The functions of DNA methyltransferases during the feeding and development of Haemaphysalis longicornis are potentially associated with lysosome pathways

Abstract

Background

DNA methylation is an epigenetic modification that plays an important role in animal and plant development. Among the diverse types of DNA methylation modifications, methylation of cytosines catalyzed by DNA cytosine methyltransferases (DNMTs) is the most common. Recently, we characterized DNA methyltransferase genes including HlDnmt1 and HlDnmt from the Asian longhorned tick, Haemaphysalis longicornis. However, the dynamic expression and functions of these DNMTs at different developmental stages and feeding statuses of the important vector tick H. longicornis remain unknown.

Results

The expression levels of HlDnmt1 and HlDnmt were significantly different at the four developmental stages: eggs, larvae, nymphs, and adults, with the highest expression levels observed in the larval stage. HlDnmt1 and HlDnmt showed different expression trends in the midguts, ovary, Malpighian tubules, and salivary glands of engorged adults, with the highest expression of HlDnmt1 observed in the ovary and the lowest in the midguts; HlDnmt expression was the highest in the midguts and the lowest in the Malpighian tubules. After RNA interference, the relative expression of HlDnmt1 and HlDnmt in H. longicornis decreased significantly, resulting in a significant decrease in the biting rate of H. longicornis. RNA-seq revealed that the differentially expressed genes were mainly enriched in the biological processes of peptide biosynthesis and the cell components of ribosomes. Molecular functions were mainly concentrated on oxidoreductase activity, ribosome structure composition, serine-type endopeptidase activity, molecular function regulators, and endopeptidase inhibitor activity. KEGG enrichment analysis showed that the differentially expressed genes were mainly enriched in autophagy and lysosome pathways, amino sugar and nucleotide sugar metabolism, glyceride metabolism, ribosomes, and other pathways.

Conclusions

HlDnmt1 and HlDnmt played an important role during development and feeding of H. longicornis, and their functions were potentially associated with lysosome pathways. These results provide basic knowledge for understanding the epigenetic regulation of the development of the tick H. longicornis, which sheds light on control strategies for ticks and tick-borne diseases.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-024-11049-9.

Introduction

DNA methylation is a major epigenetic mechanism found in both prokaryotes and eukaryotes [1]. It regulates gene expression by recruiting proteins that promote gene expression or inhibiting the binding of transcription factors to DNA [2], which plays a crucial role for diverse biological processes [3]. Unlike mammalian methylation that is distributed throughout the genome except at CpG islands near promoters of genes [4], DNA methylation in arthropods is mainly restricted to the transcribed regions of genes [5, 6], and the levels of genome methylation show great variations among different arthropods [7]. DNA methylation patterns are mainly established by DNA methyltransferases (DNMTs), which can help transfer the methyl groups of S-adenosylmethionine (SAM) to the fifth carbon of cytosine residues, resulting in 5-methylcytosine (5mC) [2]. Among the DNMTs, DNMT1 provides the maintenance methyltransferase activity, whereas DNMT2 displays RNA methyltransferase activity, and DNMT3 is responsible for most of de novo DNA methylation [8, 9].

DNA methylation has been extensively explored in vertebrates and is associated with numerous functions [10, 11]. The roles of DNA methylation in insects have also been described previously. In the large milkweed bug, Oncopeltus fasciatus, RNAi-mediated knockdown of Dnmt1 in ovarian tissue led to reproductive failure, reduced egg numbers and inviable eggs, and abnormal nuclei structure in the follicular epithelium [12]. Insights into the functional significance of DNA methylation have also emerged from arthropod genomes [6, 13]. In Daphnia, DNA methylation is primarily enriched in coding regions of genes, with the highest levels observed at exons 2–4. In contrast, vertebrate genomes exhibit global methylation, with methylation levels increasing towards exon 2 and remaining high throughout the rest of the gene body [14]. Although DNA methylation has been described in some crustaceans and arachnids, studies have been limited to ticks [15, 16]. Ticks are obligate blood-sucking ectoparasites that can transmit a great diversity of pathogens to their host and are ranked second only to mosquitoes as vectors of human pathogens [17, 18]. They have high reproductive potential, and a female can lay a batch of thousands of eggs. This may influence their population density and distribution and the likelihood of tick-borne pathogen transmission to humans and animals.

DNA methylation is important during the development of ticks. In the sheep tick, Ixodes ricinus, the 5mC and 6 mA DNA methylation were presented at all life stages, and key DNA methylation enzymes (IrDNMT1, IrDNMT3, and IrDAMT) were identified through transcriptomic and bioinformatic analysis, which suggested that DNA methylation is crucial for tick physiology and transstadial development [19]. In the blacklegged tick, Ixodes scapularis, cytosine methylation in CpG islands was confirmed in both females and males [20]. Additionally, when treated with the methylation-sensitive restriction enzyme HpaII, the presence of long stretches of genomic DNA in the I. scapularis genome, indicating significant methylation [21]. Despite this, questions remain on the functional contribution of DNA methylation during the feeding and development of ticks, especially, its relative expression in the different life stages of the Mestastriata group of the hard ticks.

