Skip to main content
Cancer Cell International logoLink to Cancer Cell International
. 2024 Nov 20;24:385. doi: 10.1186/s12935-024-03557-1

Adipose stem cell exosomes, stimulated by pro-inflammatory factors, enhance immune evasion in triple-negative breast cancer by modulating the HDAC6/STAT3/PD-L1 pathway through the transporter UCHL1

Qin Zhu 1, Kejing Zhang 1, Yukun Cao 1, Yu Hu 1,
PMCID: PMC11577656  PMID: 39568023

Abstract

Background

Triple-negative breast cancer (TNBC) is characterized by high invasiveness and metastasis potential. Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is strongly associated with breast cancer progression, although the underlying mechanisms are largely unknown.

Methods

The gene expression profiles of TNBC samples were downloaded from the TCGA database, and ubiquitination enzymes related to immune regulation were screened. UCHL1 expression in the TNBC tissues and in adipose-derived mesenchymal stem cells (ADSCs) stimulated in vitro with pro-inflammatory cytokines were analyzed. Exosomes were isolated from these stimulated ADSCs and transfected with scrambled (si-NC) or UCHL1-specific (si-UCHL1) siRNA constructs. TNBC cells were treated with the ADSCs-derived exosomes (ADSCs-Exos) and then co-cultured with macrophages or T cells. Finally, the tumorigenic potential of the ADSCs-Exos was evaluated by injecting the exosomes into mice bearing TNBC xenografts.

Results

UCHL1 was highly expressed in TNBC tissues and the stimulated ADSCs. The exosomes derived from stimulated ADSCs increased the viability and migration capacity of TNBC cells in vitro, and significantly increased Ki-67 expression through UCHL1. Furthermore, ADSCs-Exos induced M2 polarization of THP-1 monocytes by upregulating CD206 and Arg-1, and downregulating TNF-α and iNOS, and also decreased the proportion of CD3+CD8+ T cells. Mechanistically, UCHL1 regulated the STAT3 and PD-L1 signaling pathways through HDAC6. Exosomes derived from the control and cytokine-stimulated ADSCs also promoted tumor growth in vivo, and increased the expression of UCHL1, CD206, HDAC6, STAT3, and PD-L1. However, UCHL1 knockdown reversed the pro-tumorigenic effects of the ADSCs-derived exosomes in vivo and in vitro.

Conclusion

Pro-inflammatory factors (IFN-γ + TNF-α) stimulating ADSCs-Exos enhance immune evasion in triple-negative breast cancer by regulating the HDAC6/STAT3/PD-L1 pathway via UCHL1 transporter. Thus, UCHL1 inhibition may enhance the response of TNBC to immunotherapy.

Graphical Abstract

graphic file with name 12935_2024_3557_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s12935-024-03557-1.

Keywords: Triple-negative breast cancer, UCHL1, ADSCs, Immune escape, PD-L1, STAT3, Cancer progression

Introduction

Breast cancer is the leading cause of cancer-related deaths in women worldwide [1]. Triple negative breast cancer (TNBC), which accounts for 15–20% of breast cancer cases, is characterized by high invasiveness and metastatic potential, easy recurrence, and poor prognosis [2]. TNBC patients typically have shorter survival duration compared to the patient subgroups, and a mortality rate of 40% within 5 years after diagnosis [3]. Although the relative 5-year survival rate of breast cancer patients is 90% [4], the prognosis is still unsatisfactory, especially for the TNBC patients. Compared to the other breast cancer subtypes, TNBC is also more likely to develop lung, brain and distant lymph node metastases [5]. TNBC tumors lack estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER-2) [6, 7], and are characterized by immune activation and infiltration, which is conducive to an immunotherapy response [8].

Immune checkpoint inhibitors (ICIs) have achieved lasting clinical remission of various metastatic cancers, including TNBC [9]. Immune checkpoints are expressed on immune cells and tumor cells, and relay inhibitory signals that impede anti-tumor immune responses [9]. PD-1 and its major ligand PD-L1 are expressed on T cells, tumor cells and tumor-infiltrating bone marrow cells, and PD-1/PD-L1 binding leads to T cell exhaustion. Overexpression of PD-L1 is common mechanisms through which tumor cells escape immune surveillance and induce immune tolerance [10, 11]. FDA accelerated the approval of the anti-PD-L1 agent atezolizumab and anti-PD-1 agent pembrolizumab in combination with chemotherapy for treating metastatic TNBC [8]. However, the efficacy of ICIs monotherapy is not satisfactory against TNBC [12, 13], which warrants further research into the immune landscape of TNBC.

Ubiquitination and de-ubiquitination are post-translational modifications that regulate the stability and functions of proteins, and therefore influence key biological processes [14]. Studies show that ubiquitination also regulates immune checkpoint pathways and is therefore a promising target for cancer immunotherapy [15]. Furthermore, ubiquitination/de-ubiquitination also affects breast cancer development and progression [16]. The ubiquitinylated proteins are commonly marked for degradation by proteosome machinery [1]. E3 ubiquitin ligase HRD1 is down-regulated in breast cancer cells and plays an anti-tumorigenic role [17]. In addition, ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is significantly correlated with the recurrence, invasion and metastasis of breast cancer, and may be a potential therapeutic target [18]. The possible association between UCHL1 and the immune landscape of breast tumors is unknown at present.

Previous studies have shown that exosomes derived from TNF-α-treated human gingiva-derived mesenchymal stem cells (MSCs) enhance M2 macrophage polarization and inhibit alveolar bone loss [19]. In addition, exosomes derived from TNF-α-stimulated MSCs promoted M2 polarization of macrophages in mice through galectin-1 and altered intrauterine adhesion [20]. In a previous study, we showed that exosomes obtained from adipose-derived mesenchymal stem cells (ADSCs) can induce M2 polarization of the THP-1 macrophages [21]. TNF-α and IFN-γ are pro-inflammatory cytokines [19, 22] that synergistically mediate infection-driven inflammation [23]. Furthermore, the crosstalk between TNF-α and IFN-γ in the tumor microenvironment plays a key role in tumor progression and immune escape [24]. In addition, TNF-α and IFN-γ can mediate the changes of ubiquitination levels in retinal endothelial cells [25], dendritic cell maturation [26], melanoma cells [27], etc. In this study, we determined the effects of pro-inflammatory cytokines (IFN-γ + TNF-α)-induced ADSCs-exosomes (ADSCs-Exos) on TNBC cells via UCHL1 transporter, and explored the underlying role of UCHL1.

Materials and methods

Patient samples

Breast tumor tissues and para-tumor adipose tissues were retrieved from five TNBC patients at the Human Xiangya Hospital from January 2022 to January 2023. The tumor samples were analyzed by immunohistochemistry, and TNBC diagnosis was confirmed on the basis of the negative expression of ER, PR and HER-2. None of the patients had received any preoperative treatments, such as chemotherapy, radiotherapy, endocrine therapy, targeted therapy, or immunotherapy. Informed consent was obtained from all patients. The study was approved by the Human Research Ethics Committee of Xiangya Hospital (AF/SQ 2022090917).

Isolation and culture of ADSCs

ADSCs were isolated from the adipose tissues adjacent to the tumors. Briefly, the tissues were cut into small pieces (less than 2 mm3), and digested in 20 mL 0.1% collagenase solution (C8140-100, Solarbio, China) at 37℃ for 120 min. The reaction was terminated by adding 20 mL Gibco™ MEMα containing GlutaMAX™ Supplement (51985034, Thermo Fisher Scientific Inc., USA) and 10% FBS (086-610, Wisent, China), and the homogenates were centrifuged at 400 g for 10 min. The pelleted cells were re-suspended in MEMα containing 10% FBS and 0.1 mg/mL penicillin–streptomycin (AWH0529/AWH0529a, Abiowell, China), and passed through a 70 μm cell filter. The cells were seeded into cell culture flasks, and the medium was changed 48 h later.

Isolation and culture of T cells

Peripheral blood was collected from healthy donors at the physical examination center of Human Xiangya Hospital. Briefly, 15 mL blood samples were collected in 50 mL centrifuge tubes containing EDTA, and then diluted with PBS. Human peripheral blood mononuclear cells (PBMC) were isolated using the Human PBSC Isolation Kit (IPHASE, China) according to the instructions. T cells were sorted using magnetic beads and stimulated for 48 h with anti-CD3 and CD28 antibodies (85-57-0033-82 and 16-0281-85, eBiosciences, San Diego).

