and Mfn2 were significantly increased (p < 0.05) compared with those in the LPS group. In the in vitro model (Fig. 4D-F), pre-treatment with an RIPK3 inhibitor resulted in the downregulation of DRP1 and upregulation of Opa1 and Mfn2. Additionally, we examined the mitochondrial membrane potential (ΔΨm) of CEK cells (Fig. 4G) and found that it was substantially reduced in the LPS group, whereas it was prominently increased after pre-treatment with TAK242/GSK872. These results demonstrated that SeMet treatment alleviated the LPS- induced imbalance in mitochondrial dynamics in the kidney by regulating the TLR4/RIPK3 pathway.

Fig. 4.

Fig 4

SeMet mitigates LPS-spiked imbalance in mitochondrial dynamics via the TLR4/RIPK3 pathway. (A) Protein levels of mitochondrial dynamics markers in the kidney tissue. (B) Analysis of mitochondrial dynamics-related proteins in the kidneys. (C) mRNA expression of mitochondrial dynamics markers in the kidneys. (D) mRNA expression of mitochondrial dynamics markers in CEK cells. (E) Protein levels of mitochondrial dynamics markers in CEK cells. (F) Analysis of mitochondrial dynamics-related proteins in protein in CEK cells. (G) ΔΨm of CEK cells in each group was detected by JC-1 staining (scale bar, 50 μm). Significant differences were observed among columns with different letters (p < 0.05). Data are presented as the mean ± SD (n = 5).

SeMet treatment mitigated the LPS-stimulated necroptosis and inflammation in CEK cells via the TLR4/RIPK3/DRP1 pathway

It has been shown that activation of DRP1 by RIPK3 leads to necrosis and inflammation, but it is unclear whether DRP1 plays a role in inflammation, meanwhile unclear whether DRP1 plays a role in SeMet eased LPS-stimulated necroptosis and inflammation. Therefore, we inhibited DRP1 expression to determine its effects on necroptosis and other inflammation-related factors. The number of necrotic cells was significantly increased in the LPS group compared to that in the control group (Fig. 5A and B). However, the number of necrotic cells in the SeMet-, TAK242 and Mdivi-1 pretreatment groups was significantly reduced (p < 0.05). Hoechst 33342/PI staining (Fig. 5C and D) demonstrated that, compared to the LPS group, the LPS + SeMet, LPS + TAK 242 and LPS+Mdivi-1 groups demonstrated a remarkable reduction in the number of PI-positive cells (p < 0.05). We also examined the LDH release from CEK in each group (Fig. 5E). Compared to the Con group, the LPS group demonstrated a distinct increase in the release of LDH (p < 0.05). The LPS + SeMet and LPS + Mdivi-1 groups demonstrated significant reduction in the LDH release (p < 0.05). Subsequently, regarding protein and mRNA expression levels (Fig. 5F-H), the LPS group showed a prominent reduction in the protein and mRNA expression levels of MLKL and p-MLKL when compared to the control group (p < 0.05), while caspase 8 expression was markedly increased (p < 0.05). These trends were reversed upon treatment with TAK242 or Mdivi-1. These findings indicate that SeMet regulated the TLR4/RIPK3/DRP1 pathway to mitigate the LPS-stimulated kidney necroptosis and inflammation.

Fig. 5.

Fig 5

SeMet alleviates LPS-stimulated necroptosis and inflammation in CEK cells via the TLR4/RIPK3/DRP1 pathway. (A) Acridine orange/ethidium bromide (AO/EB) staining of CEK cells (scale bar, 100 μm). (B) Proportion of necrotic CEK cells from the AO/EB staining groups. (C) Effect of Hoechst 33342/propidium iodine (PI) staining on CEK cells (scale bar, 50 μm) (D) Proportion of PI-positive CEK cells in each group stained with Hoechst 33342/PI. Significance of the difference between the control group and other groups: *p < 0.05, **p < 0.001. Significance of the differences between the LPS group and the SeMet + LPS group, LPS + TAK242 group and LPS + Mdivi-1 group: #p < 0.05, ##p < 0.001. (E) LDH release rate from CEK cells in each group. (F) Protein levels of necroptosis markers in CEK cells. (G) Analysis of necroptosis-related proteins in the CEK cells. (H) Relative mRNA expression of necroptosis markers in CEK cells. (I) Protein levels of inflammatory markers in CEK cells. (J) Analysis of inflammation-related proteins in the CEK cells. (K) Relative mRNA expression of inflammatory markers in CEK cells. Significant differences were observed among columns with different letters (p < 0.05). Data are presented as the mean ± SD (n = 5).