The Asian longhorned tick, Haemaphysalis longicornis, is widely distributed in East Asia, Australia, and New Zealand, and it has recently established a population in North America [22]. It can transmit more than 30 zoonotic pathogens, including severe fever with thrombocytopenia syndrome virus (SFTSV), Anaplasma phagocytophilum, Ehrlichia chaffeensis, Rickettsia raoultii and Babesia microti, which are a threat to human health, livestock production, and wild animals [23]. Recently, we characterized DNA methyltransferase genes including HlDnmt1 and HlDnmt from H. longicornis [24] and suggested that they may play important roles in the cold response of H. longicornis, providing functional insights into DNA methylation in the regulation of tick acclimatization and adaptation to cold environment [24].

In the present study, the expression dynamics of HlDnmt1 and HlDnmt were determined during feeding and development of H. longicornis. The functions and regulatory mechanisms of HlDnmt1 and HlDnmt were explored using RNA interference and transcriptomic sequencing, in the hoping of shed light on the regulatory role of DNA methylation in the feeding and development of ticks, and provide important clues for the subsequent control of ticks and tick-borne diseases.

Materials and methods

Tick collection and maintenance

The unfed adult male and female ticks of H. longicornis were collected by the flag-dragging in Xiaowutai National Nature Reserve (114°47’-115°30’E, 39°50’-40°07’N), Zhangjiakou, Hebei Province, China. The collected ticks were placed in a centrifuge tube and brought back to the laboratory. During the non-parasitic period, ticks were maintained in a laboratory incubator (26 ± 1 ℃, relative humidity 75 ± 5%, 16 h of light: 8 h of darkness. For blood feeding, they were placed in a cloth bag and taped on the ears of the New Zealand white rabbits [25]. All the ticks used in subsequent tests were selected from second-generation cohorts obtained from the laboratory. All experiments involving rabbits were approved by the Animal Ethics Committee of the Hebei Normal University (Protocol Number: IACUC-220369).

RNA extraction and real-time quantitative PCR (qPCR)

Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. Briefly, 0.1 g of eggs, 100 larvae, 50 nymphs, and 20 adult females were randomly selected and washed sequentially with sterilized ddH₂O and 75% ethanol to remove surface impurities. After drying with filter paper, the samples were placed in a liquid nitrogen chilled mortar, ground into a powder under liquid nitrogen, and combined with TRIzol as an extraction reagent. RNA quantification was carried out using a NanoDrop R ND-1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) with a typical A260/A280 ratio above 2.0. The quality and integrity of RNA were assessed using 1% agarose gel electrophoresis.

For the cDNA synthesis, 2.0 µg of each extracted RNA was used in a 20.0 µL reaction volume with an oligo (dT)18 primer, and reverse transcription was performed under the PCR conditions of 42 ℃ for 30 min, 85 ℃ for 5 s, to synthesize cDNA following the instructions provided with the TransScript R One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech Co., Ltd, Beijing, China). The real-time PCR assays were carried out in a volume of 20.0 µL including 10 µL of 2×TransStart^® Top Green qPCR SuperMix, 1.0 µL of cDNA template, 0.4 µL of each forward and reverse gene-specific primers (Table 1), 0.4 µL of passive reference DyeII, and 7.8 µL of RNase-free H₂O. The PCR conditions were set at 94℃ for 30 s, followed by 40 cycles of 94℃ for 5 s, 60℃ for 30 s, 64℃ for 5s, and a final 95℃ for 35 s. Each sample was assessed in triplicate. β-actin was used as the reference gene. The relative expressions of the HlDnmt1 and HlDnmt were calculated by a 2^−∆∆T method [26, 27]. Each of the three independent samples was subjected to qPCR in triplicate. Statistical analysis was conducted using one-way ANOVA, followed by Tukey’s post hoc test for multiple comparisons (p < 0.05), utilizing GraphPad Prism 9.0.5 software (GraphPad Software Inc., La Jolla, CA, USA).

Table 1.

Primers of HlDnmt1 and HlDnmt in H. Longicornis

Assays	Gene	Primer sequence (5’-3’)
qPCR	HlDnmt1	F: GTGGCTGATGAAGGCAAAGA
		R: CGGCAGAGTTCAAGCAGGT
	HlDnmt	F: TCGTCAATGAATGCGAGAACC
		R: AGAACGACTTGCCGTCATCATC
	β-actin	F: CGTTCCTGGGTATGGAATCG
		R: TCCACGTCGCACTTCATGAT
RNAi	HlDnmt1	F: CAACACCCCTGAAGTTAGCAA
		R: TCAGCCACTCTTCGCCAA
	HlDnmt	F: TCGCCAAGTTCACGGAGGA
		R: TGCCGCCAAACTTCACCAT

Synthesis of double-strand RNA (dsRNA) and RNA interference

The synthesis of dsRNA was performed as previously described [24]. Briefly, oligonucleotide primers (Table 1) comprising T7 promoter sequences (5’-GGATCCTAATACGACTCACTATAGG-3’) at the 5’ end were used to amplify double-strand RNA (dsRNA) of HlDnmt1 and HlDnmt. In vitro dsRNA synthesis was carried out in a volume of 40 µL including 20 µL of 2×TS MasterMix (Dye), 1 µL of Reverse primer, 1 µL of T7-Forward primer, 2 µL of cDNA and 16 µL of RNase-free water. After the reaction, the dsRNA pellet was resuspended in diethylpyrocarbonate (DEPC)-treated water. The concentration and quality of dsRNA were determined as described above, and the concentration of dsRNA was adjusted to 3000 ng/µL, 5000 ng/µL, and 7000 ng/µL, then stored at − 80^◦C until use.