Extraction of exosomes from ADSCs

ADSCs were treated with 10 ng/mL IFN-γ (300–02, Peprotech, USA) and TNF-α (300-01A, Peprotech, USA) for 24 h. As per experimental requirements, the stimulated cells were transfected with 5 μL si-NC or si-UCHL1 (GenePharma Co., Ltd.) and 5 μL Liposome 2000 (11668019, Invitrogen, USA) in serum-free medium. After 6 h of culture, the medium was discarded and fresh medium was added, and the cells were cultured for 48 h. The supernatants of the suitably treated cells were centrifuged at 300 g for 15 min, and incubated overnight with exosome extractor ExoQuick TC (EXOQ5A-1, SBI, USA) at 4℃. The samples were centrifuged at 1500 g, and the pelleted exosomes were re-suspended with 1 mL PBS. To track their intracellular uptake, the exosomes were labeled with 2 μL PKH26 reagent (UR52302, Umibio, China) at 37℃ for 20 min, and the reaction was terminated by adding 10 μL serum. In order to demonstrated the transfer of GFP-oe-UCHL1 during the process of extracellular vesicle uptake, ADSCs-Exos under the GFP-oe-UCHL1 transfection was employed to treat TBNC cells (MDA-MB-231 and MDA-MB-468) for observation.

Culture of TNBC cells with ADSCs-Exos

The MDA-MB-231 (AW-CCH048, Abiowell, China) and MDA-MB-468 (AW-CCH272, Abiowell, China) TNBC cell lines were cultured with 10 μg/mL ADSCs-Exos for 24 h in DMEM (AW-MC001, Abiowell, China) containing 10% FBS and 1% double antibody. The cells were maintained at 37℃ in humid conditions under 5% CO2.

The 4T1 cells (AW-CCM376) were purchased from Abiowell (Changsha, China). All cells were treated with 10 μg/mL Exos, Exos IFN−γ+TNF−α, Exos IFN−γ+TNF−α+con, and Exos IFN−γ+TNF−α+si−UCHL1 for 24 h. The suitably treated cells were harvested for subsequent analyses.

Co-culture of TNBC cells with THP-1/T cells

TNBC cells were treated with 10 μg/mL ADSCs-exo for 24 h and seeded into the upper compartments of Transwell chambers (3422, Corning, China) at the density of 1 × 105 cells/well. The THP-1 monocytes (AW-CCH098, Abiowell, China) were seeded in the bottom compartments in RPMI 1640 medium with 10% FBS, 1% bis, and 0.05 mM β-mercaptoethanol (AW-MC002, Abiowell, China) at the density of 1 × 106 cells/well. The THP-1 cells were co-cultured with TNBCs cells (or sterile medium) for 48 h. The TNBC cells were co-cultured with stimulated T cells 1:1 for 16 h. T cells were activated as previously described (https://www.stemcell.com/immunocult-human-cd3-cd28-cd2-t-cell-activator.html).

Bioinformatics analysis

The transcriptomic data of 116 TNBC samples and 11 adjacent normal breast tissue samples were retrieved from The Cancer Genome Atlas (TCGA) database. The data set was processed using Affymetrix Human Gene 2.0 ST Array [transcript (gene) version] (Affymetrix, Santa Clara, CA, USA). Quantile normalization and median polishing algorithm summary were completed using the “affy” R language package. The probe was annotated by the Affymetrix annotation file. The microarray quality was evaluated by sample clustering according to the distance between different samples in the Pearson correlation matrix. No sample of the test data set was removed in subsequent analysis. The protein–protein interaction (PPI) network of the top 10 differentially expressed ubiquitination enzymes was constructed using the Search Tool for the Retrieval of Interacting Genes Database (STRING) (https://www.string-db.org/) database, and the results were visualized using Cytoscape software. A confidence score > 0.7 was set as significant.

The data of 179 normal breast samples was obtained from the GTEx database for UCHL1 expression analysis. The ubibrowser_v2.0 program was used to predict known substrates of UCHL1, and biogrid_v4.4.228 was used to predict potential targets that may interact with STAT3. The common interacting proteins of UCHL1 and STAT3 proteins were screened.

Co-immunoprecipitation (co-IP) assay

To verify whether STAT3 protein is degraded through the ubiquitin–proteasome pathway, cells were transfected with sh-NC and sh-HDAC6. To verify the interaction between UCHL1 and HDAC6 proteins, cells were transfected with si-NC/si-UCHL1 and oe-NC/oe-UCHL1. The cells were then treated with MG-132 (a proteasome inhibitor, 150 nM, 583794, Beijing Jintai Hongda Biotechnology Co., Ltd) for 3 h to examine the ubiquitination level of UCHL1 protein. Co-Immunoprecipitation (CO-IP) was employed to verify of the interaction of STAT3, PD-L1 and UCHL1 protein, as well as the ubiquitination level. A brief description was as follows.

The 300 μL IP lysis buffer (AWB0144, Abiowell, China) was used to treat cells. Cells were centrifuged to obtain protein supernatant. Protein supernatant was divided into several tubes, and added a certain amount of protein antibodies, rotated and mixed overnight at 4 °C. The antibodies included IgG (B900610, Proteintech, USA), and UCHL1 antibody, ubiquitin antibody, HDAC6 antibody or STAT3 antibody (Table 1). Cell lysate were incubated with pre-treated Protein A/G agarose beads, shook slowly at 4 °C for 2 h to couple the antibodies with Protein A/G agarose. After immunoprecipitation, it was centrifuged at 4 °C, 3000 rpm for 3 min, and decanted the agarose beads at the bottom of the centrifuge tube. The supernatant was carefully collected and transferred into a new 1.5 mL centrifuge tube. The agarose beads were washed with 400 μL IP lysis buffer four times to collect the final precipitate. The last supernatant was kept. Western blot method was employed to detect the expression of HDAC6, STAT3, PD-L1, and UCHL1 proteins.

Table 1.

The information of antibody

Name Article number Source Dilution rate Molecular weight Transfer film time Company
YOD1 25370-1-AP Rabbit 1:1000 38 KDa 60 min Proteintech (USA)
USP21 17856-1-AP Rabbit 1:500 63 KDa 80 min Proteintech (USA)
USP39 23865-1-AP Rabbit 1:2000 60–65 KDa 80 min Proteintech (USA)
USP5 10473-1-AP Rabbit 1:5000 95–105 KDa 120 min Proteintech (USA)
USP18 12153-1-AP Rabbit 1:800 43/70 KDa 90 min Proteintech (USA)
PSMD14 ab109123 Rabbit 1:5000 35 KDa 60 min Abcam (UK)
USP1 ab227551 Rabbit 1:2000 88 KDa 100 min Abcam (UK)
UCHL5 11527-1-AP Rabbit 1:500 38 KDa 60 min Proteintech (USA)
USP41 PA5-71281 Rabbit 1.0 μg/mL 25/30/42 KDa 70 min ThermoFisher (USA)
UCHL1 14730-1-AP Rabbit 1:10,000 27 KDa 50 min Proteintech (USA)
Ubiquitin 80992-1-RR Rabbit 1:10,000 Complete membrane 2.5 h Proteintech (USA)
HDAC6 ab239362 Rabbit 1:1000 131 KDa 150 min Abcam (UK)
CD63 25682-1-AP Rabbit 1:500 28–35 KDa 60 min Proteintech (USA)
CD81 66866-1-Ig Mouse 1:5000 22 KDa 40 min Proteintech (USA)
CD9 20597-1-AP Rabbit 1:5000 23–30 KDa 50 min Proteintech (USA)
STAT3 10253-2-AP Rabbit 1:2000 88 KDa 100 min Proteintech (USA)
p-STAT3 ab76315 Rabbit 1:5000 88 KDa 100 min Abcam (UK)
Ac-STAT3 PA5-17429 Mouse 1:1000 88 KDa 110 min ThermoFisher (USA)
PD-L1 28076-1-AP Rabbit 1:5000 40–50 KDa 70 min Proteintech (USA)
β-actin 66009-1-Ig Mouse 1:5000 42 KDa 60 min Proteintech (USA)
GAPDH 10494-1-AP Rabbit 1:5000 36 KDa 50 min Proteintech (USA)
Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP AWS0001 Mouse 1:5000 / 90 min Abiowell (China)
Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP AWS0002 Rabbit 1:5000 / 90 min Abiowell (China)

Tumor formation and treatment in BALB/c mice

Four weeks old female BALB/c mice were purchased from Charles River Laboratories Inc. After one week of adaptive feeding, the mice were subcutaneously injected with 4T1 cells (2 × 106) and randomly divided into the following treatment groups: untreated control, ADSCs-exo, ADSCs-exoIFN−γ+TNF−α, ADSCs-exoIFN−γ+TNF−α+si−NC, and ADSCs-exoIFN−γ+TNF−α+si−UCHL1. The mice were injected intravenously with 100 μg of the respective exosomes every 3 days. The tumors were measured twice a week, and the mice were euthanized 38 days after inoculation of the tumor cells. Tumor tissues were removed, photographed, and analyzed further.