SeMet can significantly enhance the selenoproteins expression and alleviate the reduction in their expression caused by LPS

We found that in the control and LPS groups, the mRNA expression levels of the 23 selenoproteins in chicken kidneys was generally lower than that in the other groups. The SeMet group demonstrated significantly higher selenoprotein expression levels than the other groups. In the Se+LPS group, the differences in mRNA expression levels compared with those in the control group were less pronounced. Specifically, the mRNA expression levels of Txnrd1, Txnrd2, SelS, SelK, SelC, SelF, Selpp2, Dio1, and Dio3 were higher in the Se+LPS group than in the control group; whereas those of Dio2, SelM, and Gpx3 were higher in the control group than in the Se+LPS group (Fig. 6A). Principal component analysis indicated that most selenoproteins were strongly correlated strongly with Se and LPS treatments. However some selenoproteins were significantly affected by the different treatments, with less pronounced changes in mRNA expression levels across the different treatment groups(Fig. 6B and C). These results demonstrated that SeMet treatment regulates the expression levels of selenoproteins, and alleviated the LPS-induced reduction in selenoprotein expression caused by LPS.

Fig. 6.

Fig 6

SeMet can significantly enhance the mRNA expression of selenoproteins.(A)The mRNA expression of selenoproteins. (B) and (C) present principal component analysis of different treatment groups and 23 selenoproteins, respectively.

Discussion

SeMet is the predominant form of dietary organic Se, Proper intake of Se markedly reduces multiple tissue damage (Hao et al., 2016; Chen et al., 2017). Studies have demonstrated that adding Se to feed can alleviate kidney damage in farmed animals for diverse reasons (Chen et al., 2021). Therefore, SeMet is extensively used as a food additive. LPS is widely used as an exogenous inflammatory stimulator. Jiang et al. found that apigenin-7-O-β-D-glucuronide inhibits LPS-stimulated inflammation by modulating the antioxidant pathway in RAW 264.7 cells (Hu et al., 2016). Fisertin alleviates LPS-induced kidney inflammation in mice by inhibiting Src-mediated NF-κB p65 and MAPK signaling pathways (Ren et al., 2020). Xu et al. used LPS-spiked in BV2 microglia to explore urolipin A and B attenuated inflammatory responses by inhibiting the NF-κB, MAPKs (p38 and Erk1/2), and Akt signaling pathways (Xu et al., 2018). Therefore, in this study, we selected LPS as a stimulant for the acute nephritis model in laying hens. We investigated the antagonistic roles of SeMet in LPS-stimulated kidney injury in laying hens, and the underlying molecular mechanisms. Our research indicates that SeMet attenuates LPS-stimulated necroptosis and inflammation in the kidneys of laying hens and CEK cells, and restored the balance of mitochondrial dynamics.

TLR4 is a natural LPS ligand and plays a key role in LPS-mediated damage and host responses. Zhuang et al. found that SeMet inhibits the TLR4/NF-κB pathway to attenuate Escherichia coli-induced inflammation in bovine mammary epithelial cells (Zhuang et al., 2020). Tristetraprolin modulates the TLR4 signaling pathway to inhibit necroptosis in mouse macrophages (Ariana et al., 2020). Necroptosis is initiated by various upstream signaling pathways, including TNF-α, NF-κB, and TLRs (Galluzzi et al., 2014; Hu et al., 2022). Studies have demonstrated that RIPK3, a crucial factor in necroptosis, triggers necroptosis by activating the downstream factors MLKL and DRP1 (Yang et al., 2015). Following RIPK1 deletion, RIPK3 activates TRIF, which transduces necrotic signals to mouse fibroblasts and endothelial cells (Kaiser et al., 2013). Melatonin also attenuates carbon tetrachloride-induced liver necroptosis by inhibiting RIPK3 expression (Choi et al., 2015). We found that SeMet treatment reduced LPS expression and stimulated the expression of RIPK3, MLKL, NLRP3, IL-1β, and other proteins. To explore the specific action mechanism of SeMet in LPS-induced kidney injury, we constructed an in vitro model. Experiments revealed that these factors were significantly reduced. The proportion of necrotic cells was reduced after SeMet or TAK242 treatment. This indicated that LPS activated the TLR4 pathway to induce necroptosis and inflammation in the kidneys, whereas SeMet had a protective effect.

