m6A demethylase FTO transcriptionally activated by SP1 improves ischemia reperfusion‐triggered acute kidney injury by activating Ambra1/ULK1 ‐mediated autophagy

Abstract

Ischemia reperfusion (I/R) was considered as one of main causes of acute kidney injury (AKI). However, the exact mechanism remains unclear. Here, this study aimed to investigate the role and mechanism of the m6A demethylase fat mass and obesity‐associated (FTO) protein in I/R‐induced AKI. HK‐2 cells and SD rats were utilized to establish hypoxia/reoxygenation (H/R) or I/R induced AKI models. The changes of RNAs and proteins were quantified using RT‐qPCR, western blot, and immunofluorescence assays, respectively. Cell proliferation and apoptosis were assessed by CCK‐8 and flow cytometry. Interactions between molecules were investigated using RIP, ChIP, Co‐IP, RNA pull‐down, and dual luciferase reporter assays. Global m6A quantification was evaluated by kits. TUNEL and HE staining were employed for histopathological examinations. Oxidative stress‐related indicators and renal function were determined using ELISA assays. The FTO expression was downregulated in H/R‐induced HK‐2 cells and renal tissues from I/R‐induced rats. Overexpression of FTO improved the cell viability but repressed apoptosis and oxidative stress in H/R‐treated HK‐2 cells, as well as enhanced renal function and alleviated kidney injury in I/R rats. Notably, the FTO overexpression significantly increased autophagy‐related LC3 and ULK1 levels. When autophagy was inhibited, the protective effects of FTO in AKI were diminished. Notably, Ambra1, a crucial regulator of autophagy, was repressed in H/R‐induced HK‐2 cells. However, the FTO overexpression restored the Ambra1 expression by reducing m6A modification of its mRNA. SP1, acting as an upstream transcription factor, directly interacts with the FTO promoter to enhance FTO expression. Knockdown of SP1 or Ambra1 suppressed the beneficial effects of FTO upregulation on autophagy and oxidative stress injury in H/R‐stimulated cells. FTO, transcriptionally activated by SP1, promoted autophagy by upregulating Ambra1/ULK1 signaling, thereby inhibiting oxidative stress and kidney injury. These findings may provide some novel insights for AKI treatment.

A graphical diagram of the mechanism by which FTO promotes autophagy in AKI. SP1 activates the transcription of FTO, which enhances the signaling of Ambra1/ULK1 and promotes autophagy. This process helps inhibit oxidative stress injury and protects against RIRI, potentially offering innovative approaches for treating AKI.

Abbreviations

AKI

acute kidney injury

Ambra1

autophagy/Beclin1 regulator 1

BUN

blood urea nitrogen

CCK‐8

Cell counting Kit‐8

ChIP

chromatin immunoprecipitation

CKD

chronic kidney disease

Co‐IP

co‐immunoprecipitation

Cr

creatinine

CST

Cell Signaling Technology

ELISA

enzyme‐linked immunosorbent assay

FTO

fat mass and obesity‐associated protein

H/R

hypoxia/reoxygenation

HE

hematoxylin and eosin

I/R

ischemia reperfusion

IF

immunofluorescence (IF)

m6A

N6‐methyladenosine

MeRIP

methylated RNA immunoprecipitation

PI

propidium iodide

RIP

RNA immunoprecipitation

RIRI

renal ischemia reperfusion injury

ROS

reactive oxygen species

SD

standard deviation

SP1

specificity protein 1

TUNEL

terminal deoxynucleotidyl transferase–mediated dUTP nick‐end labeling

1. INTRODUCTION

Acute kidney injury (AKI) is a clinical syndrome characterized by a rapid decline in renal function caused, resulting in reduced nitrogen metabolism (urea and creatinine) and/or urine volume. AKI is a risk factor for the development of chronic kidney disease (CKD) and end‐stage renal disease. ¹ Ischemia reperfusion (I/R) refers to the phenomenon where renal damage is exacerbated and renal function deteriorates upon the restoration of blood perfusion to an ischemic kidney, which is the most common cause of AKI. ² At present, the treatment of renal I/R injury primarily focuses on symptomatic and supportive measures, lacking specific treatment options. ³ Therefore, there is significant clinical significance in exploring novel approaches for the treatment of renal I/R injury. Renal I/R injury is a complex and multifactorial pathophysiological process involving free radicals, calcium overload and energy metabolism dysfunction. ⁴ Oxidative stress injury plays a key role in the pathophysiological process of renal I/R injury. ⁵ It has been confirmed that excessive production of reactive oxygen species (ROS) damage renal tissue through various mechanisms, including inflammatory response and mitochondrial dysfunction. ⁶ , ⁷ Therefore, targeting anti‐oxidative stress injury can serve as an effective strategy for managing renal I/R injury.

RNA methylation is a novel epigenetic modification that plays a role in regulating various biological processes, including immune response, tumor metastasis, cell differentiation and division. ⁸ N6‐methyladenosine (m6A) is the most common and abundant RNA molecular modification in eukaryotes. ⁹ The m6A modification of mRNA is reversible and dynamically regulated by methyltransferases (also called writers: METTL3, METTL4, METTL14, and WTAP) and demethylases (known as erasers: FTO, ALKBH5). Recent studies have confirmed the involvement of m6A modification in various diseases, including renal I/R injury. For example, Ni et al. proved that m6A methylation‐related genes (YTHDF3, WTAP, and IGF2BP3) were greatly upregulated in AKI patients. ¹⁰ Wang et al. discovered that conditional depletion of METTL3 in mouse kidney tissues could alleviate I/R or cisplatin‐stimulated kidney injury and inflammation by reducing the TAB3 expression through a m6A‐dependent manner. ¹¹ Fat mass and obesity‐associated (FTO) protein is a key m6A demethylation enzyme responsible for removing specific RNA methylation. It has shown that FTO was downregulated in kidney tissues in a cisplatin‐induced AKI model, and its specific inhibitor, meclofenamic acid treatment aggravated renal injury by elevating m6A modification level. ¹² In addition, ALKBH5, as an another m6A demethylase, was increased in I/R and cisplatin‐induced AKI models, showing a positive correlation with the severity of renal injury. ¹³ , ¹⁴ These observation suggested that decreased FTO expression may be one of the key factors contributing to AKI. Furthermore, it was previous confirmed that FTO was reduced in cardiomyocytes and hepatocytes under I/R conditions, where it plays a cytoprotective role. ¹⁵ , ¹⁶ However, the precise biological function of FTO in I/R‐induced AKI remains to be explored.