Oil red O staining

ADSCs were fixed with 10% formalin for 30 min, washed twice with PBS and immersed in 60% oil red O solution (O0625-25G, Sigma, USA) for 10 min. The cells were repeatedly washed with PBS to remove excess dye and then eluted with 100% isopropyl alcohol. The optical density was measured at 510 nm using Bio-Tek Enzyme Label Instrument (MB-530, Heales, China).

Transmission electron microscopy (TEM)

Briefly, 10 μL exosome solution was suspended on a copper net for 5 min. After drying at room temperature, the copper net was covered with 2% uranium diacetate. The fixed exosomes were observed using 80 keV TEM (FEI Tecnai G2 Spirit BioTWIN).

Nanoparticle tracking analysis (NTA)

The exosomes were diluted to 1 mL in TPM, and their size and concentration were determined using Nanosight Tracking Analysis with the ZetaView PMX 110 (Particle Metrix, Meerbusch, Germany).

Immunocytochemistry (ICC)

The TNBC cells were washed thrice with PBS and fixed with 4% paraformaldehyde for 30 min. Following inactivation of the endogenous peroxidases with 3% H2O2 for 10 min, the cells were incubated overnight with anti-Ki-67 antibody (ab16667, 1:1200, Abcam, UK) at 4 ℃. Subsequently, 50–100 μL HRP-conjugated anti-rabbit IgG antibody was added and the cells were incubated at 37 ℃ for 30 min. After developing color with DAB (ZLI-9017, ZSBG-Bio, China) at room temperature for 5 min, the cells were counterstained with hematoxylin (AWI0006a, Abiowell, China) for 5–10 min. Finally, the cells were dehydrated with alcohol (60–100%), cleared in xylene for 20 min, and observed under a microscope (BA210T, Motic, China).

Transwell assay

The TNBC cells were seeded in the upper compartments of Transwell chambers (3428, Corning, China) at the density of 2 × 105 cells/well in 100 μL serum-free medium, and the lower compartments were filled with 500 μL 10% FBS (10099141, Gibco, USA). After culturing at 37 ℃ for 48 h, the upper chambers were removed and washed thrice with PBS. The cells remaining on the top surface were wiped, and the cells that migrated to the bottom surface were fixed with 4% paraformaldehyde for 20 min and dyed with 0.1% crystal violet for 5 min. The stained cells were observed under an inverted microscope (BA210T, Motic, China).

Flow cytometry

First, 1 × 105/100 μL cells were taken into 1.5 mL EP tubes. The cells were precipitated with 100 μL basal medium, incubated with the CD68 (11–0689-42, ebioscience, USA), and CD206 (12-2069-42, ebioscience, USA) antibodies for 30 min in the dark. Tumor tissue was ground. The cell suspension was obtained by filtration through a sieve. The cell suspension was then centrifuged at 1500 rpm for 10 min to obtain a cell pellet. The cell pellet was re-suspended in 5 mL of red blood cell lysis buffer, left undisturbed at room temperature for 5 min, and then centrifuged to obtain a cell pellet. The supernatant was removed, and 5 mL of red blood cell lysis buffer was added to lyse the cells for 5 min to obtain a cell pellet. The supernatant was removed, and the cells were collected and washed twice with PBS before re-suspending in 1640 basal medium for further use. The cells were precipitated with 100 μL basal medium, incubated with the CD3 (11-0032-82, ebioscience, USA) and CD8 (12-0081-82, ebioscience, USA) antibodies for 30 min in the dark. Subsequently, the cell precipitates were re-suspended with 150 μL basal medium and detected by flow cytometer (A00-1-1102, Beckman, USA).

Enzyme-linked immunosorbent assay (ELISA)

Granular enzyme B (GZMB) and perforin levels were analyzed using specific GZMB (CSB-E08718h, CUSABIO, China) and perforin (CSB-E09313h, CUSABIO, China) ELISA kits according to the instructions. The optical density was measured using the Bio-Tek Enzyme Label Instrument (MB-530, Heales, China).

Cell counting kit-8 (CCK-8) assay

Cells were seeded in 96-well plates at the density of 1 × 104 cells/100 μL/well, and cultured overnight. The cells were treated as appropriate, and 10 μL CCK-8 solution was added to each well. After incubating for 4 h, the absorbance at 450 nm was measured using Bio-Tek Enzyme Label Instrument (MB-530, Heales, China).

Immunohistochemistry (IHC)

The tumor tissue sections were dewaxed in xylene and then dehydrated through an ethanol gradient. The slides were immersed in 0.01 M citrate buffer (pH 6.0) and boiled continuously for 18 min for antigen unmasking. After cooling to room temperature, the sections were treated with 1% periodate to inactivate endogenous enzymes. The sections were incubated overnight with anti-Ki-67 antibody (1:300, ab16667, Abcam, UK) at 4 ℃, followed by 50–100 μL HRP-conjugated anti-rabbit-IgG at 37 ℃ for 30 min. The color was developed with DAB working solution (ZLI-9017, ZSBG-Bio, China) at 25 ℃ for 5 min, followed by hematoxylin (AWI0006a, Abiowell, China) staining for 10 min. The sections were cleared in xylene for 10 min and then observed under a microscope (BA210T, Motic, China).

Immunofluorescence (IF)

The dehydrated and dewaxed sections were immersed in EDTA buffer and boiled for 20 min, and then incubated in sodium borohydride solution at 25 ℃ for 30 min. After staining with Sudan black dye solution at room temperature for 15 min, the sections were blocked with 5% BSA for 1 h. The tissue sections were incubated overnight with antibodies targeting F4/80 (70076 s, CST, USA), CD206 (18,704–1-AP, Proteintech, USA), CD8 (ab217344, Abcam, UK), perforin (bs-7128R, Bioss, China) and GZMB (ab255598, Abcam, UK) at 4 ℃, followed by 50–100 μL fluorochrome-labeled anti-rabbit-IgG antibody at 37 ℃ for 60 min. The nuclei were stained with DAPI working solution (D8200-10, Solarbio, China) for 20 min. The sections were observed under a microscope (BA210T, Motic, China).

Western blotting

Total protein was extracted from frozen tissue and cultured cells using RIPA buffer. The lysates were centrifuged at 1.2 × 104 g for 20 min at 4 ℃, and protein concentration in the supernatants was measured using the BCA protein assay kit (AWB0104a, Abiowell, China). The protein samples were separated by SDS-PAGE and transferred to a PVDF membrane. After blocking with skim milk, the membranes was incubated overnight with primary antibodies targeting YOD1, USP21, USP39, USP5, USP18, PSMD14, USP1, UCHL5, USP41, UCHL1, CD63, CD81, CD9, STAT3, p-STAT3, and PD-L1 at 4 ℃. The blots were washed with TBST and then probed with HRP-labeled secondary antibodies. β-actin and GAPDH were used as the internal controls. The antibodies are listed in Table 1.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from the cultured cells and tissues using TRIzol reagent (15,596,026, Thermo, USA), and reverse transcribed to cDNA using mRNA reverse transcription kit (CW2569, Kangwei Century, Beijing, China). QRT-PCR was performed on the fluorescence quantitative PCR instrument (PIKOREAL96, Thermo, USA). Relative gene expression was calculated by the 2−ΔΔCt method using β-actin as the internal control. The primers for genes were designed and synthesized by Sangon Biotech (Table 2).