For microinjection, 20 unfed female ticks were randomly selected from the experimental and control groups. After surface sterilization, the ticks were fixed on a petri dish with double-sided adhesive tape, with the ventral surfaces facing upward. The injection was carried out under a microscope using 10 µL Microliter™ Syringes (Hamilton, Nevada, USA), and 1 µL of dsRNA (3000 ng/µL, 5000 ng/µL, 7000 ng/µL) of HlDnmt1 or HlDnmt was injected into unfed female ticks through the third and fourth coxa. The control group was injected with 1 µL of RNase Free Water. Then, ticks were allowed to recover in a laboratory incubator (temperature 26 ± 1℃, relative humidity 75 ± 5%, 16 h of light: 8 h in darkness) for 24 h as described previously [24]. Subsequently, qPCR was used to evaluate the relative expression levels of HlDnmt1 and HlDnmt to verify the gene silencing efficiency.

Feeding of ticks after RNAi

After confirming the knockdown of HlDnmt1 and HlDnmt 24 h post microinjection, groups of ticks (40 females and 20 males in each group) were inoculated into the ears of the rabbits for feeding as described above. One ear was inoculated with ticks from the experimental group (injected with different concentrations of dsRNA), whereas the other ear was inoculated with ticks from the control group (injected with RNase-Free Water). Each treatment was assayed in triplicate. After 24 h, the bite rate was calculated as follows:

Bite rate = number of bites/total number of females.

Library construction and transcriptomic sequencing

After confirming the knockdown of HlDnmt1 and HlDnmt, total RNA was extracted using TRIzol as described above. Ticks injected with RNase-Free Water served as the control group (CG), and those injected with 3000 ng/µL, 5000 ng/µL, and 7000 ng/µL dsRNA of HlDnmt1 were named D1A, D1B, and D1C, respectively. Groups injected with 3000 ng/µL, 5000 ng/µL, and 7000 ng/µL of dsRNA of HlDnmt were named DA, DB, and DC, respectively. For library construction, poly A-containing mRNA in total RNA was converted into a cDNA library using oligo-dT magnetic beads. Following mRNA purification, the RNA was fragmented before reverse transcription to generate cDNA. Then a single “A” base to the 3′ end was added for the ligation of Illumina adapters. Finally, the products were purified and enriched with PCR to create the final double-stranded cDNA library, using NEBNext^® Ultra™ RNA Library Prep Kit for Illumina^®. Sequencing was performed on the library using an Illumina NovaSeq 6000 (Illumina, USA). Four fluorescently labeled dNTPs, DNA polymerase, and adapter primers were added to the sequencing flow cytometer for amplification. CASAVA base recognition was used to convert sequenced fragments into reads. To ensure data quality and reliability, raw reads were filtered to remove adapters and low-quality reads. Clean data were concatenated using Trinity software [28], and spliced transcripts were evaluated for quality using BUSCO software. Unigenes were annotated using databases including NR (Non-Redundant Protein Database), COG (Clusters of Orthologous Groups), KOG (Eukaryotic Orthologous Groups), and KEGG (Kyoto Encyclopedia of Genes and Genomes) using the DIAMOND software.

Differential expression analysis

For differential expression analysis, different conditions/groups (three biological replicates per condition) were performed using the DESeq2 R package (1.20.0). The resulting P-values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate. Genes with an adjusted P-value ≤ 0.05 found by DESeq2 were assigned as differentially expressed.

GO and KEGG enrichment analysis of differentially expressed genes

Gene Ontology (GO) enrichment analysis of differentially expressed genes was implemented by the clusterProfiler R package, in which gene length bias was corrected. GO terms with corrected P-values less than 0.05 were considered significantly enriched by differentially expressed genes (DEGs). The clusterProfiler R package was used to test the statistical enrichment of differential expression genes in KEGG pathways.

Results

The spatio-temporal expression of HlDnmt1 and HlDnmt during feeding and development of H. longicornis

The expression of HlDnmt1 and HlDnmt exhibited significant variations across four developmental stages, with the highest levels observed in the larvae (Fig. 1A). Specifically, HlDnmt1 expression was significantly elevated in larvae compared to eggs (p < 0.05). However, HlDnmt1 levels in nymphs and adults were significantly downregulated compared to larvae (p < 0.05). Similarly, the expression of HlDnmt in nymphs and adults was significantly lower compared to eggs and larvae (p < 0.05). These findings highlight the importance of HlDnmt1 and HlDnmt during larval development and suggest their diminishing roles as the tick progresses through later stages.

Fig. 1.

Developmental and feeding-stage dependent expression of HlDnmt1 and HlDnmt in Haemaphysalis longicornis A: Developmental stages; B-D: Different feeding statuses of larvae, nymphs and adults; E: Different days after larvae engorgement and nymphs engorgement. (Different letters indicate significant differences p < 0.05)

In the context of feeding, increased expression of HlDnmt1 and HlDnmt was observed in unfed larvae and nymphs; however, the level of expression decreased significantly (p < 0.05) during the feeding process (Fig. 1B, C). Notably, in adults, HlDnmt1 expression increased and reached its highest-level during engorgement. The expression of HlDnmt varied significantly during feeding, with a decrease appearing on 2nd day of feeding, reaching the peak rapidly before mating, and then gradually decreasing (p < 0.05) (Fig. 1D). These feeding-dependent variations in gene expression suggested that HlDnmt1 and HlDnmt are tightly regulated during feeding.

Following engorgement, expression levels of HlDnmt1 and HlDnmt varied significantly at different time points (1, 3, 5, 7, and 9 days) post-engorgement in larvae, with the highest expression observed on the 3rd day after engorgement (Fig. 1E). Moreover, the expression of HlDnmt showed slightly increase and then decreased with time in larvae. In nymphs, the expression of HlDnmt1 increased from 1 to 7 days and significantly decreased at 9 days after engorgement (Fig. 1F). For HlDnmt, significantly different expression levels were also observed. The highest expression was observed on 1st day after nymph engorgement, then the expression decreased significantly, and remained at a low level until the 9th day, when it reached the lowest value (Fig. 1F). The above results indicated that the involvement of both HlDnmt1 and HlDnmt may be critical for successful molting and development.

After adult female engorgement, the highest expression levels of both HlDnmt1 and HlDnmt were observed in the ovaries (Fig. 2A). As feeding progressed, the expression of HlDnmt1 increased significantly (p < 0.05) and reached its highest level in the ovaries after female mating, followed by a decrease after engorgement (Fig. 2B). For HlDnmt, decreased expression was observed as feeding progressed, with the lowest expression levels detected before mating and engorging (Fig. 2B). The temporal regulation of HlDnmt and HlDnmt1 implied that HlDnmt may play significant role in the early stages of feeding, whereas HlDnmt1 functions mainly during mating and the early phases of ovary development.

Fig. 2.

Tissue-Specific expression of DNA methyltransferase genes in different tissues of adult Haemaphysalis longicornis A: The tissue distribution of HlDnmt1 and HlDnmt B: The relative expression of HlDnmt1 and HlDnmt in the ovary of adults at different feeding statuses (Different letters indicate p < 0.05)

The function of HlDnmt1 and HlDnmt during feeding of H. longicornis

After RNAi, the relative expression of HlDnmt1 and HlDnmt was detected by qPCR to verify the knockdown efficiency. Compared to the control group, the relative expression of HlDnmt1 and HlDnmt was found to be significantly decreased after RNAi at different concentrations (p < 0.05). Expression was downregulated by 47.67%, 55.13%, and 77.36% after interference with 3000, 5000, and 7000 ng/µL of dsHlDnmt1, respectively. The expression was downregulated by 39.77%, 57.25%, and 82.30% after interference with 3000, 5000, and 7000 ng/µL of dsHlDnmt, respectively (Fig. 3A). The above results indicated that they were effectively knocked down.

Fig. 3.

RNA interference efficiency of DNA methyltransferase gene in Haemaphysalis longicornis. A: RNAi efficacy B: Effect of RNAi on the bite rate (Different letters indicate p < 0.05)

After confirming the knockdown of HlDnmt1 and HlDnmt, the bite rates were calculated. The results showed that after injection with 3000, 5000, and 7000 ng/µL of dsHlDnmt1 and dsHlDnmt, the biting rate of H. longicornis decreased sequentially, and reached the lowest level after injection with 7000 ng/µL of dsRNA (p < 0.05) (Fig. 3B). The failure of attachment strengthened their important functions during tick-host interactions.

The identification of differentially expressed genes (DEGs) using RNA-seq

A total of 147.3Gb clean data were obtained by transcriptomic sequencing, and the clean bases of each sample reached more than 6.0 Gb, with Q20 higher than 97% (Table S1). The raw data have been deposited into Sequence Read Archive (SRA) of NCBI under PRJNA1064392. The Pearson correlation coefficient between the three biological replicates of the seven groups in this study has high repeatability (i.e., all R² ≥ 0.84; Fig. S1). Co-expression Venn diagrams found that a total of 13,491 genes were shared among the four groups after treatment with different concentrations of dsHlDnmt1 (Fig. 4A). Similarly, 13,491 genes were shared after treatment with different concentrations of dsHlDnmt (Fig. 4B).

Fig. 4.

The Venn diagram shows the shared and unique genes of DEGs that were statistically analyzed. A: Knockdown of HlDnmt1; B: Knockdown of HlDnmt (CG: Injection of RNase-Free Water, D1A: Injection of 3000 ng/µL dsHlDnmt1, D1B: Injection of 5000 ng/µL dsHlDnmt1, D1C: Injection of 7000 ng/µL dsHlDnmt1, DA: Injection of 3000 ng/µL dsHlDnmt, DB: Injection of 5000 ng/µL dsHlDnmt, DC: Injection of 7000 ng/µL dsHlDnmt)

The DESeq2 package was used for differential expression analysis, with the criteria set as: log2 fold change ≥ 1 and Q value ≤ 0.05 (Fig. S2), and filter with P-value < 0.05 and |logFC| > 1. These DEGs were visualized using a volcano plot to understand the distribution of up and downregulated genes (Fig. 5). For D1A vs. CG, a total of 1,371 DEGs were identified, with 552 upregulated and 819 downregulated (Fig. 5A). For D1B vs. CG, 2,097 DEGs were identified, with 1,033 upregulated and 1,064 downregulated (Fig. 5B). Similarly, for D1C vs. CG, 2,345 DEGs were identified, with 1,101 upregulated and 1,244 downregulated (Fig. 5C). For DA vs. CG, 1,394 DEGs were identified, with 692 upregulated and 702 downregulated (Fig. 5D). A total of 2,582 DEGs were identified for DB vs. CG, including 1,454 upregulated and 1,128 downregulated genes (Fig. 5E). For DC vs. CG, 1,620 significant DEGs were identified, with 690 upregulated and 930 downregulated genes (Fig. 5F).

Fig. 5.

Volcano map of DEGs after knockdown of HlDnmt1 and HlDnmt in Haemaphysalis longicornis. A: D1A vs. CG; B: D1B vs. CG; C: D1C vs. CG; D: DA vs. CG E: DB vs. CG; F: DC vs. CG. Red dots represent upregulated genes, green dots represent downregulated genes, and blue dashed lines represent differential gene screening criteria

GO enrichment and KEGG pathway analysis of DEGs

According to the corrected P-value, the top 30 most enriched GO terms were selected in each category. Most DEGs were enriched in the molecular function and cellular component categories. Under the treatment of 3000 ng/µL dsHlDnmt1 (D1A vs. CG), the molecular functions of the DEGs were mainly related to serine endopeptidase activity, peptidase activity, and oxidoreductase activity. In the D1B vs. CG and D1C vs. CG comparisons, the molecular functions were mainly related to heme binding, transferase activity, and oxidoreductase activity. Under the dsRNA treatment of HlDnmt, the DEGs were enriched in both the molecular function and cellular component categories. In the DA vs. CG and DB vs. CG comparisons, the molecular functions of the DEGs were mainly related to the extracellular space, peptidase activity, and heme binding. In the DC vs. CG, the DEGs were enriched in hydrolase activity, oxidoreductase activity, and serine peptidase activity (Fig. S3).

During KEGG pathway enrichment analysis, a padj (P-value corrected for multiple hypothesis testing) of less than 0.05 was used as the threshold for significant enrichment. The top 20 most significant KEGG pathways from the enrichment results were selected to create a scatter plot. Results showed that the significantly enriched pathways in the three groups (D1A vs. CG, D1B vs. CG, and D1C vs. CG) included lysosome, galactose metabolism, and glycosaminoglycan degradation (Fig. 6A, B, C). In comparisons between DA and CG, DB and CG, and DC and CG, DEGs were significantly enriched in the lysosome, fatty acid biosynthesis, and glycosaminoglycan degradation pathways (Fig. 6D, E, F). Among these, the lysosome pathway had the largest number of differentially enriched genes.

Fig. 6.

KEGG enrichment of DEGs after knockdown of HlDnmt1 and HlDnmt in Haemaphysalis longicornis. A: D1A vs. CG; B: D1B vs. CG; C: D1C vs. CG; D: DA vs. CG E: DB vs. CG; F: DC vs. CG. Note: In the figure, the abscissa is the ratio of the number of differential genes annotated to the KEGG pathway to the total number of differential genes, and the ordinate is the KEGG pathway

Through KEGG enrichment analysis, pathways significantly enriched in upregulated or downregulated differential genes were identified to further understand the regulatory function of DNA methyltransferase genes on the blood-feeding process of H. longicornis. The analysis showed that the upregulated genes were mostly enriched in pathways related to protein processing, fatty acid biosynthesis, fatty acid metabolism, and glutathione metabolism (padj < 0.05). The downregulated genes were significantly enriched in pathways such as lysosome, other glycan degradation, glycosaminoglycan degradation, and glycosphingolipid biosynthesis (padj < 0.05) (Tables S2 and S3).

Lysosomal signaling pathways associated with the functions of HlDnmt1and HlDnmt

Under treatment with different concentrations of dsHlDnmt1 and dsHlDnmt, the lysosomal metabolic pathway in H. longicornis was significantly downregulated. After dsRNA injection of HlDnmt1 at 7000ng/µL, a total of 18 KEGG nodes were associated with lysosomal pathways, involving 53 genes (Fig. 7; Table 2). Among them, KEGG nodes encoding glycosidases were the most abundant, with six nodes (all downregulated). There are three KEGG nodes encoding minor lysosomal membrane proteins (including three downregulated gene nodes); In addition, there are two KEGG nodes (including two downregulated gene nodes) encoding proteases, two KEGG nodes (including two downregulated gene nodes) encoding sulfatases, and one KEGG nodes (including one upregulated gene node) encoding sphingomyelinase. One KEGG node (including one downregulated gene node) encodes sulfatases, lipases, nucleases, phosphatases, aspartylglucosaminidase and other lysosomal enzymes and activators (Fig. 7A).

Fig. 7.

Metabolic pathway diagram of lysosome and autophagy pathways of DEGs after knockdown of HlDnmt1 and HlDnmt in Haemaphysalis longicornis. The KEGG nodes marked with red borders contain upregulated genes, the KEGG nodes marked with green borders contain downregulated genes. A: D1C vs. CG B: DC vs. CG

Table 2.

Differentially expressed genes of the autophagy and lysosome pathways

Group	List of differentially expressed genes
D1CvsCG	Upregulated gene: sphingomyelin: phosphodiesterase 1(SMPD1)
	Downregulated genes: proteases: cathepsin, legumain (LGMN) Glycosidases: beta-galactosidase (GLB), alpha-glucosidase (GAA), glucosylceramidase (GBA), L-iduronidase (IDUA), hexosaminidase (HEXA/B), lysosomal alpha-mannosidase (LAMAN) Sulfatases: N-sulfoglucosamine sulfohydrolase (SGSH) Lipases: lysosomal acid lipase (LIPA) Nuclease: deoxyribonuclease II (DNase II) Phosphatase: lysosomal acid phosphatase (ACP2) Aspartylglucosaminidase: N4-(beta-N-acetylglucosaminyl)-L-asparaginase (AGA) Other lysosomal enzymes and activators: sphingolipid activator protein (saposin) Minor lysosomal membrane protein: niemann-pick protein C (NPC), lysosomal acid phosphatase (ACP2), sialin
DCvsCG	Downregulated genes: proteases: cathepsin, legumain (LGMN) Glycosidases: glycosidases: beta-galactosidase (GLB), L-iduronidase (IDUA), beta-mannosidase (MANB) Sulfatases: iduronate-2-sulfatase (IDS), N-sulfoglucosamine sulfohydrolase (SGSH) Lipases: lysosomal acid lipase (LIPA) Nuclease: deoxyribonuclease II (DNase II) Phosphatase: lysosomal acid phosphatase (ACP2) Sphingomyelin: phosphodiesterase 1(SMPD1) Minor lysosomal membrane protein: niemann-pick protein C (NPC), sialin, lysosomal acid phosphatase (ACP2)

After dsRNA injection of HlDnmt at 7000 ng/µL, a total of 14 KEGG nodes related to lysosomal pathways were identified, involving 50 genes. The most enriched KEGG nodes encoding glycosidases including three nodes in total (all downregulated gene nodes). There are three KEGG nodes encoding minor lysosomal membrane proteins were downregulated. In addition, there are two KEGG nodes each for proteases and sulfatases (all downregulated), whereas one KEGG node (including one downregulated gene node) encodes lipases, nucleases, nuclease, phosphatase, and aspartylglucosaminidase (Fig. 7B).

Discussion

DNA methylation modulates gene expression and regulates the developmental processes of arthropods, from egg production to embryonic development [6, 29]. As obligate hematophagous arthropods, most ticks experience complex life cycles, including short periods on-host (feeding/blood-sucking) and long periods off-host (development) [30]. Therefore, in the present study, the relative expression of DNA methyltransferases (HlDnmt1 and HlDnmt) during the feeding and development of H. longicornis was determined, and the underlying mechanism of transcriptomic changes after knockdown of HlDnmt1 and HlDnmt were explored.

The significant variations in the expression patterns of HlDnmt1 and HlDnmt across the developmental stages of H. longicornis underscore the dynamic regulatory mechanisms underlying epigenetic modifications in ticks. HlDnmt1 was found downregulated in nymphs and adult ticks, and that HlDnmt1 was upregulated in larvae compared with eggs, with the larval stage showing the highest expression levels of both genes. This indicates that they are actively involved in DNA methylation processes during early developmental stages and play an important role in the growth and development of the larval stage, which might be due to the chromatin remodeling. Chromatin remodeling often involves moving nucleosomes and modifying histones, which can impact gene activity and genome stability [31]. Similarly, studies on Manduca sexta have shown that the expression of differentially methylated genes associated with the RNA interference pathway decreases from larvae to adults, indicating that RNA-dependent regulation may be more crucial in larvae than adults [32]. Furthermore, differences were observed in DNA methylation levels between diapause-destined and diapause-terminated eggs in B. mori, particularly at CG sites. KEGG analysis indicates that DNA methylation positively affects embryonic development and diapause by regulating pathways such as cell differentiation, metabolism, apoptosis, and phosphorylation [33]. Further evidence suggests that DNA methylation within genes regulates ovarian and embryonic development of B. mori by enhancing gene expression through 5’ UTR methylation, recruiting MBD2/3 and acetyltransferase Tip60, leading to histone H3K27 acetylation, ultimately affecting fertility [34]. In addition, various epigenetic modification enzymes (EMEs), including DNMTs, exhibit significant expression in early developmental stages in B. mori. Specifically, these enzymes were highly expressed in embryos, as well as in the head and internal genitalia of larvae, suggesting a vital role in early embryonic development and larval stages [35]. In honeybee, Apis mellifera, DNA methyltransferases, particularly Dnmt1, are most highly expressed in embryos. This high expression and methylation level are essential for the maintenance of DNA methylation patterns during early development [36, 37]. In German cockroach, Blattella germanica, RNAi of DNA methyltransferase 1 (DNMT1) reduces DNA methylation and impairs blastoderm formation, with methylated genes associated with metabolism showing high expression, and unmethylated genes related to signaling showing low expression [29].

The developmental stage-specific expression of DNMTs has been reported in many insect species during development [38]. For example, the expression of BmDnmt1 in B. mori showed a sharp decrease from egg to first instar, and the expression increased sharply from fifth instar to adult, with the highest expression observed in the eggs [39]. TaDnmt1 was differentially expressed in different development stages of Tuta absoluta, among which the expression in the adult stage and the first and second instars was significantly higher than in the other stages, and the expression in male adults was significantly higher than in female [40]. In Solenopsis invicta, Dnmt1 and Dnmt3 exhibit distinct expression patterns: Dnmt3 is most highly expressed during embryonic development, whereas Dnmt1 is similarly expressed throughout development [41]. In oriental armyworm, Mythimna separata, MsDnmt1 was found highly expressed in the adult stages, and much lower expression was found during the larval stages [42]. The Nlu-Dnmt1 in the brown planthopper, Nilaparvata lugens, was highly expressed in female adults [43]. However, differences in the expression of DNA methyltransferases have only been demonstrated in the life stages of I. ricinus ticks [19]. In the present study, DNMTs were found expressed at different levels across all developmental stages. HlDnmt1 expression was significantly elevated from eggs to larvae, and downregulated in nymphs and adults, whereas HlDnmt in nymphs and adults was significantly lower compared to eggs and larvae. The varied expression levels suggest that they may play important roles in epigenetic regulation of post-embryonic development, which may be potentially influenced by factors such as environmental conditions, hormonal changes, or the metabolic demands of different life stages [44]. However, the protein expression was unfortunately not confirmed in the current study, which might hamper pinpointing the functional implications of DNMTs in ticks. Future studies should aim to investigate both gene and protein expression levels to provide a more comprehensive understanding of the functional roles of DNMTs in H. longicornis and other tick species.

Blood is the only source of nutrition for ticks, and ticks undergo a series of physiological and biochemical changes during the transition from unfed to engorgement [45]. In the larvae and nymphs of H. longicornis, the expression of HlDnmt1 and HlDnmt decreased significantly from unfed to engorgement. Specifically, the expression of HlDnmt1 and HlDnmt decreased significantly (p < 0.05) from the unfed to engorgement in nymphs, which suggested the DNA methylation may play a key role during tick feeding and molting. As in the Lepidoptera, DNA methylation has been shown to contribute to the regulation of Atg8 during metamorphosis [32, 46]. Juvenile hormones and ecdysone are crucial regulators in insect development, and studies have also found that the corresponding genes are regulated by histone acetylation and deacetylation [47].

In adults, the expression of HlDnmt1 increased during feeding and reached its highest level when the females engorged. In contrast, HlDnmt displayed fluctuating expression from unfed to engorged and reached its peak before mating in female H. longicornis. Interestingly, this expression patterns resembled that of the IrDNMT1 gene, which encodes a methylation maintenance enzyme in I. ricinus. It was noted that the expression level of IrDNMT1 was significantly lower in fed females compared to unfed females [19]. Additionally, HlDnmt shares the common domains, BAH and Zf-CXXC, with the IrDNMT1 gene [19]. The expression of HlDnmt1 and HlDnmt showed different trends after engorgement of the larvae and nymphs. These findings suggest the functional divergence of HlDnmt1 and HlDnmt during feeding and mating in adult H. longicornis. This divergence may be attributed to the regulatory roles of the DMAP1 and SANT domains in HlDnmt1, which potentially influences the gene expression during feeding and mating, whereas the BAH domain in HlDnmt may affect its expression dynamics through interactions with chromatin or other regulatory proteins [24]. Furthermore, it has been shown to influence the expression of several tick genes [48, 49]. Such domain-specific functions underscore the intricate regulatory mechanisms involving DNA methyltransferases in H. longicornis.

The tissue-specific expression of DNA methyltransferases has been observed in many insect species. For example, DNMT1 tended to be expressed at higher levels in reproductive tissues than in other tissues in the termite Reticulitermes speratus [50]. Both Dnmt1 and Dnmt2 showed gregarious-abundant expression in the testes but solitarious-abundant expression in the brains of the desert locust Schistocerca gregaria [51]. In the current study, HlDnmt1 and HlDnmt showed tissue-specific expression, with the highest expression appearing in the ovary of the unfed adult H. longicornis, followed by Malpighian tubules and salivary glands, and the lowest expression was observed in the midguts. Ovaries play a crucial role during tick reproduction and the transovarial transmission of tick-borne pathogens [52]. Hence, the high levels of expression in the ovary may suggest their potential role in reproduction and pathogen transmission [37]. However, HlDnmt1 and HlDnmt showed different expression trends in the ovaries of female H. longicornis at different feeding stages. The expression of HlDnmt1 in the ovary reached its highest level after mating when the females entered the rapid feeding stage and remained high until engorgement, whereas the expression of HlDnmt was the highest in the unfed females and gradually decreased until engorgement. However, the specific regulatory mechanisms require further investigation.

Tick blood meal digestion occurs intracellularly, requiring the nutrients in the blood meal to be absorbed into the digestive cells. This absorption is primarily accomplished through fluid phase endocytosis (FPE) and receptor-mediated endocytosis (RME), where lysosome play a critical role [53]. Lysosomes are cystic, single-layered membrane organelles that maintain cellular homeostasis by decomposing aging and damaged organelles, as well as by engulfing and killing invading viruses or bacteria. After RNAi, the relative expression levels of HlDnmt1 and HlDnmt were significantly reduced, resulting in a significant decrease in the bite rate of female H. longicornis. The possible mechanisms were further explored using RNA-seq analysis, which revealed many DEGs. A similar phenomenon was also observed in the wasp Nasonia vitripennis, with a widespread disruption of gene expression detected after Nv-Dnmt1a knockdown [54]. After dsRNA injection of HlDnmt1 and HlDnmt at 7000 ng/µL, sphingomyelin phosphodiesterase 1 (SMPD1) was found to be significantly upregulated. Sphingomyelin phosphodiesterase catalyzes the hydrolysis of sphingomyelin to produce ceramide and phosphorylcholine, playing a crucial role in sphingolipid metabolism and cellular signaling pathways. Therefore, when the DNA methyltransferase gene is knocked down, the high expression of SMPD1 suggests a possible link between DNA methylation and sphingolipid metabolic pathway [55]. The C-type Niemann-pick protein 2 (NPC2) is a small lysosomal glycoprotein that participates in the binding and recognition of various chemical signals and may serve as a semiochemical carrier in arthropods [56]. After interference with HlDnmt1 and HlDnmt, NPC2 expression was significantly downregulated, which might disrupt H. longicornis for biting, resulting in low bite rates. Meanwhile, hemoglobin digestion is mainly achieved through the aspartic and cysteine peptidases in a concerted manner [57]. The low aspartic and cysteine peptidases after RNAi of HlDnmt1 and HlDnmt may also affect the feeding and development of H. longicornis. Similarly, the downregulated expression of important proteases such as cathepsin B (cathepsin) and cysteine protease (LGMN) in the lysosomal pathway results in the dysfunction of tick cells and affects the process of tick blood-sucking. The lysosomal pathway is related to the autoimmune defense mechanism of H. longicornis. Hence, it is speculated that HlDnmt1 and HlDnmt may play important roles in the feeding and development of ticks through the lysosome and autophagy pathways. However, the underlying mechanisms require further investigation.

Conclusions

In this study, we evaluated the spatiotemporal expression of HlDnmt1 and HlDnmt during blood feeding and development of H. longicornis and explored the function and underlying mechanism of these genes. The expression of HlDnmt1 and HlDnmt varied significantly at the four developmental stages and showed different expression trends in different tissues. After RNAi, the relative expression of HlDnmt1 and HlDnmt in H. longicornis decreased significantly, and the bite rate of H. longicornis decreased significantly. RNA-seq showed that the differentially expressed genes were mainly enriched in the lysosomal and autophagy pathways. These results provide basic knowledge for understanding the epigenetic regulation of ticks and shed light on control strategies for ticks and tick-borne diseases.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

ZJY conceived the study, designed the experiments and wrote the manuscript. TWP, XYS performed the experiments, analyzed the data and drafted the paper. CFN, ZYB, ZWG, JLM, and LL participated in the implementation of the study. JZL designed the experiments and critically revised the manuscript.

Funding

This work was funded by the Natural Science Foundation of China (32071510), the Youth Top Talent Support Program of Hebei Province to ZY (2018–2023), and the Foundation of Science and Technology Project of Hebei Education Department (ZD2022008).

Data availability

Data will be made available on request. The raw data have been deposited into SRA of NCBI under PRJNA1064392.

Declarations

Ethics approval and consent to participate

All experiments involving rabbits were approved by the Animal Ethics Committee of the Hebei Normal University (Protocol Number: IACUC-220369).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.