Mitochondrial dysfunction is an important hallmark of cellular homeostasis imbalance. It promotes disease progression and plays an important role in inducing necroptosis and inflammation. Mitochondrial dynamics, a prominent component of mitochondrial function, is regulated by specific proteins, such as Mfn1, Mfn2, and Opa1 for fusion and DRP1 for fission (Liesa and Palacín, 2009). In our study, protein and mRNA expression levels of DRP1 were substantially increased, while those of Opa1 and Mfn2 levels were reduced. A prominent decrease in the ΔΨm and a notable increase in the expression of factors associated with necroptosis and inflammation were observed. DRP1 acts downstream of RIPK3 to trigger necroptosis and NLRP3 activation (Heid et al., 2013). Li et al. found that LPS initiated necroptosis through the RIPK3/DRP1 pathway in the piglet jejunum (Liu et al., 2021). The RIPK1/RIPK3/DRP1 pathway regulates NLRP3 activation hemorrhage (Zhou et al., 2017). It has been evidenced in diverse experimental models that the development of inflammatory response is frequently associated with necroptosis (Meng et al., 2022; Zhang et al.,2023). Mohammed et al. reported that necroptosis increased chronic hepatitis and fibrosis in mice (Mohammed et al., 2021). Furthermore, after the onset of necroptosis, cells release DAMPs that trigger an inflammatory response, suggesting that the onset of necroptosis promotes inflammation (Zhou et al., 2021). Herein, DRP1 was downregulated, the expression levels of Mfn2 and Opa1 were upregulated, the ΔΨm was increased, and mitochondrial dynamic balance was gradually restored after treatment with SeMet and GSK872. Furthermore, MLKL, NLRP3, IL-1β, and IL-18 were downregulated, caspase 8 was upregulated, and the proportion of necrotic cells decreased after treatment with Mdivi-1. This result indicates that the DRP1-mediated imbalance in mitochondrial dynamics is critical for LPS-stimulated necroptosis and activation of the NLRP3 inflammasome in the kidney. It highlights the potential mechanism by which SeMet mitigates LPS-stimulated necroptosis and inflammation in the kidneys of laying hens. Following SeMet treatment, selenoprotein levels increase, which helps in suppressing inflammatory responses and alleviate cellular necrosis.

Conclusions

Our study demonstrated that SeMet alleviated renal necrosis and inflammation caused by LPS in laying hens. Mechanistically, SeMet antagonized LPS-induced mitochondrial dynamic imbalance through the TLR4/RIPK3/DRP1 pathway. This study provides new research directions and data support for SeMet as a protective agent to alleviate renal injury in livestock and poultry, and shows that DRP1 may be a novel therapeutic target to antagonize renal inflammatory injury in laying hens.

Data availability statement

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.

CRediT authorship contribution statement

Xinzhang Chen: Conceptualization, Methodology, Investigation, Writing – original draft. Yixuan Wang: Conceptualization, Methodology, Investigation, Writing – original draft. Muyue Zhang: Methodology, Software, Formal analysis. Yongzhen Du: Software, Investigation. Yujiao He: Software, Investigation. Shu Li: Resources, Project administration, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial inte rests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

The authors thank the Key Laboratory of the Provincial Education Department of Heilongjiang for Common Animal Disease Prevention and Treatment, College of Veterinary Medicine, Northeast Agricultural University for providing conditions. This work was supported by the National Natural Science Foundation of China (Grant No. 32072811, 32372967) and Natural Science Foundation of Heilongjiang Province (ZD2022C005).

Footnotes

1

The scientific section for the paper: Health and Disease; Molecular and Cellular Biology.

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2024.104439.