Table 2.

The primer sequence

Primer ID 5′-3′ Product length (bp)
PD-L1 F: GCAGGGCATTCCAGAAAGATG 80
R: TTGTATGGGGCGTTCAGCAA
STAT3 F: CTCTTACTTCTCCAGCAACACT 176
R: ATACATGCTACCTAAGGCCAT
iNOS F: TCAGCTGTGCCTTCAACCC 199
R: CCGAGGCCAAACACAGCGTA
TNFα F: GAACCCCGAGTGACAAGCCT 120
R: TATCTCTCAGCTCCACGCCAT
CD206 (MRC1) F: TATGCCAGACACGATCCGACCC 135
R: AGTATGTCTCCGCTTCATGCCAT
ARG1 F: TGGACAGACTAGGAATTGGCA 102
R: CCAGTCCGTCAACATCAAAACT
FABP4 F: TGGGCCAGGAATTTGACGAA 232
R: GCGAACTTCAGTCCAGGTCA
ADIPOQ F: ACTGCAGTCTGTGGTTCTGA 142
R: CATGACCGGGCAGAGCTAAT
LPL F: CAATCACAGCAGCAAAACCTT 134
R: GCCAGTCCACCACAATGACA
HSL (LIPE) F: CACTTAGCCCCTCCACACCCT 70
R: TCAGCCTCTTCCCCTGCATCCTC
PPARγ F: TGCTCCAGAAAATGACAGACC 194
R: ATTTTCCCTCAGAATAGTGCAAC
UCHL1 F: GACGAATGCCTTTTCCGGTG 114
R: AGAAGCGGACTTCTCCTTGC
M-PD-L1 F: AAAGACGAGCATAGCCGAAC 188
R: GCCACACCAATCCAACACC
M-actin F: ACATCCGTAAAGACCTCTATGCC 223
R: TACTCCTGCTTGCTGATCCAC
β-actin F: ACCCTGAAGTACCCCATCGAG 224
R: AGCACAGCCTGGATAGCAAC

Statistical analysis

Data analysis was performed using GraphPad Priam (version 9.0; GraphPad Software, La Jolla, California). Measurement data are presented as mean ± standard deviation (SD). Student’s t-test was used to analyze the differences between the two groups. The one-way analysis of variance (ANOVA) was used to compare multiple groups. P < 0.05 was considered statistically significant.

Results

Screening of ubiquitin enzymes related to the immune landscape of TNBC

The ubiquitination enzymes associated with the immune regulation of TNBC were screened from the transcriptomic data (TCGA database). As shown in Fig. 1A, 10 ubiquitination enzymes were significantly upregulated in TNBC samples compared to the normal tissues, including PSMD14, UCHL5, USP39, USP5, USP21, USP1, YOD1, USP18, USP41, and UCHL1 (Fig. 1B). The PPI network of these genes is shown in Fig. 1C. Furthermore, GO and KEGG analyses showed significant enrichment of proteasome, Fanconi anemia pathway, thiol-dependent ubiquitinyl hydrolase activity, and ubiquitin-like protein-specific protease activity (Fig. 1D).

Fig. 1.

Fig. 1

Screening of ubiquitin enzymes related to immune regulation in TNBC. A Volcano plot of ubiquitin enzymes. Those in the upper left and right quadrants showed significant differential expression. B Heat map showing the top 10 upregulated ubiquitin enzymes. C The PPI network of the top 10 ubiquitin enzymes from the STRING database. D GO and KEGG analysis of the ubiquitin enzymes

UCHL1 was highly expressed in TNBC tissues and the IFN-γ and TNF-α-stimulated ADSCs

We isolated ADSCs from the para-tumor fat tissues of TNBC patients, and stimulated the cells with IFN-γ and TNF-α to simulate the inflamed tumor microenvironment. As shown in Fig. 2, the number and density of the Oil-red O-stained ADSCs were significantly higher after 7 days of culture compared to that on Day 0. Consistent with this, the PPAR-γ, HSL, LPL, ADIPOQ and FABP4 mRNAs were upregulated in the ADSCs on Day 7 (Fig. 2B). Furthermore, the expression levels of the 10 ubiquitination enzymes also increased significantly following stimulation with the pro-inflammatory cytokines, of which UCHL1 showed the maximum increase (Figure S1A-B). Likewise, UCHL1 was upregulated in the TNBC tissues of 11 patients in TCGA compared to the corresponding para-tumor tissues (Figure S2A). Compared to the normal breast tissues from GTEx (179 samples) and TCGA (11 para-tumor tissues), UCHL1 was highly expressed in the 116 TNBC samples from TCGA (Figure S2B). We also examined clinical specimens from TNBC patients, and found that UCHL1 gene and protein levels were significantly higher in the tumor tissues compared to the adjacent breast tissues (Figure S1C). Studies have shown that UCHL1 was upregulated in ADSCs following stimulation with pro-inflammatory cytokines IFN-γ and TNF-α [22]. Based on these studies [22, 28], we speculate that IFN-γ and TNF-α may activate the expression of UCHL-1 in ADSCs through NF-κB. The results showed that BAY 11-7082 (NF-κB inhibitor) intervention inhibited the UCHL1 protein level in the IFN-γ and TNF-α-stimulated ADSCs (Figure S1D). Taken together, UCHL1 was highly expressed in TNBC tissues and the IFN-γ and TNF-α-stimulated ADSCs, indicating its involvement in tumor development and progression.

Fig. 2.

Fig. 2

Extraction and identification of exosomes derived from ADSCs. A Representative images of Oil-red O-stained ADSCs. Scale bar = 25 μm. B Expression levels of PPAR-γ, HSL, LPL, ADIPOQ, and FABP4 mRNAs in the ADSCs on Day 0 and Day 7. C Representative TEM images of the exosomes. Scale bar = 100 nm. D Size of the exosomes by NTA. E Immunoblot showing levels of CD9, CD63 and CD81 proteins in the ADSCs and exosomes. F Representative images showing the distribution of exosomes (PKH26) in the TNBC cells. Scale bar = 25 μm. G UCHL1 protein expression in the ADSCs, ADSCs-con and ADSCs-si-UCHL1. H UCHL1 protein expression in the Exos, Exos-con and Exos-si-UCHL1. I The transfection efficiency of GFP-oe-NC and GFP-oe-UCHL1 in ADSCs. J UCHL1 protein expression in Exos-GFP-oe-NC and Exos-GFP-oe-UCHL1 transfection. *P < 0.05 vs. Day 0. #P < 0.05 vs. ADSCs-con

Exosomes secreted by ADSCs likely promote immune escape of TNBC cells by transporting UCHL1

We isolated exosomes from the ADSCs, and verified their vesicular structure by TEM (Fig. 2C) and the particle size (~ 130 nm) by NTA (Fig. 2D). In addition, the exosomes expressed the characteristic markers, including CD63, CD81, and CD9 in Exos (Fig. 2E). As shown in Fig. 2F, the exosomes were successfully taken up by the MDA-MB-231 and MDA-MB-468 cells (Fig. 2F). To further explore the role of UCHL1 in the ADSCs, we knocked down UCHL1 gene expression in ADSCs using specific siRNA. UCHL-1 protein levels were significantly decreased in ADSCs-si-UCHL1 group (Fig. 2G), as well as in the exosomes of ADSCs-si-UCHL1 (Fig. 2H), compared to the ADSCs-con or Exos-si-UCHL1 group. We further validated its transfection efficiency by adopting GFP-oe-UCHL1 (Fig. 2I). Western blot detection further confirmed that after GFP-oe-UCHL1 transfection, the expression of UCHL1 protein increased in ADSCs-Exos (Fig. 2J). Furthermore, treatment of TBNC cells (MDA-MB-231 and MDA-MB-468) with ADSCs-Exos showed that GFP-oe-UCHL1 was taken up by TBNC cells (Figure S1E). These results demonstrated the transfer of GFP-oe-UCHL1 during the process of extracellular vesicle uptake. Furthermore, ADSCs-Exos increased UCHL-1 protein expression in the co-cultured TNBC (MDA-MB-231 and MDA-MB-468) cells. While ADSCs-exoIFN−γ+TNF−α significantly upregulated UCHL1 compared to ADSCs-Exos, this effect was mitigated by knocking down UCHL1 in the stimulated ADSCs (Fig. 3A). ADSCs-Exos promoted the viability, migration and proliferative capacity of TNBC cells, and these parameters were further enhanced by ADSCs-exoIFN−γ+TNF−α. On the other hand, ADSCs-exoIFN−γ+TNF−α+si−UCHL1 decreased the viability, proliferation, and migration of the co-cultured TNBCs (Fig. 3B–D).