Autophagy is a cellular process in which autophagosomes fuse with lysosomes to degrade damaged organelles or dysfunctional macromolecular proteins in eukaryotic cells under starvation and toxic substance stimulation. The breakdown products are then utilized by cells to sustain normal physiological functions. ¹⁷ Autophagy serves a dual role. Under normal physiological conditions, cells maintain a basal level of autophagy, which plays an important role in material recycling and the maintenance of intracellular environmental stability. ¹⁸ Previous research has demonstrated that autophagy was inhibited in the renal tissue of an AKI rat model, and activation of autophagy improved renal injury caused by I/R. ¹⁹ Moreover, autophagy can promote cellular adaptation and reduce oxidative damage by degrading and recovering damaged macromolecules and dysfunctional organelles in cells. ²⁰ , ²¹ , ²² Autophagy/Beclin1 regulator 1 (Ambra1) is a newly discovered autophagy‐related gene. ²³ Ambra1 binds to Beclin1 and combines with Vps34/PI3KC3 to form a complex known as class III PI3K, which further facilitates autophagy formation. ²⁴ Studies have shown that Ambra1 can alleviate H/R injury by regulating autophagy and ROS in H9C2 cells, as well as the activity of ULK1 complex. ²⁵ However, the association between Ambra1 and renal I/R injury remains unclear.

Through analysis of the SRAMP database, several m6A modification sites were identified in Ambra1 mRNA, indicating that its expression was regulated by m6A modification. Additionally, our previous research discovered that specificity protein 1 (SP1) could relieve I/R‐induced AKI by restoring autophagy, ¹⁹ and identified several transcriptional sites on the FTO promoter region. Therefore, we proposed the hypothesis that FTO activated by SP1 to activate Ambra1/ULK1‐mediated autophagy in a m6A‐dependent manner, thus alleviating I/R‐induced oxidative stress and renal injury. Our study might provide a new theoretical basis for the pathogenesis and mechanism of I/R‐induced AKI.

2. MATERIALS AND METHODS

2.1. Cell culture and treatment

Human renal tubular epithelial cell (HK‐2) was purchased from obtained from the American Type Culture Collection (CRL‐2190, Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM) (#11965092, Gibco, Grand Island, NY, USA) supplemented with 10% FBS (#10099158, Gibco) at 37°C with 5% CO₂. For the hypoxia/reoxygenation (H/R) treatment, cells were cultured in serum‐free DMEM and subjected to hypoxia (94% N₂, 5% CO₂, 1% O₂) for 12 h, followed by reoxygenation (74% N₂, 5% CO₂, 21% O₂) for 2, 4, or 6 h at 37°C. DAA is a m6A modification inhibitor that can inhibit the m6A modification level of global mRNA. ²⁶ , ²⁷ Here, cells were treated with 3‐Deazaadenosine (DAA, #SML1455, Sigma, St. Louis, MO, USA) at a concentration of 200 μM for 2 h.

2.2. Cell transfection

The full sequences of FTO or SP1 were cloned into the pcDNA3.1 vector (GenePharma, Shanghai, China). The short hairpin RNA (shRNA) targeting FTO, Ambra1 or SP1 was synthesized by RiBoBio (Guangzhou, China). Plasmid transfection was conducted utilizing Lipofectamine 3000 (#L3000015, Thermo Fisher Scientific, Waltham, MA, USA) for 48 h according to the manufacturer's protocol. The transfection efficiency was evaluated using real‐time quantitative PCR (RT‐qPCR).

2.3. RNA extraction and RT‐qPCR

Total RNA from HK‐2 cells or rat kidney tissues was isolated using TRIzol (#15596026CN, Invitrogen, Shanghai, China). The Prime‐Script™ RT reagent (#RR037A, Takara, Tokyo, Japan) was used for reverse transcription. SYBR® Premix Ex Taq™ II (#RR390A, Takara) was utilized for the RT‐qPCR process on an ABI‐7500 real‐time PCR system. The following primers were used: human FTO F: 5′‐TGGTGTCCCAAGAAATCGTG‐3′, R: 5′‐TGCAGGCCGTGAACCAC‐3′; rat FTO F: 5′‐GACCGTCCTGCGATGATGAAGTG‐3′, R: 5′‐CCTGTCCACCAAGTTCTCGTCATG‐3′; human Ambra1 F: 5′‐TGGGGAGGTTAGGATTTGGGA‐3′, R: 5′‐GAGCCGTAGGGTGGAAAGC‐3′; human SP1 F: 5′‐GACAGGACCCCCTTGAGCTT‐3′, R: 5′‐GGCACCACCACCATTACCAT‐3′. The 2^−∆∆Ct method was adopted to calculate gene expression, with GAPDH used as an internal control.

2.4. Western blot

Cells or tissue samples were lysed in RIPA buffer (#89900, Thermo Fisher Scientific). The protein concentration was determined utilizing the BCA protein assay (#23227, Pierce, Rockford, IL, USA). Equal amounts of proteins (20 μg) were separated on 10% SDS‐PAGE gels. Subsequently, the proteins were transferred onto PVDF membranes (#SLCRX13NL, Millipore, Billerica, MA, USA), which were blocked with 5% fat‐free milk. Primary antibodies were then applied and incubated at 4°C overnight: FTO (ab126605, 1:1000, Abcam, Cambridge, MA, USA), LC3II/I (#4108, 1:1000, Cell Signaling Technology, CST, Danvers, MA, USA), ULK1 (ab203207, 1:1000, Abcam), Ambra1 (#24907, 1:1000, CST); SP1 (ab13370, 1:1000, Abcam); p62 (ab109012, 1:1000, Abcam). After washing with TBST, a secondary antibody (#7074, 1:1000, CST) was added and incubated for 1 h. Protein bands were visualized using enhanced chemiluminescence (#A38555, Thermo Fisher Scientific) and quantified using ImageJ software (NIH, Bethesda, MD, USA). GAPDH was used as an internal reference.

2.5. Cell counting Kit‐8 (CCK‐8) assay

CCK‐8 assay was performed to assess cell survival. HK‐2 cells were seeded in 96‐well plates (5000 cells per well) and subjected to the specified treatment. Next, the cells were incubated with the CCK‐8 Kit (10 μL/well; #96992, Sigma) for 2 h. Finally, we recorded the absorbance at 450 nm utilizing a microplate reader (BioTek, Winooski, VT, USA).

2.6. Flow cytometry

The cell apoptotic rate was determined utilizing the Annexin V‐FITC Apoptosis Detection Kit (#556547, BD Bioscience, San Jose, CA). HK‐2 cells were treated with trypsin and collected by centrifugation. After washing with phosphate‐buffered saline (PBS), the cells were resuspended in a 100 μL binding buffer (1 × 10⁶ cells/mL). Then, 5 μL of Annexin V‐FITC and 10 μL of Propidium Iodide (PI) solution were added to stain the cells for 15 min in the dark. Apoptosis was measured using a flow cytometer (BD Biosciences).

2.7. Immunofluorescence (IF) staining

HK‐2 cells were washed with PBS, fixed with 4% paraformaldehyde, and permeabilized with 0.2% Triton X‐100 (#9036‐19‐5, Sigma) for 5 min, followed by blocking with 1% bovine serum albumin for 1 h. Next, the cells were incubated overnight with LC3B antibody (ab192890, 1:500, Abcam) at 4°C. After that, the cells were incubated with Alexa Fluor 488 anti‐rabbit IgG (#A27034, 1:1000, Invitrogen). Finally, IF detection was performed using a fluorescence microscope (Olympus, Tokyo, Japan).

For distribution of LC3 and LAMP1 in HK‐2 cells, primary antibodies against LC3 (#4108, 1:1000, CST) and LAMP1 (14‐1079‐80, 1:1000, Invitrogen) were applied to probe the cells. After rinsing with PBS, sections were incubated with Alexa Fluor 488 (Invitrogen) and Alexa Fluor 568 (Invitrogen) for 1 h. Finally, nuclei were stained with DAPI. Images were acquired with a fluorescence microscope (Olympus).

2.8. Detection of cell oxidative capacity

The concentrations of oxidative stress‐related factors (SOD, GSH, and MDA) in rat renal tissues and HK‐2 cells were determined utilizing specific Enzyme‐linked immunosorbent assay (ELISA) kits (#BC0170, #BC1175, # BC0020, Solarbio, Shanghai, China) following the manufacturer's instructions. Intracellular ROS was detected using the fluorescent probe DCFH‐DA (#35845, Sigma). Briefly, HK‐2 cells were incubated with 10 μM of DCFH‐DA solution in DMSO for 30 min at 37°C, followed by washing with PBS 2–3 times for ROS detection under a fluorescence microscope (Olympus).

2.9. Animal model

Male Sprague–Dawley rats (4–5 weeks of age) weighing 180–220 g was obtained from SLAC Laboratory Animal Center (Shanghai, China), and housed in light‐controlled (8 a.m./8 p.m.), homoeothermic (20°C–22°C) and air‐filtered cages. This study was approved by Animal Welfare and Ethics Committee of The Second Affiliated Hospital of Nanchang University (Approval number: SYXK‐2021–0004). All 24 rats were randomly assigned to 4 groups (n = 6 rats/group): Sham, I/R, I/R + pcDNA3.1, I/R + pcDNA3.1‐FTO. The pcDNA3.1‐FTO and empty pcDNA3.1 plasmids were introduced into the PHY‐LV‐KD5.1 lentivirus vector (GenePharma) and then packaged into lentivirus particles. One week prior to the I/R operation, lentivirus particles (5 × 10⁷ particles/μL, 200 μL) were administrated to the rats via the tail vein. A rat model of renal I/R was established as previously described. ¹⁹ Rats were anesthetized with intraperitoneal injection of sodium pentobarbital (50 to 70 mg/kg) and placed on an electrical heating pad to maintain a stable rectal temperature of 37°C. Both renal pedicles were occluded for 45 min through a midline incision. After that, the renal pedicles were repercussed in situ. Rats were sacrificed 24 h after reperfusion, and renal tissues and blood samples were dissected for subsequent experiments. The sham operation followed the same procedure excluding the application of microaneurysm clips.

2.10. Histopathological examination (HE and TUNEL staining)

Paraformaldehyde (4%) was adopted to fix the kidneys. Kidney tissues were dehydrated and embedded in paraffin. The 4‐μm sections were stained with hematoxylin and eosin (HE staining) and then analyzed utilizing light microscopy. Renal tubular injury was assessed using a semiquantitative scoring system on a scale of 0–5, as described previously. ²⁸ Pathological scoring is between 0 and 5 points based on the percentage of injury area: 0, no damage; 1, injury area <10%; 2, 10% < injury area < 25%; 3, 25% < injury area < 50%; 4, 50% < injury area < 75%; 5, injury area >75%. The sections were evaluated by three pathologists who were blinded to the groupings to ensure objectivity. The terminal deoxynucleotidyl transferase–mediated dUTP nick‐end labeling (TUNEL) method with the Onestep TUNEL Apoptosis Assay Kit (#C1086, Beyotime, Shanghai, China) was used to identify apoptotic cells in kidney sections according to the manufacturer's instructions. TUNEL‐positive nuclei were identified using a microscopy, and the apoptosis rate of renal tubules was calculated.

2.11. Assessment of the renal function

Blood samples from rats were centrifuged at 3000 rpm and 4°C for 20 min. The levels of serum creatinine (Cr) and blood urea nitrogen (BUN) were assessed using the corresponding detection kits (#C011‐2‐1, #C013‐2‐1, Jiancheng, Nanjing, China) according to the manufacturer's instructions.

2.12. Global m6A quantification

Total RNA from HK‐2 cells was isolated using TRIzol (#15596026CN, Invitrogen). The total m6A levels in mRNA were determined using the EpiQuik m6A RNA Methylation Quantification Kit (#P‐9005, Epigentek, NY, US) following the manufacturer's protocol. Briefly, 200 ng of RNA was coated onto assay wells, followed by the addition of the appropriate dilution of the m6A antibody (ab195352, 1:1000, Abcam) to each well. The m6A levels were tested utilizing a microplate reader (BioTek) at 450 nm.

2.13. RNA immunoprecipitation (RIP)

RIP was carried utilizing the Magna RIP RNA‐Binding Protein Immunoprecipitation Kit (#17–700, Millipore) according to the manufacturer's protocol. Briefly, HK‐2 cells were lysed in RIP lysis buffer. Cell extracts were incubated with magnetic beads coated with specific antibodies against anti‐IgG (#2729, CST), anti‐m6A antibody (ab284130, Abcam) or anti‐FTO (ab126605, Abcam) at 4°C overnight. Afterwards, the precipitated RNA was extracted and quantified by RT‐qPCR.

2.14. RNA pull‐down

The biotinylated probes of sense/antisense Ambra1 were designed and synthesized by RiboBio (Guangzhou, China). The magnetic RNA‐protein Pull Down kit (#20164, Thermo Fisher Scientific) was used to examine the interplay between Ambra1 and FTO. Briefly, cell lysates from HK‐2 cells were obtained and mixed with biotin‐labeled sense/antisense Ambra1 RNA. The mixture was then incubated with M‐280 streptavidin magnetic beads at 4°C for 4 h. After washing with PBS, the eluted proteins were assessed using western blot assay.

2.15. Chromatin immunoprecipitation (ChIP) assay

ChIP was conducted utilizing the SimpleChIP Enzymatic Chromatin IP Kit (#9002, CST). Briefly, cells were crosslinked with formaldehyde, and chromatin was fragmented by sonication. Chromatin was immunoprecipitated with anti‐SP1 (ab13370, Abcam) or control IgG (#2729, CST) antibodies. Afterwards, the chromatin was incubated with protein A/G‐Sepharose beads (ab193262, Abcam). The precipitated chromatin DNA was analyzed by PCR using FTO primers.

2.16. Dual luciferase reporter assay

The FTO promoter was amplified by PCR (Promega, Madison, WI, USA) and cloned into the pGL3 vector (Promega). To validate the regulatory relationship between FTO and SP1, HK‐2 cells were plated in a 24‐well plate for 24 h. Afterwards, the cells were co‐transfected with pcDNA3.1‐SP1, sh‐SP1, or negative control plasmids along with recombinant pGL3.0 plasmids utilizing Lipofectamine 3000 (#L3000015, Thermo Fisher Scientific) for 48 h, respectively. Next, the cells were collected for assay utilizing the Dual Luciferase reporter system (Promega).

2.17. Co‐immunoprecipitation (Co‐IP)

Cells were lysed in 1% NP‐40 buffer. The samples were then precipitated with Ambra1 antibody (#24907, CST) and protein A/G–agarose beads (ab193262, Abcam) at 4°C overnight. The bound proteins were eluted by boiling in SDS buffer and subjected to western blot analysis using antibodies against TRAF6 (ab40675, Abcam), TRIM32 (ab96612, Abcam), and ULK1 (ab203207, Abcam).

2.18. Statistical analyses

The experimental results were analyzed using SPSS 20.0 software (SPSS Inc., IL, United States). The data were presented as mean ± standard deviation (SD) from three independent experiments. Differences between multiple groups were identified using one‐way ANOVA, while differences between two groups were tested utilizing Student's t‐test. p < .05 was considered statistically significant.

3. RESULTS

3.1. Gain‐of‐function of FTO alleviated the H/R‐induced oxidative stress injury

First, to investigate the effect of FTO on AKI, HK‐2 cells were subjected to H/R condition to mimic an in vitro AKI model. Data from RT‐qPCR assay showed that FTO expression at both the mRNA and protein level was inhibited in H/R‐treated HK‐2 cells in a time‐dependent manner compared to the control group (Figure 1A,B). Next, HK‐2 cells were transfected with pcDNA3.1‐FTO or pcDNA3.1. Compared to the pcDNA3.1 group, transfection with pcDNA3.1‐FTO remarkably elevated FTO expression in HK‐2 cells (Figure 1C). Subsequently, CCK‐8 assay demonstrated that H/R treatment markedly decreased cell viability, while FTO upregulation obviously reversed this inhibitory effect (Figure 1D). Then, the cellular oxidative stress was further examined. Following H/R treatment, the MDA level was increased, while the activities of SOD and GSH were repressed. However, all these changes in the oxidative stress index caused by H/R were rescued by the FTO overexpression (Figure 1E). Likewise, DCFH‐DA staining revealed that the ROS level in HK‐2 cells was induced by H/R treatment, but repressed in presence of pcDNA3.1‐FTO (Figure 1F). Furthermore, it was observed that the cell apoptotic rate was obviously increased by H/R stimulation, which could be overturned by the FTO overexpression (Figure 1G). These data implied that FTO upregulation improved H/R‐triggered oxidative stress injury in HK‐2 cells.

FIGURE 1.

Gain‐of‐function of FTO alleviated H/R‐induced oxidative stress injury. (A and B) HK‐2 cells were cultured under H/R condition for 2, 4 or 6 h. RT‐qPCR and Western blot were used to detect FTO expression. (C) The mRNA expression of FTO in HK‐2 cells transfected with pcDNA3.1‐FTO or pcDNA3.1 were detected by RT‐qPCR. Next, HK‐2 cells were transfected with pcDNA3.1‐FTO or pcDNA3.1, and then cultured under H/R condition. (D) CCK‐8 detection of cell viability. (E) ELISA detection of MDA, GSH, and SOD levels. (F) DCFH‐DA was adopted to detect ROS level. (G) Flow cytometry detection of apoptosis. Error bars represent the mean ± SD of at least three independent experiments. *p < .05, **p < .01, ***p < .001.

3.2. Autophagy inhibition reversed the FTO overexpression‐mediated inhibitory effects on the H/R‐triggered oxidative stress injury

Autophagy has been proved to play an essential role in renal I/R injury. Here, we aimed to explore the interplay between FTO and autophagy in H/R‐induced HK‐2 cells. As shown in Figure 2A,B and Figure S1A, the levels of LC3II/I and ULK1 were significantly reduced, and p62 was increased in H/R‐treated cells compared to the control group. However, these protein alterations were dramatically restored upon the FTO overexpression. Co‐localization experiment also showed that the enhanced co‐localization of LC3 and LAMP1 was reversed by FTO upregulation (Figure S1B). Next, H/R‐induced HK‐2 cells were co‐treated with the FTO overexpression and 3‐MA (an autophagy inhibitor). In H/R‐treated HK‐2 cells, FTO upregulation significantly elevated the protein levels of LC3II/I and ULK1, and also downregulated p62 level, while these changes were abolished by 3‐MA (Figure 2C, Figure S1A). Similarly, the increase of LC3 and LAMP1 co‐localization mediated by the FTO overexpression were also reversed by 3‐MA (Figure S1B). Moreover, reinforced expression of FTO promoted cell proliferation in H/R‐treated HK‐2 cells, and 3‐MA overturned this effect of FTO (Figure 2D). Additionally, the decrease in MDA level and the increase in SOD and GSH activities mediated by FTO upregulation were reversed by 3‐MA (Figure 2E,F). Further, flow cytometry analysis revealed that cell apoptosis was suppressed by overexpressed FTO, and it was recovered by 3‐MA in H/R‐stimulated HK‐2 cells (Figure 2G). Thus, these results suggested that overexpression of FTO protected HK‐2 cells from oxidative stress injury triggered by H/R via activating autophagy.

FIGURE 2.

Autophagy inhibition reversed the FTO overexpression‐mediated inhibitory effects on H/R‐triggered oxidative stress injury. HK‐2 cells were transfected with pcDNA3.1‐FTO or pcDNA3.1, and then cultured under H/R condition. (A) Western blot detection of LC3II/I and ULK1 expression. (B) Immunofluorescence detection of LC3B. Next, HK‐2 cells were treated with the FTO overexpression and 3‐MA (an autophagy inhibitor), and then cultured under H/R condition. (C) Western blot detection of LC3II/I and ULK1 expression. (D) CCK‐8 detection of cell viability. (E) ELISA detection of MDA, GSH, and SOD levels. (F) DCFH‐DA was adopted to detect ROS level. (G) Flow cytometry detection of apoptosis. The data are expressed as the mean ± SD and are representative of 3 experiments. *p < .05, **p < .01, ***p < .001.

3.3. Enforced expression of FTO relieved I/R‐induced AKI through activating autophagy

To explore the effect of FTO on renal I/R injury in vivo, a rat model of renal I/R injury was established. Firstly, the serum levels of BUN and Cr were increased after I/R in rats, while FTO upregulation reduced the secretion of BUN and Cr (Figure 3A,B). HE staining showed that I/R resulted in significant damage to renal function, manifested as the dilation and congestion of renal tubules, as well as swelling and necrosis of renal tubular epithelial cells. Notably, all these pathologic changes could be alleviated by the FTO overexpression (Figure 3C). TUNEL staining demonstrated an increase in renal tubular cell apoptosis following I/R in rat renal tissues, while the FTO overexpression inhibited the phenomenon (Figure 3D). Moreover, increased levels of MDA and decreased activities of GSH and SOD were observed in rats from the I/R group, However, these changes were abrogated by the FTO overexpression (Figure 3E). Subsequently, western blot analysis showed that the levels of LC3II/I and ULK1 were decreased after I/R in rat kidney tissues, while reinforced expression of FTO further restored the expression of LC3II/I and ULK1 (Figure 3F). Furthermore, the mRNA expression of FTO in the kidney tissues of rats was reduced in response to I/R treatment, while it was reversed in rats from the I/R + pcDNA3.1‐FTO group (Figure 3G). Taken together, these findings revealed that overexpressed FTO attenuated I/R‐triggered AKI by activating autophagy in rats.

FIGURE 3.

Enforced expression of FTO relieved I/R‐induced AKI through activating autophagy. A rat model of renal I/R injury was established and treated with a FTO overexpressing vector. (A and B) ELISA analysis of serum BUN and Cr levels. (C) Representative images of HE staining to assess renal histopathological changes in rats. (D) Representative images of TUNEL staining to detect renal tubular cell apoptosis. (E) ELISA analysis of MDA, GSH and SOD levels. (F) Western blot detection of LC3II/I and ULK1 expression. (G) RT‐qPCR detection of FTO expression. Data are the means ± SD for three independent experiments. *p < .05, **p < .01, ***p < .001. n = 6 rats/group.

3.4. FTO‐enhanced the autophagy‐related Ambra1 expression via a m6A‐dependent manner

Here, we further investigated the potential regulatory network of FTO in renal I/R injury. In H/R‐induced HK‐2 cells, both Ambra1 mRNA and protein levels were downregulated compared to control cells, but the FTO overexpression further restored the Ambra1 expression (Figure 4A,B). Similar data was also observed in vivo, showing that the Ambra1 expression was suppressed in kidney tissues of I/R rats, and it was recovered by the FTO overexpression (Figure 4C,D). As a m6A demethylase, we next assessed the changes in the global m6A level in each group. As shown in Figure 4B, the global RNA m6A modification level was markedly increased after H/R treatment, and was dramatically decreased by the FTO overexpression (Figure 4E). Consistently, it was also observed that the m6A modification level of Ambra1 mRNA was increased after H/R treatment, and further decreased with FTO upregulation (Figure 4F). This finding suggested a potential negative relationship between the m6A modification level of Ambra1 mRNA and its expression level. Next, several m6A modification sites on Ambra1 mRNA were discovered, which by the SRAMP database (Figure 4G). Then, the RIP assay revealed that compared to the IgG group, the FTO antibody successfully precipitated Ambra1 mRNA (Figure 4H). RNA pull down results also showed that the FTO protein exhibited a significant binding relationship with the Ambra1 sense probe rather than the antisense labeled probe (Figure 4I). Afterwards, FTO silencing in HK‐2 cells was established by transfection with sh‐FTO, and the transfection efficiency was validated by RT‐qPCR (Figure 4J). Subsequently, it was observed that the m6A modification and mRNA level of Ambra1 were greatly increased and reduced in presence of sh‐FTO, respectively. Additionally, co‐treatment with DAA dramatically downregulated the m6A level of Ambra1 while promoting the Ambra1 expression (Figure 4K,L). Altogether, the above data indicated that FTO facilitated the Ambra1 expression by removing its mRNA m6A modification.

FIGURE 4.

FTO enhanced autophagy‐related Ambra1 expression via a m6A‐dependent manner. (A and B) Effects of the FTO overexpression on the Ambra1 expression in H/R‐induced HK‐2 cells were detected by RT‐qPCR and Western blot. (C and D) Rats were divided into the Sham group, I/R group, I/R + pcDNA3.1‐NC group, and I/R + pcDNA3.1‐FTO group. The Ambra1 expression was detected by RT‐qPCR and Western blot. (E) The global m6A levels were detected by kits. (F) m6A modification level of Ambra1 was detected by meRIP. (G) Schematic diagram of the m6A modification sites on Ambra1 mRNA, which was predicted by SRAMP database. (H and I) RIP and RNA pull down assays were used to detect the binding relationship between FTO and Ambra1 mRNA. (J) Transfection efficiency of sh‐FTO in HK‐2 cells was detected by RT‐qPCR. Next, HK‐2 cells were treated with sh‐FTO or co‐treated with sh‐FTO and DAA (a m6A inhibitor). (K) m6A modification of Ambra1 mRNA was detected by meRIP. (L) The Ambra1 expression was detected by RT‐qPCR. Data are represented as the mean ± SD of three independent experiments. *p < .05, **p < .01, ***p < .001.

3.5. Ambra1 inhibition reversed the FTO overexpression‐mediated autophagy activation

Autophagosome formation was initiated by ULK1 and beclin‐1‐Vps34‐Ambra1 complex. ²⁹ Ambra1 could interact with E3 ubiquitin ligase TRIM32 and TRAF6 to promote the polyubiquitination of ULK1 K63 and Lys63 and improve its protein stability. ³⁰ , ³¹ Therefore, we next explored whether the relationship between these factors was existed in HK2 cells. Co‐IP assay confirmed the presence of a binding relationship between Ambra1 and TRAF6, TRIM32 or ULK1 in HK2 cells (Figure 5A). Moreover, sh‐Ambra1 and shNC were transfected into HK‐2 cells, and the transfection efficiency was validated by RT‐qPCR. As shown in Figure 5B, compared to the shNC group, shAmbra1 transfection greatly downregulated Ambra1 level. Subsequently, we found that Ambra1 depletion mitigated the promotion effects of the FTO overexpression on Ambra1, LC3II/I, and ULK1 expressions, co‐localization of LC3 + LAMP1, as well as the suppressive role in p62 level in H/R‐treated HK2 cells (Figure 5C, Figure S1A,B). These results implied that overexpression of FTO facilitated autophagy activation by upregulating Ambra1.

FIGURE 5.

Ambra1 inhibition reversed the FTO overexpression‐mediated autophagy activation. (A) Co‐IP detection of the binding between Ambra1 and TRAF6, TRIM32 or ULK1 in HK2 cells. (B) RT‐qPCR was used to detect the Ambra1 expression after sh‐Ambra1 transfection. Next, HK‐2 cells were co‐transfected with pcDNA3.1‐FTO and sh‐Ambra1, and then cultured under H/R condition. (C) Western blot detection of Ambra1, LC3II/I, and ULK1 expression. Values were expressed as mean ± SD of three separate determinations. *p < .05, **p < .01, ***p < .001.

3.6. Silencing of Ambra1 restrained the FTO overexpression‐mediated protective effects on H/R‐triggered oxidative stress injury

To further investigate the functional correlation between Ambra1 and FTO in H/R‐induced renal cell injury, HK‐2 cells were co‐transfected with pcDNA3.1‐FTO and sh‐Ambra1, and then cultured under H/R condition. CCK‐8 assay exhibited that the promoting effect of FTO upregulation on cell viability was impeded by the loss of Ambra1 in H/R‐treated cells (Figure 6A). Similarly, the reduced MDA level and elevated SOD and GSH activities mediated by the FTO overexpression were greatly overturned when Ambra1 was inhibited (Figure 6B). In addition, the ROS level was repressed after the FTO overexpression, whereas co‐transfection of sh‐Ambra1 further increased the ROS level (Figure 6C). Moreover, the inhibitory effect of FTO upregulation on H/R‐induced cell apoptosis was impaired by co‐transfection of sh‐Ambra1 (Figure 6D). The above data suggested that overexpressed FTO protected HK‐2 cells from H/R‐triggered oxidative stress injury by upregulating Ambra1.

FIGURE 6.

Silencing of Ambra1 restrained the FTO overexpression‐mediated protective effects on H/R‐triggered oxidative stress injury. HK‐2 cells were co‐transfected with pcDNA3.1‐FTO and sh‐Ambra1, and then cultured under H/R condition. (A) CCK‐8 detection of cell viability. (B) ELISA detection of MDA, GSH, and SOD levels. (C) DCFH‐DA was adopted to detect ROS level. (D) Flow cytometry detection of apoptosis. Error bars represent the mean ± SD of at least three independent experiments. *p < .05, **p < .01, ***p < .001.

3.7. FTO was transcriptionally regulated by SP1

The full length of FTO promoter was obtained from the NCBI database (chr16; NC_000016.10:53701963–53 703 963), and the upstream regulator was predicted. Analysis using the JASPAR database revealed that SP1 (MA0079.3) had several binding sites on the FTO promoter region (Figure 7A,B). Next, ChIP assay confirmed that compared to the IgG group, the FTO promoter showed a significant enrichment in the DNA complex pulled down by SP1 (Figure 7C). Additionally, SP1 expression in HK‐2 cells was greatly elevated after transfection with pcDNA3.1‐SP1 vectors, and it was markedly reduced by shSP1 transfection (Figure 7D–G). Dual luciferase assay revealed that SP1 upregulation significantly increased the luciferase activity in cells expressing the FTO promoter, whereas SP1 knockdown presented an opposite effect (Figure 7E). Finally, RT‐qPCR and/or Western blot implied that the SP1 overexpression elevated SP1 and FTO expression, while SP1 depletion decreased SP1 and FTO expression (Figure 7F,G). These data clarified that SP1 transcriptionally activated FTO in HK‐2.

FIGURE 7.

FTO was transcriptionally regulated by SP1. (A) Schematic diagram of SP1 motif. (B) Schematic diagram of potential binding sites of SP1 on FTO promoter predicted by JASPAR database. (C) ChIP assay was used to confirm the binding relationship between SP1 and FTO promoter. (D) RT‐qPCR detection of the effects of overexpressing or knockdown efficiency of SP. (E) Dual luciferase reporter assay was utilized to detect the effect of SP1 on the transcriptional activity of FTO promoter. (F) RT‐qPCR detection of FTO expression. (G) Western blot detection of SP1 and FTO expression. Values were expressed as mean ± SD of three separate determinations. *p < .05, **p < .01, ***p < .001.

3.8. SP1 knockdown diminished the effects of FTO upregulation on autophagy and oxidative stress in H/R induced HK‐2 cells

To determine whether the changes of SP1 expression could affect the roles of FTO in H/R‐induced HK‐2 cells, we co‐transfected pcDNA3.1‐FTO and sh‐SP1 into HK‐2 cells, followed by exposure to the H/R condition. The cell viability triggered by FTO upregulation was substantially abrogated by SP1 knockdown (Figure 8A). Besides, the FTO overexpression reduced oxidative stress damage, as confirmed by the decrease in MDA level and the enhancement of GSH and SOD activities. These results were reversed upon silencing of SP1 (Figure 8B). When FTO expression was upregulated, ROS levels and apoptosis rates were significantly decreased, which could be rescued by co‐transfection with sh‐SP1 (Figure 8C,D). Next, Western blot confirmed that reinforced FTO expression induced an upregulation in Ambra1, LC3II/I and ULK1 expressions, the increase of colocalization of LC3 and LAMP1, and the decrease in p62 level, while those increases could be weakened by SP1 silencing (Figure 8E, Figure S1A,B). Therefore, SP1 depletion suppressed the effects of the FTO overexpression on autophagy and oxidative stress in H/R‐stimulated HK‐2 cells.

FIGURE 8.

SP1 knockdown diminished the effects of FTO upregulation on autophagy and oxidative stress in H/R induced HK‐2 cells. HK‐2 cells were transfected with pcDNA3.1‐FTO or co‐transfected with pcDNA3.1‐FTO and sh‐SP1, and then cultured under H/R condition. (A) CCK‐8 detection of cell viability. (B) ELISA detection of MDA, GSH, and SOD levels. (C) DCFH‐DA was used to detect ROS level. (D) Flow cytometry detection of apoptosis. (E) Western blot detection of Ambra1, LC3II/I and ULK1 expression. Error bars represent the mean ± SD of at least three independent experiments. *p < .05, **p < .01, ***p < .001.

4. DISCUSSION

AKI is one of the most common and serious clinical diseases. Current treatment strategies for AKI caused by I/R are ineffective, leading to high incidence and mortality. ³² The pathophysiological process of renal I/R injury is complex, but it is generally believed that oxidative stress plays an important role in it, which is the main cause of renal tubular necrosis, apoptosis, and aggravation of local inflammation. ³³ Here, we demonstrated that FTO ameliorated kidney injury and oxidative stress damage induced by I/R through activating Ambra1/ULK1‐mediated autophagy, indicating that FTO is a potential target of AKI therapy.

The m6A imbalance is closely related to AKI development. ¹³ Several m6A‐associated enzymes, including ALKBH5 ¹³ and METTL3, ¹¹ have been implicated in I/R‐induced AKI. FTO, an RNA demethylase, was decreased during I/R injury and overexpressed FTO ameliorated hepatic I/R injury and H/R‐induced cardiomyocytes apoptosis and inflammation. ¹⁵ , ¹⁶ Gain of function of FTO also showed a protective role in I/R‐induced neuroinflammation through modulating cGAS and microRNA‐155 in m6A‐dependent manner. ³⁴ , ³⁵ Consistently, we observed that FTO was downregulated in H/R‐treated HK‐2 cells and renal tissues from I/R rats. Overexpressed FTO promoted cell proliferation and reduced apoptosis induced by H/R, as well as mitigating I/R‐induced renal injury. Moreover, Hou et al. showed that FTO increased the Nrf2 expression, thereby inhibiting oxidative stress response and alleviating cerebral I/R injury. ³⁶ Yang et al. found that FTO played as an autophagy inducer to alleviate TGF‐β1‐or I/R‐induced renal fibrosis. ³⁷ Wang et al. also proved that FTO induced autophagy‐associated ATG5 and ATG7 expression during adipogenesis through removing their m6A modification and blocking the recognition of YTHDF2. ³⁸ Similarly, our work found that FTO upregulation reduced oxidative stress injury in H/R‐treated cells by activating autophagy. In vivo experiments further confirmed that autophagy‐associated LC3II/I and ULK1 expressions were enhanced upon the FTO overexpression. These findings collectively indicated that FTO could be a beneficial factor in I/R‐induced renal injury.

m6A modification in RNA has emerged as a functional regulator in various diseases. ³⁹ Here, we observed an increase in global m6A levels and m6A‐modified Ambra1 in H/R‐induced HK‐2 cells. However, the expression of Ambra1 was decreased, indicating a negative correlation between m6A modification of Ambra1 mRNA and its expression. Notably, we discovered that FTO enhanced the Ambra1 expression by reducing the m6A methylation of Ambra1 mRNA. Ambra1 is a novel BH3‐like protein and a key autophagy factor. ⁴⁰ By participating in the formation of type III phosphatidylinositol 3‐kinase (III PI3‐kinase) complex, Ambra1 positively regulates Beclin1 gene and promotes autophagy. ⁴¹ , ⁴² Additionally, Ambra1 served as an upstream key factor in regulating autophagy along with ULK1. ²⁵ Here, we illustrated that ULK1 was a key downstream gene of Ambra1. Ambra1 knockout reversed FTO overexpression‐mediated autophagy activation and decreased ULK1 level. Ambra1 has been shown to protect H9C2 cells against H/R injury by promoting autophagy and reducing ROS. ²⁵ Functionally, we demonstrated that the FTO overexpression‐mediated protective effects on H/R‐triggered oxidative stress injury were overturned by Ambra1 knockdown. These findings collectively suggested that targeting FTO/Ambra1/ULK1 axis could hold promise as a therapeutic approach for I/R‐induced renal injury.

SP1 is a common transcription factor, which is important for cell growth, differentiation, autophagy, and apoptosis. ⁴³ Studies have shown that SP1 plays a crucial role in protecting renal I/R injury. ⁴⁴ Our previous study demonstrated that SP1 protected renal tubule cell against injury induced by I/R via the miR‐205/PTEN/Akt pathway mediated autophagy. ¹⁹ SP1 prevented podocyte injury in diabetic nephropathy by reducing oxidative stress. ⁴⁵ Overexpressed SP1 alleviated intestinal oxidative stress and inflammatory injury after sepsis. ⁴¹ SP1 activated ZFAS1 to aggravate sepsis‐induced cardiac dysfunction via autophagy and pyroptosis. ⁴⁶ Here, our findings demonstrated that SP1 knockdown effectively eliminated the protective effects of FTO against autophagy and oxidative stress in H/R‐stimulated HK‐2 cells. Hence, SP1 play as an upstream regulator of FTO during the pathogenesis of I/R induced renal injury.

In summary, m6A demethylase FTO mitigated renal damage and oxidative stress injury during I/R by activating Ambra1/ULK1‐mediated autophagy pathway. Specifically, FTO inhibited m6A methylation modification of Ambra1, resulting in Ambra1 up‐regulation. Moreover, SP1 transcriptionally promoted FTO expression. Therefore, these data illustrated that FTO exerted a protective role in I/R‐induced AKI and may be a potential therapeutic target for I/R‐induced AKI. In the future, our research should be confirmed through large‐scale clinical studies and more in‐depth mechanism researches, thereby providing a clearer theoretical basis for the clinical treatment of I/R‐induced AKI. Additionally, it is worth noting that there is a lack of data on FTO transcriptionally regulated by SP1 from in vivo animal experiments, which will be addressed in the future.

AUTHOR CONTRIBUTIONS

Conception and design of study: Yan Chen, Chong Huang. Acquisition of data: Yan Chen, Yuanfei Liu. Analysis and interpretation of data: Weiping Tu, Chengyun Xu. Drafting the manuscript: Yanxia Chen. Revising the manuscript critically for important intellectual content: Yan Chen, Chong Huang. All authors reviewed the manuscript.

FUNDING INFORMATION

This study is supported by the Funded Project of Jiangxi Engineering and Technology Research Centre for Kidney Diseases and the National Natural Science Foundation of China (Nos. 82360141 and 82160134).

DISCLOSURES

The authors declare that they have no conflicts of interest.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

This study was approved by Animal Welfare and Ethics Committee of the Second Affiliated Hospital of Nanchang University (Approval number: SYXK‐2021–0004).

CONSENT FOR PUBLICATION

Not applicable.

Supporting information

Figure S1.

Figure S2.

Chen Y, Liu Y, Tu W, Chen Y, Xu C, Huang C. m6A demethylase FTO transcriptionally activated by SP1 improves ischemia reperfusion‐triggered acute kidney injury by activating Ambra1/ULK1 ‐mediated autophagy. The FASEB Journal. 2024;38:e70118. doi: 10.1096/fj.202400132RRR

DATA AVAILABILITY STATEMENT

All data generated or analyzed are included in this article. Further inquiries can be directed to the corresponding author.