Appendix. Supplementary materials

mmc1.zip (152.3KB, zip)

References

  1. Andrei E.M., Sabroe L., Hasday J.D., Vogel S.N. Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease. J. Endotoxin Res. 2006;12:133–150. doi: 10.1179/096805106×102255. [DOI] [PubMed] [Google Scholar]
  2. Ariana A., Alturki N.A., Hajjar S., Stumpo D.J., Tiedje C., Alnemri E.S., Gaestel M., Blackshear P.J., Sad S. Tristetraprolin regulates necroptosis during tonic Toll-like receptor 4 (TLR4) signaling in murine macrophages. J. Biol. Chem. 2020;295:4661–4672. doi: 10.1074/jbc.ra119.011633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baker M.O.D.G., Shanmugam N., Pham C.L.L., Ball S.R., Sierecki E., Gambin Y., Steain M., Sunde M. The RHIM of the Immune Adaptor Protein TRIF Forms Hybrid Amyloids with Other Necroptosis-Associated Proteins. Molecules. 2022;27:3382. doi: 10.3390/molecules27113382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Calik A., Emami N.K., Schyns G., White M.B., Walsh M.C., Romero L.F., Dalloul R.A. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, Part II: oxidative stress, immune response, gut integrity, and intestinal microbiota. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao L., Gao S.Y., Liu J.B., Wang J.R., Qin R. Selenomethionine protects against Escherichia coli-induced endometritis by inhibiting inflammation and necroptosis via regulating the PPAR-γ/NF-κB pathway. Chem. Biol. Interact. 2023;379 doi: 10.1016/j.cbi.2023.110532. [DOI] [PubMed] [Google Scholar]
  6. Chen H.J., Li P., Shen Z.Q., Wang J.L., Diao L. Protective effects of selenium yeast against cadmium-induced necroptosis through miR-26a-5p/PTEN/PI3K/AKT signaling pathway in chicken kidney. Ecotoxicol. Environ. Saf. 2021;220 doi: 10.1016/j.ecoenv.2021.112387. [DOI] [PubMed] [Google Scholar]
  7. Chen X.X., Che C.P., Korolchuk V.I., Gan F., Chen P., Huang K.H. Selenomethionine Alleviates AFB1-Induced Damage in Primary Chicken Hepatocytes by Inhibiting CYP450 1A5 Expression via Upregulated SelW Expression. J. Agric. Food Chem. 2017;65:2495–2502. doi: 10.1021/acs.jafc.6b05308. [DOI] [PubMed] [Google Scholar]
  8. Chen Y.Q., He H.R., Bi X.J., Zhang Y., Yin H.D. Effects of various selenium-enriched yeasts, selenomethionine, and nanoselenium on production performance, quality, and antioxidant capacity in laying hens. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen Z., Liang S.J., Zan G.X., Wang X.F., Gao C.Q., Yan H.C., Wang X.Q., Zhou J.Y. Selenomethionine Alleviates DON-Induced Oxidative Stress via Modulating Keap1/Nrf2 Signaling in the Small Intestinal Epithelium. J. Agric Food Chem. 2022;71:895–904. doi: 10.1021/acs.jafc.2c0788. [DOI] [PubMed] [Google Scholar]
  10. Chi X., Liu Z.G., Wei W., Hu X.Y., Wang Y., Wang H.F., Xu B.H. Selenium-rich royal jelly inhibits hepatocellular carcinoma through PI3K/AKT and VEGF pathways in H22 tumor-bearing mice. Food Funct. 2021;12:9111–9127. doi: 10.1039/d1fo01070k. [DOI] [PubMed] [Google Scholar]
  11. Choi H., Kang J.W., Lee S.M. Melatonin attenuates carbon tetrachloride-induced liver fibrosis via inhibition of necroptosis. Transl Res. 2015;166:292–303. doi: 10.1016/j.trsl.2015.04.002. [DOI] [PubMed] [Google Scholar]