Fig. 3.

Fig. 3

Fig. 3

ADSCs-ExosIFN−γ+TNF−α promoted immune escape of TNBC cells by transporting UCHL1. ADSCs were treated with 10 ng/mL IFN-γ and TNF-α, and transfected with si-NC or si-UCHL1. The exosomes were extracted from the supernatant. TNBC cells were treated with 10 μg/mL of the ADSCs-CM and different exosomes for 24 h, and then co-cultured with THP-1 cells for 48 h or with T cells for 16 h. A UCHL1 protein levels in TNBC cells in the indicated groups. B Viability of TNBC cells in the indicated groups. C Representative images showing Ki-67 expression in TNBC cells in the indicated groups. Scale bar = 100/25 μm. D Representative images showing migration of TNBC cells in the indicated groups. Scale bar = 100 μm. *P < 0.05 vs. MDA-MB-231 or MDA-MB-468. #P < 0.05 vs. Exos + MDA-MB-231 or Exos + MDA-MB-468. &P < 0.05 vs. ExosIFN−γ+TNF−α+con + MDA-MB-231 or ExosIFN−γ+TNF−α+con + MDA-MB-468. E The proportion of CD68+CD206+ THP-1 cells in the indicated groups. F Arg-1, CD206, TNF-α, and iNOS expression in THP-1 cells. *P < 0.05 vs. THP-1. #P < 0.05 vs. MDA-MB-231 + THP-1 or MDA-MB-468 + THP-1. &P < 0.05 vs. Exos + THP-1. @P < 0.05 vs. ExosIFN−γ+TNF−α+con + THP-1. G The proportion of CD3+CD8+ T cells in the indicated groups. H Perforin and GZMB levels in T cells. *P < 0.05 vs. T cells. #P < 0.05 vs. MDA-MB-231 + T cells or MDA-MB-468 + T cells. &P < 0.05 vs. Exos + T cells. @P < 0.05 vs. ExosIFN−γ+TNF−α+con + T cells

TNBC cells increased the expression of CD206 and Arg-1, and decreased that of THF-α and iNOS in the co-cultured THP-1 cells, which is indicative of M2 polarization. Interestingly, subsequent exposure to ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α enhanced M2 polarization of the THP-1 monocytes, and the impact of ADSCs-ExosIFN−γ+TNF−α was more pronounced. In contrast, ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 reversed the M2 polarization of THP-1 cells by downregulating CD206 and Arg-1, and upregulating THF-α and iNOS (Fig. 3E, F). Furthermore, the TNBC cells also reduced the CD8 + population in the co-cultured T cells. The proportion of CD3+CD8+T cells decreased further following culture with ADSCs-Exos, while ADSCs-ExosIFN−γ+TNF−α led to even greater decline. As expected, ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 increased the proportion of CD3+CD8+T cells in ADSCs-ExosIFN−γ+TNF−α+con group (Fig. 3G). The TNBC cells also increased the levels of perforin and GZMB in the co-culture supernatant, which were decreased by the ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α. However, ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 increased perforin and GZMB secretion by the co-cultured T cells (Fig. 3H). Taken together, these findings suggest that exosomes secreted by ADSCs in the inflamed breast tumor microenvironment promote immune escape of tumor cells by transporting UCHL1.

ADSCs-Exos delivered UCHL1 to activate the STAT3/PD-L1 pathways in TNBC cells through HDAC6

To further explore the role of exosomal UCHL1 in TNBC cells, we cultured the MDA-MB-231 and MDA-MB-468 cells with the exosomes from differentially treated ADSCs. As shown in Fig. 4A, ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α significantly upregulated PD-L1 mRNA in the TNBC cell lines, while ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 downregulated PD-L1 mRNA. Similar trends were noted in the levels of PD-L1 as well as p-STAT3/STAT3 proteins (Fig. 4B, C). In addition, the anti-PD-L1 monoclonal antibody inhibited the M2 polarization of THP-1 cells by ADSCs-ExosIFN−γ+TNF−α (Fig. 4D), and downregulated Arg-1 and CD206 (Fig. 4E). These findings suggest that ADSCs-ExosIFN−γ+TNF−α can activate the STAT3 and PD-L1 pathways in TNBC cells.

Fig. 4.

Fig. 4

Exosomes derived from cytokine-stimulated ADSCs activated the STAT3 and PD-L1 pathways via UCHL1 transporter. ADSCs were treated with 10 ng/mL IFN-γ and TNF-α, and transfected with si-NC or si-UCHL1. The exosomes were extracted from the supernatant. The TNBC cells were cultured with the different exosomes for 24 h. A PD-L1 mRNA expression in MDA-MB-231 and MDA-MB-468 cells. B and C p-STAT3/STAT3 and PD-L1 protein expression in the TNBC cells. *P < 0.05 vs. MDA-MB-231 or MDA-MB-468. #P < 0.05 vs. Exos + MDA-MB-231 or Exos + MDA-MB-468. &P < 0.05 vs. ExosIFN−γ+TNF−α+con + MDA-MB-231 or ExosIFN−γ+TNF−α+con + MDA-MB-468. D The proportion of CD68+CD206+ THP-1 cells in the indicated groups. E Arg-1 and CD206 expressions in THP-1 cells. TNBC cells were treated with 10 μg/mL exosomes for 24 h and then co-cultured with THP-1 cells in the presence of IgG or anti-PD-L1 monoclonal antibody (10 μg/mL) for 72 h. *P < 0.05 vs. Exos + MDA-MB-231 + IgG or Exos + MDA-MB-468 + IgG. #P < 0.05 vs. ExosIFN−γ+TNF−α + THP-1 + IgG

Knocking down UCHL1 in the MDA-MB-231 and MDA-MB-468 cells significantly decreased UCHL1 protein levels (Fig. 5A), and also downregulated PD-L1 and p-STAT3/STAT3 (Fig. 5B). The co-IP assay showed lack of interaction between UCHL1 and PD-L1/STAT3 (Figure S3A). To further investigate the specific mechanism by which UCHL1 regulates the STAT3/PD-L1 axis, we used ubibrowser_v2.0 to predict the known substrates of UCHL1, and biogrid_v4.4.228 to predict potential targets that may interact with STAT3. The intersection of these two datasets yielded 5 interacting proteins of UCHL1 and STAT3 proteins, namely TP53, COPS5, NFKB1, HIF1A, and HDAC6 (Figure S3B). HDAC6 is known to interact with STAT3 in cancer-associated fibroblasts, and mediates immune-related functions [29]. Furthermore, the HDAC6/STAT3 pathway also regulates PD-L1 expression in osteosarcoma cell lines [30]. Therefore, we hypothesized that UCHL1 may regulate PD-L1 expression in tumor cells via the HDAC6/STAT3 pathway. Consistent with our hypothesis, UCHL1 silencing downregulated the HDAC6 protein in MDA-MB-231 and MDA-MB-468 cells (Fig. 5C), and co-IP further verified the interaction between UCHL1 and HDAC6 (Fig. 5D). Under the proteasome inhibitor MG132 treatment, si-UCHL1 promoted the ubiquitination degradation level of HDAC6 protein, while oe-UCHL1 inhibited the ubiquitination degradation level of HDAC6 protein (Fig. 5E, F). Furthermore, HDAC6 knockdown downregulated the HDAC6, p-STAT3/STAT3, and PD-L1 levels in TNBC cell lines without affecting the deacetylation level of STAT3 (Fig. 5G), and co-IP analysis confirmed the interaction between HDAC6 and STAT3 (Fig. 5H). Taken together, exosomal UCHL1 may regulate the STAT3/PD-L1 signaling pathways in TNBC cells through HDAC6.

Fig. 5.