  12. Chu C.N., Wang X.Y., Chen F., Yang C., Shi L., Xu W.D., Wang K., Liu B.C., Wang C.Y., Sun D.P., Li J.S., Ding W.W. Neutrophil extracellular traps aggravate intestinal epithelial necroptosis in ischaemia-reperfusion by regulating TLR4/RIPK3/FUNDC1-required mitophagy. Cell Prolif. 2023;57 doi: 10.1111/cpr.13538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Galluzzi L., Kepp O., Krautwald S., Kroemer G., Linkermann A. Molecular mechanisms of regulated necrosis. Semin. Cell Dev. Biol. 2014;35:24–32. doi: 10.1016/j.semcdb.2014.02.006. [DOI] [PubMed] [Google Scholar]
  14. Ghassemi Nejad J., Vakili R., Sobhani E., Sangari M., Mokhtarpour A., Hosseini Ghafari S.A. Worldwide research trends for chelates in animal science: a bibliometric analysis. Animals (Basel) 2023;13:2374. doi: 10.3390/ani13142374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Giacomello M., Pyakurel A., Glytsou C., Scorrano L. The cell biology of mitochondrial membrane dynamics. Nat. Rev. Mol. Cell Biol. 2020;21:204–224. doi: 10.1038/s41580-020-0210-7. [DOI] [PubMed] [Google Scholar]
  16. Guo X., Sesaki H., Qi X. Drp1 stabilizes p53 on the mitochondria to trigger necrosis under oxidative stress conditions in vitro and in vivo. Biochem .J. 2014;461:137–146. doi: 10.1042/bj20131438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hao S., Hu J.F., Song S.Q., Huang D.W., Xu H.B., Qian G., Gan F., Huang K.H. Selenium Alleviates Aflatoxin B₁-Induced Immune Toxicity through Improving Glutathione Peroxidase 1 and Selenoprotein S Expression in Primary Porcine Splenocytes. J. Agric. Food Chem. 2016;64:1385–1393. doi: 10.1021/acs.jafc.5b05621. [DOI] [PubMed] [Google Scholar]
  18. Heid M.E., Keyel P.A., Kamga C., Shiva S., Watkins S.C., Salter R.D. Mitochondrial reactive oxygen species induces NLRP3-dependent lysosomal damage and inflammasome activation. J .Immunol. 2013;191:5230–5238. doi: 10.4049/jimmunol.1301490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Horváth C., Jarabicová I., Kura B., Kaločayová B., Faurobert E., Davidson S.M., Adameová A. Novel, non-conventional pathways of necroptosis in the heart and other organs: Molecular mechanisms, regulation and inter-organelle interplay. Biochim. Biophys. Acta. Mol. Cell Res. 2023;1870 doi: 10.1016/j.bbamcr.2023.119534. [DOI] [PubMed] [Google Scholar]
  20. Hu W.C., Wang X.F., Wu L., Shen T., Ji L., Zhao X.H., Si C.L., Jiang Y.Y., Wang G.C. Apigenin-7-O-beta-D-glucuronide inhibits LPS-induced inflammation through the inactivation of AP-1 and MAPK signaling pathways in RAW 264.7 macrophages and protects mice against endotoxin shock. Food & Function. 2016;7:1002–1013. doi: 10.1039/c5fo01212k. [DOI] [PubMed] [Google Scholar]
  21. Hu X.L., Xu Y., Zhang H.J., Li Y., Wang X.Y., Xu C., Ni W.F., Zhou K.L. Role of necroptosis in traumatic brain and spinal cord injuries. J. Adv. Res. 2022;40:125–134. doi: 10.1016/j.jare.2021.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kaiser W.J., Sridharan H., Huang C.Z., Mandal P., Upton J.W., Gough P.J., Sehon C.A., Marquis R.W., Bertin J., Mocarski E.S. Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL. J. Biol. Chem. 2013;288:31268–31279. doi: 10.1074/jbc.m113.462341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li Z., Xu T., Fan X., Chen K., Wan C., Li X., Yin H., Li S. Bisphenol A aggravate selenium deficiency-induced apoptosis via miR-215-3p/Dio1 to activate ROS/PI3K/AKT pathway in chicken arterial. J. Cell. Physiol. 2023;238:1256–1274. doi: 10.1002/jcp.31007. [DOI] [PubMed] [Google Scholar]
  24. Li A.Y., Zhang S.H., Li J., Liu K., Huang F., Liu B.L. Metformin and resveratrol inhibit Drp1-mediated mitochondrial fission and prevent ER stress-associated NLRP3 inflammasome activation in the adipose tissue of diabetic mice. Mol. Cell. Endocrinol. 2016;434:36–47. doi: 10.1016/j.mce.2016.06.008. [DOI] [PubMed] [Google Scholar]
  25. Liesa M., Palacín M., Zorzano A. Mitochondrial dynamics in mammalian health and disease. Physiol. Rev. 2009;89:799–845. doi: 10.1152/physrev.00030.2008. [DOI] [PubMed] [Google Scholar]
  26. Liu Y.L., Xu Q., Wang Y., Liang T.Z., Li X.G., Wang D., Wang X.Y., Zhu H.L., Xiao K. Necroptosis is active and contributes to intestinal injury in a piglet model with lipopolysaccharide challenge. Cell Death. Dis. 2021;12:62. doi: 10.1038/s41419-020-03365-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Meng X., Yin K., Zhang Y., Wang D.X., Lu H.M., Hou L.L., Zhao H.J., Xing M.W. Polystyrene microplastics induced oxidative stress, inflammation and necroptosis via NF-κB and RIP1/RIP3/MLKL pathway in chicken kidney. Toxicology. 2022.;478 doi: 10.1016/j.tox.2022.153296. [DOI] [PubMed] [Google Scholar]
  28. Minsart C., C.Liefferinckx A.L., C.Dressen E.Q., I.Leclercq J.D., Moreau R., Gustot T. New insights in acetaminophen toxicity: HMGB1 contributes by itself to amplify hepatocyte necrosis in vitro through the TLR4-TRIF-RIPK3 axis. Sci. Rep. 2020;10:5557. doi: 10.1038/s41598-020-61270-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mohammed S., Nicklas E.H., Thadathil N., Selvarani G.H.R., Kinter M., Richardson A., Deepa S.S. Role of necroptosis in chronic hepatic inflammation and fibrosis in a mouse model of increased oxidative stress. Free Radic Biol Med. 2021;164:315–328. doi: 10.1016/j.freeradbiomed.2020.12.449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ramachandran A., McGill M.R., Xie Y.C., Ni H.M., Ding W.X., Jaeschke H. Receptor interacting protein kinase 3 is a critical early mediator of acetaminophen-induced hepatocyte necrosis in mice. Hepatology. 2013;58:2099–2108. doi: 10.1002/hep.26547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ren Q., Guo F., Tao S.B., Huang R.S., Fu P. Flavonoid fisetin alleviates kidney inflammation and apoptosis via inhibiting Src-mediated NF-κB p65 and MAPK signaling pathways in septic AKI mice. Biomed. Pharmacother. 2020;122 doi: 10.1016/j.biopha.2019.109772. [DOI] [PubMed] [Google Scholar]
  32. Shen Y., Yang S., Shi Z., Lin T., Zhu H., Bi F., Liu A., Ying X., Liu H., Yu K., Yan S. SeMet mediates anti-inflammation in LPS-induced U937 cells targeting NF-κB signaling pathway. Inflammation. 2015;38:736–744. doi: 10.1007/s10753-014-9984-0. [DOI] [PubMed] [Google Scholar]
  33. Shen Y., Yang S.Z., Shi Z.J., Lin T.T., Zhu H.X., Bi F.G., Liu A., Ying X.Z., Liu H.X., Yu K., Yan S.G. Dietary selenomethionine ameliorates lipopolysaccharide-induced renal inflammatory injury in broilers via regulating the PI3K/AKT pathway to inhibit necroptosis. Food Funct. 2021;12:4392–4401. doi: 10.1007/s10753-014-9984-0. [DOI] [PubMed] [Google Scholar]
  34. Wang S.C., Tian B., Hu Y., Li T.T., Cui X.Y., Zhang L.Y., Luo X.G. Research progress on the biological regulatory mechanisms of selenium on skeletal muscle in broilers. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang X., Xu T., Luo D.L., L․S․, Tang X.Y., Ding J.Y., Yin H., Li S. Cannabidiol Alleviates Perfluorooctanesulfonic Acid-Induced Cardiomyocyte Apoptosis by Maintaining Mitochondrial Dynamic Balance and Energy Metabolic Homeostasis. J. Agric. Food Chem. 2023;71:5450–5462. doi: 10.1021/acs.jafc.2c08378. [DOI] [PubMed] [Google Scholar]