Fig. 5

UCHL1 regulates the STAT3/PD-L1 pathways through HDAC6 in TNBC cells. A UCHL1 protein expression in MDA-MB-231 and MDA-MB-468 cells. B PD-L1, STAT3 and p-STAT3 expression in the TNBC cells. C HDAC6 protein expression in TNBC cells with UCHL1 knockdown. D Results of co-IP showing the interaction of UCHL1 and HDAC6. E and F Ubiquitination level of HDAC6 in the UCHL1-knockdown or UCHL1-overexpressing cells treated with MG132 (150 nM) for 3 h. G HDAC6, PD-L1, STAT3, p-STAT3 and ac-STAT3 expressions in HDAC6-knockdown MDA-MB-231 and MDA-MB-468 cells. H Results of co-IP showing the interaction of STAT3 and HDAC6. *P < 0.05 vs. con. #P < 0.05 vs. sh-NC

Exosomes derived from stimulated ADSCs promoted tumorigenesis in vivo

To further validate the tumorigenic role of exosomes secreted by stimulated ADSCs, we established an in vivo 4T1 tumor model, and treated the tumor-bearing mice with the different exosomes. The 4T1 cells treated with ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α exhibited an increase in the expression of PD-L1, HDAC6 and p-STAT3 proteins, while ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 downregulated these proteins in 4T1 cells (Figure S4A-B). In the mouse model, ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α increased tumor volume and mass, and the effect of the latter was more pronounced. However, ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 significantly reduced tumor weight and volume (Fig. 6A). Furthermore, ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α also increased the expression of Ki-67 and the numbers of F4/80+/CD206+ cells in the tumor tissues, whereas ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 resulted in a significant reduction in these markers (Fig. 6B, C). Treatment with ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α significantly decreased the percentage of CD3+CD8+ T cells, the levels of perforin and GZMB (Fig. 6D, E), the numbers of CD8+/GZMB+ cells and CD8+/perforin+ cells (Fig. 6F, G) in the tumor tissues, whereas ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 increased the intra-tumoral proportion of CD8+T cells and the cytotoxic effectors (Fig. 6D–G). Finally, ADSCs-Exos and ADSCs-ExosIFN−γ+TNF−α also upregulated the HDAC6, UCHL1, PD-L1 and STAT3 transcripts, and HDAC6, UCHL1, PD-L1 and p-STAT3 proteins in the tumor tissues, whereas ADSCs-ExosIFN−γ+TNF−α+si−UCHL1 reversed these trends (Fig. 6H). Notably, ADSCs-ExosIFN−γ+TNF−α had a stronger therapeutic effect compared to ADSCs-Exos. Overall, these findings suggest that exosomes secreted by ADSCs under inflammatory conditions promote tumor growth by fostering an immunosuppressive microenvironment via the UCHL1/HDAC6/STAT3/PD-L1 axis.

Fig. 6.

Fig. 6

Fig. 6

ADSCs-ExosIFN−γ+TNF−α promoted tumor growth in vivo. BALB/c mice were subcutaneously injected with 4T1 cells (2 × 106) and treated with 100 μg of the different exosomes every 3 days. A Tumor weight and volume in the indicated groups. B In-situ expression of Ki-67 in the tumor tissues of indicated groups. Scale bar = 100/25 μm. C The F4/80+/CD206+ cells in the tumor tissues of indicated groups. Scale bar = 25 μm. D The proportion of CD3+CD8+ T cell in the tumor tissues of indicated groups. E Perforin and GZMB levels in the tumor tissues of indicated groups. F and G CD8+/GZMB+ cells and CD8+/perforin+ cells in the tumor tissues of indicated groups. (H) HDAC6, UCHL1, PD-L1, p-STAT3 and STAT3 levels in the tumors of indicated groups. *P < 0.05 vs. 4T1. #P < 0.05 vs. Exos + 4T1. &P < 0.05 vs. ExosIFN−γ+TNF−α+con + 4T1

Discussion

UCHL1 plays a key role in the progression of TNBC by maintaining cell dryness and promoting cell invasion, and is therefore a potential therapeutic target [31]. High UCHL1 expression in breast cancer patients is frequently associated with poor prognosis [32]. Consistent with previous reports, we found that UCHL1 was highly expressed in TNBC tissues, as well as in the ADSCs isolated from the para-tumor fat tissues and stimulated in vitro with pro-inflammatory cytokines. BAY 11-7082 (NF-κB inhibitor) intervention inhibited the UCHL1 protein level in the IFN-γ and TNF-α-stimulated ADSCs. In addition, TNBC cells cultured in the presence of exosomes derived from the stimulated ADSCs also showed an upregulation of UCHL1 protein. Furthermore, treatment of TBNC cells (MDA-MB-231 and MDA-MB-468) with ADSCs-Exos showed that GFP-oe-UCHL1 was taken up by TBNC cells, which proved the transfer of GFP-oe-UCHL1 during the process of extracellular vesicle uptake. Taken together, UCHL1 was highly expressed in TNBC tissues and the IFN-γ and TNF-α-stimulated ADSCs, indicating its involvement in tumor development and progression.

Further investigation of the underlying mechanisms may contribute to the development of targeted UCHL1 drugs.

ADSCs secrete growth factors and exosomes that may affect tumor progression [33]. In addition, pro-inflammatory cytokines in the tumor tissues induce an immunosuppressive microenvironment [22], which is a key determinant of the response to immunotherapy. Tumor-associated macrophages also play crucial roles in tumor invasion and metastasis [34, 35], and are predominantly of the M2 phenotype [36, 37]. M2 macrophages promote tumor growth, invasion and angiogenesis, while inhibiting T cell activation [38, 39]. CD8+T cells are the key anti-tumor immune effectors, and induce cell death through direct physical contact [40, 41]. The lack of CD8+T cells in the tumor microenvironment allows tumor cells to evade the immune system [4244]. The exosomes secreted by ADSCs with UCHL1 knockdown significantly downregulated CD206, HDAC6, STAT3, and PD-L1 in vivo and in vitro, indicating that ADSCs-Exos mediate immune escape of TNBC cells by transporting UCHL1.

Targeted inhibition of UCHL1 has been shown to enhance the efficacy of endocrine therapy against TNBC, and reduce the migration and metastasis of tumor cells [45]. In addition, UCHL1 knockdown increased the transcriptional activity of estrogen receptor (ER) in the estrogen-treated breast cancer cell lines [46]. Deubiquitination enzymes (DUBs) are ubiquitin (Ub) hydrolases that play key roles in cancer progression [46]. In this study, we found that UCHL1 regulates the STAT3 and PD-L1 signaling pathways through HDAC6. Pharmacological or genetic depletion of HDAC6 in primary melanoma samples and cell lines also led to PD-L1 downregulation by targeting STAT3 recruitment and activation [47]. Furthermore, HDAC6 inhibitors can enhance the efficacy of conventional chemotherapy drugs such as DNA damaging agents, proteasome inhibitors, and microtubule inhibitors [48]. Therefore, a combination therapy targeting UCHL1 and HDAC6 inhibitors may be effective against TNBC and is worth investigating further.

STAT3 is a pro-oncogenic transcription factors that is activated in breast tumors [49], and regulates the expression genes associated with cancer cell proliferation, invasion, migration, apoptosis, immunosuppression, stem cell regeneration, and autophagy [5052]. STAT3 activation can upregulate oncogenes or downregulate tumor suppressor genes [50, 53], and is associated with factors involved in tumor immune escape and chemoresistance, such as OCT-4, c-MYC [54], TGF-β [55], VEGF [56], and NF-κB [57]. The combination of PD-1 and STAT3 blockers synergistically inhibited tumor growth in colon cancer models [58]. In addition, PD-L1 antibodies have been shown to be effective against multiple cancer types and can significantly improve patient survival [59]. D-mannose sensitized TNBC cells to immunotherapy and radiotherapy by degrading PD-L1 [60].

Overall, our findings suggest that exosomes secreted by ADSCs under inflammatory conditions promote tumor growth by inducing immunosuppressive conditions via the UCHL1/HDAC6/STAT3/PD-L1 axis. These novel insights into the malignant progression of TNBC offers potential therapeutic targets.

Conclusion

UCHL1 is significantly upregulated in TNBC tissues and correlates with prognosis. Exosomes derived from the para-tumor ADSCs also express high levels of UCHL1, and likely promote cancer progression and immune escape through the UCHL1/HDAC6/STAT3/PD-L1 pathway.

Supplementary Information

Supplementary Material 2. (205.2KB, jpg)
Supplementary Material 3. (285.9KB, jpg)
Supplementary Material 4. (715.9KB, jpg)

Acknowledgements

No acknowledgment.

Author contributions

Conception and design: Q. Z. and Y. H.; analysis and interpretation of the data: Q. Z., K. Z., and Y. C.; The drafting of the paper: Y. H.; Revising the paper critically for intellectual content: Q. Z., K. Z., and Y. C.

Funding

This study was supported by Nature Science Foundation of Hunan Province (No.2022JJ30994).

Availability of data and materials

Data can be provided upon request.

Declarations

Ethics approval and consent to participate

This study was approved by Human Research Ethics Committee of Xiangya Hospital (AF/SQ 2022090917).

Consent for publication

N/A.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Ding Y, Chen X, Liu C, Ge W, Wang Q, Hao X, Wang M, Chen Y, Zhang Q. Identification of a small molecule as inducer of ferroptosis and apoptosis through ubiquitination of GPX4 in triple negative breast cancer cells. J Hematol Oncol. 2021;14(1):19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yin L, Duan JJ, Bian XW, Yu SC. Triple-negative breast cancer molecular subtyping and treatment progress. Breast Cancer Res. 2020;22(1):61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dent R, Trudeau M, Pritchard KI, Hanna WM, Kahn HK, Sawka CA, Lickley LA, Rawlinson E, Sun P, Narod SA. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res. 2007;13(15 Pt 1):4429–34. [DOI] [PubMed] [Google Scholar]
  • 4.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68(1):7–30. [DOI] [PubMed] [Google Scholar]
  • 5.Kennecke H, Yerushalmi R, Woods R, Cheang MC, Voduc D, Speers CH, Nielsen TO, Gelmon K. Metastatic behavior of breast cancer subtypes. J Clin Oncol. 2010;28(20):3271–7. [DOI] [PubMed] [Google Scholar]
  • 6.Gluz O, Liedtke C, Gottschalk N, Pusztai L, Nitz U, Harbeck N. Triple-negative breast cancer–current status and future directions. Ann Oncol. 2009;20(12):1913–27. [DOI] [PubMed] [Google Scholar]
  • 7.Penault-Llorca F, Viale G. Pathological and molecular diagnosis of triple-negative breast cancer: a clinical perspective. Ann Oncol. 2012. 10.1093/annonc/mds190. [DOI] [PubMed] [Google Scholar]
  • 8.Heeke AL, Tan AR. Checkpoint inhibitor therapy for metastatic triple-negative breast cancer. Cancer Metastasis Rev. 2021;40(2):537–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Johnson DB, Nebhan CA, Moslehi JJ, Balko JM. Immune-checkpoint inhibitors: long-term implications of toxicity. Nat Rev Clin Oncol. 2022;19(4):254–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Barton BM, Xu R, Wherry EJ, Porrett PM. Pregnancy promotes tolerance to future offspring by programming selective dysfunction in long-lived maternal T cells. J Leukoc Biol. 2017;101(4):975–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shim YJ, Khedraki R, Dhar J, Fan R, Dvorina N, Valujskikh A, Fairchild RL, Baldwin WM 3rd. Early T cell infiltration is modulated by programed cell death-1 protein and its ligand (PD-1/PD-L1) interactions in murine kidney transplants. Kidney Int. 2020;98(4):897–905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Franzoi MA, Romano E, Piccart M. Immunotherapy for early breast cancer: too soon, too superficial, or just right? Ann Oncol. 2021;32(3):323–36. [DOI] [PubMed] [Google Scholar]
  • 13.Keenan TE, Tolaney SM. Role of Immunotherapy in triple-negative breast cancer. J Natl Compr Canc Netw. 2020;18(4):479–89. [DOI] [PubMed] [Google Scholar]
  • 14.Liu J, Cheng Y, Zheng M, Yuan B, Wang Z, Li X, Yin J, Ye M, Song Y. Targeting the ubiquitination/deubiquitination process to regulate immune checkpoint pathways. Sign Transduct Target Ther. 2021;6(1):28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gavali S, Liu J, Li X, Paolino M. Ubiquitination in T-cell activation and checkpoint inhibition: new avenues for targeted cancer immunotherapy. Int J Mol Sci. 2021. 10.3390/ijms221910800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cui H, Wang Q, Lei Z, Feng M, Zhao Z, Wang Y, Wei G. DTL promotes cancer progression by PDCD4 ubiquitin-dependent degradation. J Exp Clin Cancer Res. 2019;38(1):350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fan Y, Wang J, Jin W, Sun Y, Xu Y, Wang Y, Liang X, Su D. CircNR3C2 promotes HRD1-mediated tumor-suppressive effect via sponging miR-513a-3p in triple-negative breast cancer. Mol Cancer. 2021;20(1):25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mondal M, Conole D, Nautiyal J, Tate EW. UCHL1 as a novel target in breast cancer: emerging insights from cell and chemical biology. Br J Cancer. 2022;126(1):24–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nakao Y, Fukuda T, Zhang Q, Sanui T, Shinjo T, Kou X, Chen C, Liu D, Watanabe Y, Hayashi C, et al. Exosomes from TNF-α-treated human gingiva-derived MSCs enhance M2 macrophage polarization and inhibit periodontal bone loss. Acta Biomater. 2021;122:306–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li J, Pan Y, Yang J, Wang J, Jiang Q, Dou H, Hou Y. Tumor necrosis factor-α-primed mesenchymal stem cell-derived exosomes promote M2 macrophage polarization via Galectin-1 and modify intrauterine adhesion on a novel murine model. Front Immunol. 2022;13: 945234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhu Q, Cao Y, Yuan J, Hu Y. Adipose-derived stem cell exosomes promote tumor characterization and immunosuppressive microenvironment in breast cancer. Cancer Immunol Immunother. 2024;73(2):39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gu Y, Ding X, Huang J, Xue M, Zhang J, Wang Q, Yu H, Wang Y, Zhao F, Wang H, et al. The deubiquitinating enzyme UCHL1 negatively regulates the immunosuppressive capacity and survival of multipotent mesenchymal stromal cells. Cell Death Dis. 2018;9(5):459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Karki R, Sharma BR, Tuladhar S, Williams EP, Zalduondo L, Samir P, Zheng M, Sundaram B, Banoth B, Malireddi RKS, et al. Synergism of TNF-α and IFN-γ triggers inflammatory cell death, tissue damage, and mortality in SARS-CoV-2 infection and cytokine shock syndromes. Cell. 2021;184(1):149-168.e117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hoekstra ME, Slagter M, Urbanus J, Toebes M, Slingerland N, de Rink I, Kluin RJC, Nieuwland M, Kerkhoven R, Wessels LFA, et al. Distinct spatiotemporal dynamics of CD8(+) T cell-derived cytokines in the tumor microenvironment. Cancer Cell. 2024;42(1):157-167.e159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Eshaq RS, Harris NR. The role of tumor necrosis factor-α and interferon-γ in the hyperglycemia-induced ubiquitination and loss of platelet endothelial cell adhesion molecule-1 in rat retinal endothelial cells. Microcirculation. 2021;28(7): e12717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Basler M, Buerger S, Groettrup M. The ubiquitin-like modifier FAT10 in antigen processing and antimicrobial defense. Mol Immunol. 2015;68(2PtA):129–32. [DOI] [PubMed] [Google Scholar]
  • 27.Freeman AJ, Vervoort SJ, Michie J, Ramsbottom KM, Silke J, Kearney CJ, Oliaro J. HOIP limits anti-tumor immunity by protecting against combined TNF and IFN-gamma-induced apoptosis. EMBO Rep. 2021;22(11): e53391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang H, Mao X, Sun Y, Hu R, Luo W, Zhao Z, Chen Q, Zhang Z. NF-κB upregulates ubiquitin C-terminal hydrolase 1 in diseased podocytes in glomerulonephritis. Mol Med Rep. 2015;12(2):2893–901. [DOI] [PubMed] [Google Scholar]
  • 29.Li A, Chen P, Leng Y, Kang J. Histone deacetylase 6 regulates the immunosuppressive properties of cancer-associated fibroblasts in breast cancer through the STAT3-COX2-dependent pathway. Oncogene. 2018;37(45):5952–66. [DOI] [PubMed] [Google Scholar]
  • 30.Keremu A, Aimaiti A, Liang Z, Zou X. Role of the HDAC6/STAT3 pathway in regulating PD-L1 expression in osteosarcoma cell lines. Cancer Chemother Pharmacol. 2019;83(2):255–64. [DOI] [PubMed] [Google Scholar]
  • 31.Tian C, Liu Y, Liu Y, Hu P, Xie S, Guo Y, Wang H, Zhang Z, Du L, Lei B, et al. UCHL1 promotes cancer stemness in triple-negative breast cancer. Pathol Res Pract. 2022;240: 154235. [DOI] [PubMed] [Google Scholar]
  • 32.Chen XS, Wang KS, Guo W, Li LY, Yu P, Sun XY, Wang HY, Guan YD, Tao YG, Ding BN, et al. UCH-L1-mediated down-regulation of estrogen receptor α contributes to insensitivity to endocrine therapy for breast cancer. Theranostics. 2020;10(4):1833–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang X, Wang H, Cao J, Ye C. Exosomes from adipose-derived stem cells promotes VEGF-C-dependent lymphangiogenesis by regulating miRNA-132/TGF-β pathway. Cell Physiol Biochem. 2018;49(1):160–71. [DOI] [PubMed] [Google Scholar]
  • 34.Vitale I, Manic G, Coussens LM, Kroemer G, Galluzzi L. Macrophages and metabolism in the tumor microenvironment. Cell Metab. 2019;30(1):36–50. [DOI] [PubMed] [Google Scholar]
  • 35.Quail DF, Joyce JA. Microenvironmental regulation of tumor progression and metastasis. Nat Med. 2013;19(11):1423–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hinshaw DC, Shevde LA. The tumor microenvironment innately modulates cancer progression. Cancer Res. 2019;79(18):4557–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yahaya MAF, Lila MAM, Ismail S, Zainol M, Afizan N. Tumour-associated macrophages (TAMs) in colon cancer and how to reeducate them. J Immunol Res. 2019;2019:2368249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mantovani A, Marchesi F, Malesci A, Laghi L, Allavena P. Tumour-associated macrophages as treatment targets in oncology. Nat Rev Clin Oncol. 2017;14(7):399–416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Osipov A, Saung MT, Zheng L, Murphy AG. Small molecule immunomodulation: the tumor microenvironment and overcoming immune escape. J Immunother Cancer. 2019;7(1):224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jiang X, Xu J, Liu M, Xing H, Wang Z, Huang L, Mellor AL, Wang W, Wu S. Adoptive CD8(+) T cell therapy against cancer: challenges and opportunities. Cancer Lett. 2019;462:23–32. [DOI] [PubMed] [Google Scholar]
  • 41.Farhood B, Najafi M, Mortezaee K. CD8(+) cytotoxic T lymphocytes in cancer immunotherapy: a review. J Cell Physiol. 2019;234(6):8509–21. [DOI] [PubMed] [Google Scholar]
  • 42.Joyce JA, Fearon DT. T cell exclusion, immune privilege, and the tumor microenvironment. Science. 2015;348(6230):74–80. [DOI] [PubMed] [Google Scholar]
  • 43.Jiang P, Gu S, Pan D, Fu J, Sahu A, Hu X, Li Z, Traugh N, Bu X, Li B, et al. Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response. Nat Med. 2018;24(10):1550–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Peranzoni E, Lemoine J, Vimeux L, Feuillet V, Barrin S, Kantari-Mimoun C, Bercovici N, Guérin M, Biton J, Ouakrim H, et al. Macrophages impede CD8 T cells from reaching tumor cells and limit the efficacy of anti-PD-1 treatment. Proc Natl Acad Sci U S A. 2018;115(17):E4041-e4050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liu S, González-Prieto R, Zhang M, Geurink PP, Kooij R, Iyengar PV, van Dinther M, Bos E, Zhang X, Le Dévédec SE, et al. Deubiquitinase activity profiling identifies UCHL1 as a candidate oncoprotein that promotes TGFβ-induced breast cancer metastasis. Clin Cancer Res. 2020;26(6):1460–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jara JH, Frank DD, Özdinler PH. Could dysregulation of UPS be a common underlying mechanism for cancer and neurodegeneration? lessons from UCHL1. Cell Biochem Biophys. 2013;67(1):45–53. [DOI] [PubMed] [Google Scholar]
  • 47.Lienlaf M, Perez-Villarroel P, Knox T, Pabon M, Sahakian E, Powers J, Woan K, Lee C, Cheng F, Deng S. Essential role of HDAC6 in the regulation of PD-L1 in melanoma. Mol Oncol. 2016;10(5):735–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kaur S, Rajoria P, Chopra M. HDAC6: a unique HDAC family member as a cancer target. Cell Oncol (Dordr). 2022;45(5):779–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.To SQ, Dmello RS, Richards AK, Ernst M, Chand AL. STAT3 signaling in breast cancer: multicellular actions and therapeutic potential. Cancers. 2022;14(2):429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Huynh J, Chand A, Gough D, Ernst M. Therapeutically exploiting STAT3 activity in cancer - using tissue repair as a road map. Nat Rev Cancer. 2019;19(2):82–96. [DOI] [PubMed] [Google Scholar]
  • 51.Ma JH, Qin L, Li X. Role of STAT3 signaling pathway in breast cancer. Cell Commun Signal. 2020;18(1):33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646–74. [DOI] [PubMed] [Google Scholar]
  • 53.Lee H, Zhang P, Herrmann A, Yang C, Xin H, Wang Z, Hoon DS, Forman SJ, Jove R, Riggs AD, et al. Acetylated STAT3 is crucial for methylation of tumor-suppressor gene promoters and inhibition by resveratrol results in demethylation. Proc Natl Acad Sci U S A. 2012;109(20):7765–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Cheng CC, Shi LH, Wang XJ, Wang SX, Wan XQ, Liu SR, Wang YF, Lu Z, Wang LH, Ding Y. Stat3/Oct-4/c-Myc signal circuit for regulating stemness-mediated doxorubicin resistance of triple-negative breast cancer cells and inhibitory effects of WP1066. Int J Oncol. 2018;53(1):339–48. [DOI] [PubMed] [Google Scholar]
  • 55.Liu RY, Zeng Y, Lei Z, Wang L, Yang H, Liu Z, Zhao J, Zhang HT. JAK/STAT3 signaling is required for TGF-β-induced epithelial-mesenchymal transition in lung cancer cells. Int J Oncol. 2014;44(5):1643–51. [DOI] [PubMed] [Google Scholar]
  • 56.Niu G, Wright KL, Huang M, Song L, Haura E, Turkson J, Zhang S, Wang T, Sinibaldi D, Coppola D, et al. Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis. Oncogene. 2002;21(13):2000–8. [DOI] [PubMed] [Google Scholar]
  • 57.Snyder M, Huang J, Huang XY, Zhang JJ. A signal transducer and activator of transcription 3·Nuclear Factor κB (Stat3·NFκB) complex is necessary for the expression of fascin in metastatic breast cancer cells in response to interleukin (IL)-6 and tumor necrosis factor (TNF)-α. J Biol Chem. 2014;289(43):30082–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hayakawa T, Yaguchi T, Kawakami Y. Enhanced anti-tumor effects of the PD-1 blockade combined with a highly absorptive form of curcumin targeting STAT3. Cancer Sci. 2020;111(12):4326–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Yamaguchi H, Hsu J-M, Yang W-H, Hung M-C. Mechanisms regulating PD-L1 expression in cancers and associated opportunities for novel small-molecule therapeutics. Nat Rev Clin Oncol. 2022;19(5):287–305. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang R, Yang Y, Dong W, Lin M, He J, Zhang X, Tian T, Yang Y, Chen K, Lei QY, et al. D-mannose facilitates immunotherapy and radiotherapy of triple-negative breast cancer via degradation of PD-L1. Proc Natl Acad Sci U S A. 2022. 10.1073/pnas.2114851119. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 2. (205.2KB, jpg)
Supplementary Material 3. (285.9KB, jpg)
Supplementary Material 4. (715.9KB, jpg)

Data Availability Statement

Data can be provided upon request.


Articles from Cancer Cell International are provided here courtesy of BMC

RESOURCES