  36. Wang B., Cui Y., Zhang Q.J., Wang S.C., Xu S.W. Selenomethionine alleviates LPS-induced JNK/NLRP3 inflammasome-dependent necroptosis by modulating miR-15a and oxidative stress in chicken lungs. Metallomics. 2021;13 doi: 10.1093/mtomcs/mfab048. [DOI] [PubMed] [Google Scholar]
  37. Wang X.F., Lu W.Z., Xia X.Y., Zhu Y.C., Ge C.M., Guo X.Y., Zhang N., Chen H., Xu S.M. Selenomethionine mitigate PM2.5-induced cellular senescence in the lung via attenuating inflammatory response mediated by cGAS/STING/NF-κB pathway. Ecotoxicol. Environ. Saf. 2022;247 doi: 10.1016/j.ecoenv.2022.114266. [DOI] [PubMed] [Google Scholar]
  38. Xu J.L., Yuan C.H., Wang G.H., Luo J.Y., Ma H., Xu L., Mu Y., Li Y.Y., Seeram N.P., Huang X.S., Li L.Y. Urolithins Attenuate LPS-Induced Neuroinflammation in BV2Microglia via MAPK, Akt, and NF-κB Signaling Pathways. J. Agric. Food Chem. 2018;66:571–580. doi: 10.1021/acs.jafc.7b03285. [DOI] [PubMed] [Google Scholar]
  39. Yang B.Y., Xu R.L.W., He F.P., Luo B.Y., Wang J.Y. Inhibition of receptor-interacting protein 3 upregulation and nuclear translocation involved in Necrostatin-1 protection against hippocampal neuronal programmed necrosis induced by ischemia/reperfusion injury. Brain Res 2015. 2015;1609:63–71. doi: 10.1016/j.brainres.2015.03.024. [DOI] [PubMed] [Google Scholar]
  40. Zhang Z.Q., Sun Y.Y., Xie H., Wang J.J., Zhang X., Shi Z.Y., Liu Y.M. Protective effect of selenomethionine on kidney injury induced by ochratoxin A in rabbits. Environ. Sci. Pollut. Res. Int. 2023;30:29874–29887. doi: 10.1007/s11356-022-24297-7. [DOI] [PubMed] [Google Scholar]
  41. Zhao X., Lu J.C., Chen X.B., Gao Z.X., Zhang C., Chen C.X., Qiao D.F., Wang H.J. Methamphetamine exposure induces neuronal programmed necrosis by activating the receptor-interacting protein kinase 3 -related signalling pathway. FASEB J. 2021;35:e21561. doi: 10.1096/fj.202100188. [DOI] [PubMed] [Google Scholar]
  42. Zhou K.L., Shi L.G., Wang Z., Zhou J.Y., Manaenko A., Reis C., Chen S., Zhang J.M. RIP1-RIP3-DRP1 pathway regulates NLRP3 inflammasome activation following subarachnoid hemorrhage. Exp. Neurol. 2017;295:116–124. doi: 10.1016/j.expneurol.2017.06.003. [DOI] [PubMed] [Google Scholar]
  43. Zhou M.X., He J.P., Shi Y.Y., Liu X.M., Luo S.J., Cheng C., Ge W.S., Qu C.Y., Du P., Chen Y.W. ABIN3 Negatively Regulates Necroptosis-induced Intestinal Inflammation Through Recruiting A20 and Restricting the Ubiquitination of RIPK3 in Inflammatory Bowel Disease. J Crohns Colitis. 2021;15:99–114. doi: 10.1093/ecco-jcc/jjaa131. [DOI] [PubMed] [Google Scholar]
  44. Zhuang C.C., Liu G., Barkema H.W., Zhou M., Xu S.Y., Rahman S., Liu Y.X., Kastelic J.P., Gao J., Han B. Selenomethionine Suppressed TLR4/NF-κB Pathway by activating selenoprotein S to Alleviate ESBL Escherichia coli-induced inflammation in bovine mammary epithelial cells and macrophages. Front Microbiol. 2020;11:1461. doi: 10.3389/fmicb.2020.01461. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.zip (152.3KB, zip)

Data Availability Statement

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.


Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES