ABSTRACT
Background
This study aimed to investigate the association between genetic variants of ERAP1 (OMIM: 606832) and psoriasis vulgaris (PsV) susceptibility in Inner Mongolia Han nationality.
Methods
For primary screening, the subjects included 142 PsV cases and 100 healthy controls without psoriasis. The 27 exons of ERAP1 gene were sequenced to screen significant genetic variants. For the validation study, the subjects included 1030 PsV cases and 965 healthy controls. A total of 18 mutations were detected for genetic variants of significance in primary screening and previously reported genetic variants.
Results
In primary screening stage, 13 genetic variants of ERAP1 showed an association with psoriasis. A total of 18 genetic variants were typed for the validation, and 12 genetic variants were associated with PsV in Inner Mongolia Han population. Stratified analysis showed significant differences in the allele frequencies of 8 ERAP1 genetic variants in cases with positive family history, and significant differences in allele frequencies among 9 ERAP1 genetic variants in patients with negative family history. A risk haplotype (TCCCTCCAGACC) was significantly associated with PsV, and the most risk haplotype was E730/K528/R127/E56.
Conclusion
ERAP1 gene mutation may be associated with PsV and HLA‐C*06:02 in Han nationality in Inner Mongolia. A risk haplotype of four‐nonsynonymous mutation (E730/K528/R127/E56) is associated with PsV.
Keywords: association, ERAP1, genetic variation, HLA‐C, psoriasis
ERAP1 gene mutation may be associated with psoriasis vulgaris and HLA‐C0602 in Han nationality in Inner Mongolia. A risk haplotype of four‐nonsynonymous mutation (E730/K528/R127/E56) is associated with PsV.

1. Introduction
Psoriasis vulgaris (PsV) is a chronic inflammatory skin disease characterized by skin erythema and scaling, with a prevalence of about 0.1%–2.8% of the total population worldwide and an overall prevalence of about 0.47% in China (Xiaolan et al. 2010). According to the age of onset, PsV can be divided into early‐onset PsV (age of onset ≤ 40 years) and late‐onset PsV (age of onset > 40 years), and the incidence of early‐onset PsV is higher in the PsV family (Fanoni et al. 2019; Guo et al. 2023; Szentkereszty‐Kovács et al. 2019). It is well‐known that ERAP1 gene (OMIM: 606832) is involved in PsV, and Tang et al. conducted a genetic study of 10,727 PsV cases and 10,582 controls in China, and the results showed that rs27044 (Q730E) and rs26653 (R127P) on ERAP1 were significantly associated with PsV (Tang et al. 2014). A European study showed that rs27524A at the ERAP1 variant was associated with psoriasis (p = 0.019, OR = 1.34), especially in pediatric patients, which could be used as an independent risk factor (p = 0.042, OR = 1.43) (Bergboer et al. 2012). Therefore, ERAP1 is highly polymorphic and may be involved in the pathogenesis of PsV.
Human leukocyte antigen (HLA) (OMIM: 142840) is PsV‐associated gene, especially for HLA‐C*06:02 (Zhen et al. 2019). Previous studies suggest that ERAP1 and HLA‐C*06:02 interact in the pathogenesis of PsV. Das et al. (2017) analyzed the relationship between ERAP1, HLA‐C*06:02, and PsV in an eastern Indian population and found that three genetic variants of ERAP1 (rs27044, rs30187, rs26653) were associated with PsV only when HLA‐C*06:02 was positive. Lysell et al. (2013) reported that the association between rs26653 on the ERAP1 gene and PsV was not limited to HLA‐C*06:02 positive individuals. There may be an interaction between ERAP1 and HLA‐C*06:02, but due to ethnic and geographical differences, the results are not consistent and there may be genetic heterogeneity.
It has been previously reported in China that ERAP1 genetic variants rs27044, rs26653, rs30187, rs27524, and rs151823 are associated with PsV (Shahid et al. 2023; Yang et al. 2013), but the mechanism of interaction between ERAP1 and HLA‐C*06:02 has not been fully elucidated, and there are ethnic and regional differences in the genes. In order to clarify the association between ERAP1 gene variants and PsV in Inner Mongolia Han nationality, and the effects of these genetic variants and HLA‐C*06:02 interaction on PsV susceptibility in Inner Mongolia Han nationality, we performed this study with a large sample size and carried out genetic association analysis studies using a two‐stage experimental method of primary screening and validation.
2. Materials and Methods
2.1. Ethical Compliance
This study was approved by the Ethics Committee of Inner Mongolia Medical University and adhered to the Declaration of Helsinki during its implementation, and informed consent was obtained from all study subjects.
2.2. Subjects
The study population consisted of 1172 patients with PsV and 1065 healthy controls who visited the Affiliated Hospital of Inner Mongolia Medical University from December 2010 to March 2020. All subjects recruited were Han Chinese over 18 years of age, male or female. Of these, 142 PsV patients and 100 healthy controls served as primary screening sequencing samples. The remaining samples (1030 PsV patients and 965 healthy controls) were subjected to validation experiments. Patients with PsV were diagnosed by two chief physicians based on histopathology. Healthy controls with no personal history of PsV were recruited from the physical examination center of the hospital, and no PsV patients among the first‐, second‐, and third‐degree relatives. This study was approved by the Ethics Committee of Inner Mongolia Medical University and adhered to the Declaration of Helsinki during its implementation, and informed consent was obtained from all study subjects.
2.3. Next‐Generation Sequencing
Blood samples were collected from all subjects the next morning after fasting for 8 h for examination, and 4 mL of peripheral blood samples were collected from each subject and stored at −80°C for future use. Genomic DNA from blood samples was extracted using a DNA extraction kit (AxyPrep, AP‐MX‐BL‐GDNA‐25, Suzhou, China). Information on all SNPs was obtained from the PubMed database. The multiplex PCR reaction system included: 1 μL DNA template, 2 μL buffer, 0.6 μL Mg2+, 2 μL dNTPs, 0.2 μL Taq DNA polymerase, 2 μL primer mixture, supplemented with double‐distilled water. The primers are listed in Table 1. PCR reaction conditions: pre‐denaturation at 95°C for 2 min; 35 cycles of annealing at 94°C for 30 s, 56°C for 1.5 min, and extension at 65°C for 30 s; and finally extension at 65°C for 10 min.
TABLE 1.
Primer sequence of 18 variants of ERAP1 in validated stage.
| Gene | Single nucleotide polymorphism | Sense primer strand | Antisense primer strand |
|---|---|---|---|
| ERAP1 | Rs27980 | AATCAATATGAGAAGGAAATAGAAATAGC | CACAATGCCATCACTTAACTATAACTC |
| ERAP1 | Rs27042 | TACTGGGTTCCTGCCAATGAG | GCAGTGATTCATAACTGTTTCATCAC |
| ERAP1 | Rs27044 | CTCTGTACGCACGGCTGATAG | CTGTTTCCCTGTACAACGCC |
| ERAP1 | Rs17482078 | CTCTGTACGCACGGCTGATAG | CTGTTTCCCTGTACAACGCC |
| ERAP1 | Rs469876 | GCCTTAGTAGTCAGACAGGAGGT | TTCTGAAAGCAGCTGTTGTATTTC |
| ERAP1 | Rs469783 | AAACCGCGACTTTGTGCAG | TGGCTATTACGTGCATTACG |
| ERAP1 | Rs469758 | CCATTCCACCTCTTCTGGGAG | TTGAGGCTTTGTTTTCTGGTTTC |
| ERAP1 | Rs10050860 | TTCACATTCCTTGAATTAACTAG | GAATTGAATCAACAAATGAACAATC |
| ERAP1 | Rs30187 | CCGTCAGAGCCCTTCATGTAG | TGTGTACACACCAGCATTGGC |
| ERAP1 | Rs26510 | GCAGTCTTATCTGGAATGAGGGT | CTAGAAGTCAATTACCATCTTCATCC |
| ERAP1 | Rs77311599 | TTACAAACAATCATAGATTCAACTG | GAAAATATTCACTAATCTTTGATTATAGAAC |
| ERAP1 | Rs27434 | GCTTTGGAGAAACAATTTTTCCT | CATCAAGTAAGCTTGGCATCAC |
| ERAP1 | Rs2287987 | GCTTTGGAGAAACAATTTTTCCT | CATCAAGTAAGCTTGGCATCAC |
| ERAP1 | Rs998509 | CTCAGCCTCCCAAACTGTTG | AAGAGTGGAGTCAAGGTGAGCC |
| ERAP1 | Rs766222717 | CTCAAAATCTGAAATGATGAAGGC | GTTCACTGTATTGGATAATTGGATTAC |
| ERAP1 | Rs26653 | CCAGCATAGTGAATGACAACTGTG | GTCACCACCTGCAGATATCTAGG |
| ERAP1 | Rs3734016 | TCTACTTTCGTGGTTCCCCAG | TCCTGGTTCATGTCAGAGCAC |
| ERAP1 | Rs151949 | GCAGGCGGGGAAGCC | GTGCACTTCCTACGCCTGATC |
Illumina second‐generation sequencing platform (Illumina Miseq) was used to sequence and analyze PCR products. The data analysis was performed to interpret the genotyping of each sample at each site. Sequence‐specific primer‐guided PCR reaction (PCR‐SSP) for HLA‐C*06:02 polymorphism (Gene accession No: OP585164.1). The primers are listed in Table 2. PCR amplification reaction: the total volume of the reaction was 25 μL, including PCR mixed buffer 12.5 μL, DNA model 3 μL, upstream primers 1 ul, downstream primers 1 μL, and double‐distilled water 7.5 μL. Reaction conditions: pre‐denaturation at 94°C for 180 s, denaturation at 94°C for 30 s, annealing at 60°C for 50 s, extension at 72°C for 60 s, and finally extension for 300 s for 35 cycles.
TABLE 2.
Primer sequences of HLA‐C*06:02 gene.
| Primer name | Upstream (5′‐3′) | Downstream (5′‐3′) | Length of PCR product |
|---|---|---|---|
| HLA‐C*06:02* | TACTACAACCAGAGCGAGGA | GGTCGCAGCCATACATCCA | 297 bp |
| Internal control | GCATCTTGCTCTGTGCAGAT | TGCCAAGTGGAGCACCCAA | 796 bp |
Note: *Gene accession no: OP585164.1.
2.4. Statistical Analysis
Statistical analysis was performed using the PLINK1.07 software package (http://pngu.mgh.harvard.edu/purcell/plink/). The minimum allele frequency (MAF) of 27 exons in the control group was calculated, and Hardy–Weinberg equilibrium (HWE) test was performed. The MAF of each genetic variant locus was compared between the two groups by chi‐squared test, and the odds ratio (OR) of the minimum allele and its 95% confidence interval (95% CI) were calculated. Cochran–Mantel–Haenszel (CMH) method was used for the pooled analysis of data at the primary screening stage and the validation stage. For the validation stage classification data, stratified analysis was performed according to the age of onset, family history of PsV, and HLA‐C*06:02, and chi‐square tests were performed. p < 0.05 was considered statistically significant.
3. Results
3.1. Primary Screening
In the primary screening stage, we sequenced 27 exons of the ERAP1 gene in 142 PsV vulgaris cases and 100 healthy controls, and a total of 157 genetic variants were found by sequencing. After quality control (removal of genetic variants that do not conform to HWE balance and removal of genetic variants with allele frequencies < 0.01), a total of 85 genetic variants were included in the statistical analysis. Statistical analysis showed that 13 genetic variants were associated with PsV (p < 0.05), including rs27980, rs27042, rs27044, rs469876, rs469783, rs469758, rs26510, rs27434, rs998509, rs766222717, rs3734016, rs151949, and rs77311599 (Table 3).
TABLE 3.
Association of 18 ERAP1 variants with psoriasis in screening and validated stage.
| SNP | BP | Allele | Preliminary screening test (142 cases and 100 controls) | Validation experiments (1030 cases and 965 controls) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MAF | χ 2 | p | OR | 95% CI | MAF | χ 2 | p | OR | 95% CI | |||||
| Case | Control | Case | Control | |||||||||||
| rs27980 | 96762191 | G | 0.183 | 0.330 | 13.740 | 2.10E‐04 | 0.46 | 0.30–0.69 | 0.465 | 0.500 | 4.407 | 0.036 | 0.87 | 0.76–0.99 |
| rs27042 | 96781236 | A | 0.134 | 0.225 | 6.870 | 0.009 | 0.53 | 0.33–0.86 | 0.264 | 0.272 | 0.237 | 0.626 | 0.96 | 0.83–1.12 |
| rs27044 | 96783148 | G | 0.616 | 0.510 | 5.407 | 0.020 | 1.54 | 1.08–2.22 | 0.479 | 0.440 | 5.594 | 0.018 | 1.17 | 1.03–1.33 |
| rs17482078 | 96783162 | T | 0.063 | 0.030 | 2.775 | 0.096 | 2.19 | 0.85–5.61 | 0.058 | 0.054 | 0.161 | 0.688 | 1.06 | 0.80–1.40 |
| rs469876 | 96785702 | G | 0.053 | 0.165 | 16.530 | 4.78E‐05 | 0.28 | 0.15–0.54 | 0.289 | 0.313 | 2.615 | 0.106 | 0.89 | 0.77–1.03 |
| rs469783 | 96785820 | C | 0.722 | 0.585 | 9.867 | 1.68E‐03 | 1.85 | 1.25–2.70 | 0.518 | 0.462 | 11.610 | 0.001 | 1.25 | 1.10–1.43 |
| rs469758 | 96786011 | C | 0.884 | 0.675 | 31.680 | 1.81E‐08 | 3.70 | 1.25–2.70 | 0.513 | 0.463 | 9.091 | 0.003 | 1.22 | 1.07–1.40 |
| rs10050860 | 96786506 | T | 0.077 | 0.050 | 1.434 | 0.231 | 1.60 | 0.74–3.45 | 0.028 | 0.025 | 0.271 | 0.603 | 1.12 | 0.73–1.73 |
| rs30187 | 96788627 | T | 0.599 | 0.510 | 3.742 | 0.053 | 1.42 | 0.99–2.08 | 0.510 | 0.459 | 9.646 | 0.002 | 1.23 | 1.08–1.40 |
| rs26510 | 96790207 | C | 0.778 | 0.575 | 22.820 | 1.78E‐06 | 2.56 | 1.75–3.85 | 0.511 | 0.459 | 9.870 | 0.002 | 1.23 | 1.08–1.40 |
| rs77311599 | 96793259 | T | 0.021 | 0.055 | 3.973 | 0.046 | 0.37 | 0.13–1.02 | 0.026 | 0.038 | 4.354 | 0.037 | 0.67 | 0.46–0.98 |
| rs27434 | 96793809 | A | 0.648 | 0.540 | 5.708 | 0.017 | 1.56 | 1.08–2.27 | 0.498 | 0.457 | 6.111 | 0.013 | 1.18 | 1.04–1.34 |
| rs2287987 | 96793832 | C | 0.060 | 0.030 | 2.312 | 0.128 | 2.06 | 0.80–5.32 | 0.057 | 0.055 | 0.134 | 0.715 | 1.05 | 0.80–1.40 |
| rs998509 | 96797092 | A | 0.063 | 0.145 | 8.917 | 2.83E‐03 | 0.40 | 0.21–0.74 | 0.141 | 0.168 | 5.060 | 0.024 | 0.81 | 0.68–0.97 |
| rs766222717 | 96797330 | C | 0.081 | 0.145 | 5.015 | 0.025 | 0.52 | 0.29–0.93 | 0.135 | 0.166 | 6.987 | 0.008 | 0.78 | 0.65–0.94 |
| rs26653 | 96803547 | G | 0.218 | 0.175 | 1.374 | 0.241 | 1.32 | 0.83–2.08 | 0.465 | 0.500 | 4.371 | 0.037 | 0.87 | 0.76–0.99 |
| rs3734016 | 96803761 | T | 0.085 | 0.145 | 4.404 | 0.036 | 0.54 | 0.31–0.97 | 0.132 | 0.168 | 9.002 | 0.003 | 0.76 | 0.63–0.91 |
| rs151949 | 96808142 | T | 0.113 | 0.215 | 9.383 | 2.19E‐03 | 0.46 | 0.28–0.76 | 0.280 | 0.278 | 0.008 | 0.928 | 1.01 | 0.87–1.16 |
Note: Case indicates the case group; Control indicates the control group.
Abbreviations: Allele, allele; BP, physical locus; MAF, minimum allele frequency; SNP, single nucleotide polymorphism.
3.2. Validation of the Association of ERAP1 With PsV
For validation, 1030 PsV cases and 965 healthy control samples were selected for second‐generation sequencing. A total of 18 genetic variants were selected, including 13 statistically significant sites in the primary screening stage, and five sites previously reported to be associated with PsV rs30187, rs17482078, rs2287987, rs10050860, and rs26653 (p > 0.05 in the primary screening stage). After quality control, 12 loci showed correlation with PsV, including rs27980, rs27044, rs469758, rs30187, rs26510, rs77311599, rs27434, rs998509, rs766222717, rs26653, rs3734016, and rs469783 (p < 0.05) (Table 3).
Among the loci analyzed, protective factors for the onset of PsV were rs27980_G (OR = 0.82), rs469876_G (OR = 0.84), rs77311599_T (OR = 0.63), rs998509_A (OR = 0.77), rs766222717_C (OR = 0.75), and rs3734016_T (OR = 0.73); the risk factors for the onset of PsV were rs27044_G (OR = 1.20), rs469783_C (OR = 1.32), rs469758_C (OR = 1.33), rs26510_C (OR = 1.33), rs30187_T (OR = 1.25), and rs27434_A (OR = 1.22). However, rs27042_A, rs2287987_C, rs17482078_T, rs26653_G, rs10050860_T, and rs151949_T were not significantly associated with PsV (p > 0.05).
Pooled analysis using CMH method for data in the primary screening stage and validation stage showed 12 significant ERAP1 gene variants, which were rs27980, rs27044, rs469758, rs30187, rs26510, rs77311599, rs27434, rs998509, rs766222717, rs3734016, rs974683, and rs469876 (p < 0.05) (Table 4).
TABLE 4.
Combined association analysis of 18 ERAP1 variants in screening and validated stages.
| SNP | BP | Allele | MAF | χ 2 | p | OR | 95% CI |
|---|---|---|---|---|---|---|---|
| rs27980 | 96762191 | G | 0.455 | 9.522 | 0.002 | 0.82 | 0.73–0.93 |
| rs27042 | 96781236 | A | 0.257 | 1.458 | 0.227 | 0.92 | 0.80–1.06 |
| rs27044 | 96783148 | G | 0.472 | 8.850 | 0.003 | 1.20 | 1.07–1.36 |
| rs17482078 | 96783162 | T | 0.055 | 0.847 | 0.358 | 1.13 | 0.87–1.48 |
| rs469876 | 96785702 | G | 0.278 | 6.181 | 0.013 | 0.84 | 0.73–0.96 |
| rs469783 | 96785820 | C | 0.510 | 17.710 | 2.57E‐05 | 1.32 | 1.15–1.47 |
| rs469758 | 96786011 | C | 0.520 | 19.820 | 8.50E‐06 | 1.33 | 1.17–1.51 |
| rs10050860 | 96786506 | T | 0.032 | 1.131 | 0.288 | 1.23 | 0.84–1.78 |
| rs30187 | 96788627 | T | 0.492 | 12.560 | 3.94E‐04 | 1.25 | 1.10–1.41 |
| rs26510 | 96790207 | C | 0.510 | 19.830 | 8.45E‐06 | 1.33 | 1.16–1.49 |
| rs77311599 | 96793259 | T | 0.033 | 6.985 | 0.008 | 0.63 | 0.44–0.89 |
| rs27434 | 96793809 | A | 0.491 | 9.598 | 0.002 | 1.22 | 1.07–1.37 |
| rs2287987 | 96793832 | C | 0.055 | 0.695 | 0.404 | 1.12 | 0.86–1.47 |
| rs998509 | 96797092 | A | 0.148 | 9.076 | 0.003 | 0.77 | 0.65–0.91 |
| rs766222717 | 96797330 | C | 0.146 | 10.260 | 0.001 | 0.75 | 0.63–0.90 |
| rs26653 | 96803547 | G | 0.450 | 2.733 | 0.098 | 0.90 | 0.79–1.02 |
| rs3734016 | 96803761 | T | 0.146 | 12.290 | 4.56E‐04 | 0.73 | 0.62–0.87 |
| rs151949 | 96808142 | T | 0.265 | 0.559 | 0.455 | 0.95 | 0.83–1.09 |
Abbreviations: Allele, allele; BP, physical locus; MAF, minimum allele frequency; SNP, single nucleotide polymorphism.
3.3. Stratified Analysis of the Association Between ERAP1 and PsV
First, we used HLA‐C*06:02 for stratified analysis of the association between ERAP1 gene variants and PsV in the Inner Mongolia Han population. When HLA‐C*06:02 was positive, there were 547 PsV cases and 165 healthy controls; when HLA‐C*06:02 was negative, there were 336 PsV cases and 790 healthy controls. The results showed that when HLA‐C*06:02 was positive, rs469783_C (p = 0.036, OR = 1.29), rs469758_C (p = 0.030, OR = 1.31), and rs26510_C (p = 0.047, OR = 1.28) were significantly associated with PsV, and there was no significant association when HLA‐C*06:02 was negative (Table 5).
TABLE 5.
Association of 18 ERAP1 variants with PsV stratified by HLA‐C*06:02.
| SNP | BP | Allele | HLA‐C*06:02 positive (547 cases and 165 controls) | HLA‐C*06:02 negative (336 cases and 790 controls) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MAF | χ 2 | p | OR | 95% CI | MAF | χ 2 | p | OR | 95% CI | |||||
| Case | Control | Case | Control | |||||||||||
| rs27980 | 96762191 | G | 0.453 | 0.503 | 2.486 | 0.115 | 0.82 | 0.64–1.05 | 0.481 | 0.499 | 0.550 | 0.459 | 0.93 | 0.78–1.12 |
| rs27042 | 96781236 | A | 0.252 | 0.282 | 1.186 | 0.276 | 0.86 | 0.65–1.13 | 0.283 | 0.269 | 0.437 | 0.508 | 1.07 | 0.87–1.31 |
| rs27044 | 96783148 | G | 0.494 | 0.439 | 3.011 | 0.083 | 1.25 | 0.97–1.60 | 0.460 | 0.442 | 0.556 | 0.456 | 1.07 | 0.89–1.29 |
| rs17482078 | 96783162 | T | 0.059 | 0.064 | 0.080 | 0.778 | 0.93 | 0.56–1.55 | 0.054 | 0.052 | 0.030 | 0.864 | 1.04 | 0.69–1.55 |
| rs469876 | 96785702 | G | 0.268 | 0.304 | 1.611 | 0.204 | 0.84 | 0.64–1.10 | 0.317 | 0.315 | 0.006 | 0.937 | 1.01 | 0.83–1.23 |
| rs469783 | 96785820 | C | 0.529 | 0.463 | 4.384 | 0.036 | 1.29 | 1.02–1.67 | 0.505 | 0.463 | 3.201 | 0.074 | 1.18 | 0.98–1.42 |
| rs469758 | 96786011 | C | 0.526 | 0.457 | 4.693 | 0.030 | 1.31 | 1.03–1.69 | 0.499 | 0.466 | 1.953 | 0.162 | 1.14 | 0.95–1.37 |
| rs10050860 | 96786506 | T | 0.025 | 0.033 | 0.500 | 0.479 | 0.76 | 0.36–1.62 | 0.033 | 0.023 | 1.645 | 0.200 | 1.46 | 0.82–2.59 |
| rs30187 | 96788627 | T | 0.520 | 0.461 | 3.600 | 0.058 | 1.26 | 0.99–1.61 | 0.497 | 0.459 | 2.658 | 0.103 | 1.16 | 0.97–1.39 |
| rs26510 | 96790207 | C | 0.523 | 0.461 | 3.930 | 0.047 | 1.28 | 1.01 to 1.63 | 0.496 | 0.460 | 2.359 | 0.125 | 1.15 | 0.96–1.38 |
| rs77311599 | 96793259 | T | 0.029 | 0.045 | 2.033 | 0.154 | 0.64 | 0.34–1.19 | 0.021 | 0.037 | 3.835 | 0.050 | 0.56 | 0.31–1.01 |
| rs27434 | 96793809 | A | 0.510 | 0.454 | 3.052 | 0.081 | 1.25 | 0.97–1.60 | 0.485 | 0.458 | 1.262 | 0.261 | 1.11 | 0.92–1.33 |
| rs2287987 | 96793832 | C | 0.059 | 0.067 | 0.235 | 0.628 | 0.88 | 0.54–1.46 | 0.054 | 0.052 | 0.041 | 0.840 | 1.04 | 0.69–1.57 |
| rs998509 | 96797092 | A | 0.136 | 0.146 | 0.172 | 0.678 | 0.93 | 0.65–1.32 | 0.146 | 0.172 | 2.343 | 0.126 | 0.82 | 0.64–1.06 |
| rs766222717 | 96797330 | C | 0.132 | 0.146 | 0.382 | 0.537 | 0.89 | 0.63–1.27 | 0.137 | 0.170 | 3.758 | 0.053 | 0.77 | 0.60–1.00 |
| rs26653 | 96803547 | G | 0.450 | 0.488 | 1.487 | 0.223 | 0.86 | 0.67–1.10 | 0.485 | 0.500 | 0.432 | 0.511 | 0.94 | 0.78–1.13 |
| rs3734016 | 96803761 | T | 0.127 | 0.146 | 0.791 | 0.374 | 0.85 | 0.60–1.21 | 0.139 | 0.172 | 3.758 | 0.053 | 0.78 | 0.60–1.00 |
| rs151949 | 96808142 | T | 0.268 | 0.295 | 0.865 | 0.352 | 0.88 | 0.67–1.16 | 0.296 | 0.275 | 0.976 | 0.323 | 1.11 | 0.90–1.36 |
Note: Case indicates the case group; Control indicates the control group.
Abbreviations: Allele, allele; BP, physical locus; MAF, minimum allele frequency; SNP, single nucleotide polymorphism.
Next, we focused on family history of PsV (122 cases with positive family history and 766 cases with negative family history), and the results showed that there were significant differences in the allele frequencies of eight ERAP1 genetic variants in patients with positive family history compared to control group: rs469783, rs469758, rs30187, rs26510, rs27434, rs998509, rs944222717, and rs3734016 (p < 0.05). There were significant differences in allele frequencies among nine ERAP1 genetic variants in patients with negative family history compared to control group: rs27044, rs469783, rs469758, rs30187, rs26510, rs77311599, rs27434, rs766222717, and rs3734016 (p < 0.05) (Table 6).
TABLE 6.
Association of 18 ERAP1 variants with PsV stratified by family history.
| SNP | BP | Allele | Family history of psoriasis (122 cases and 965 controls) | No family history of psoriasis (766 cases and 965 controls) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MAF | χ 2 | p | OR | 95% CI | MAF | χ 2 | p | OR | 95% CI | |||||
| Case | Control | Case | Control | |||||||||||
| rs27980 | 96762191 | G | 0.454 | 0.500 | 1.765 | 0.184 | 0.83 | 0.64–1.09 | 0.466 | 0.500 | 3.673 | 0.055 | 0.88 | 0.76–1.00 |
| rs27042 | 96781236 | A | 0.281 | 0.272 | 0.097 | 0.756 | 1.05 | 0.78–1.41 | 0.262 | 0.272 | 0.412 | 0.521 | 0.95 | 0.82–1.11 |
| rs27044 | 96783148 | G | 0.500 | 0.440 | 3.123 | 0.077 | 1.27 | 0.97–1.66 | 0.476 | 0.440 | 4.316 | 0.038 | 1.15 | 1.01 to 1.32 |
| rs17482078 | 96783162 | T | 0.070 | 0.054 | 0.945 | 0.331 | 1.30 | 0.76–2.21 | 0.056 | 0.054 | 0.020 | 0.888 | 1.02 | 0.76–1.37 |
| rs469876 | 96785702 | G | 0.265 | 0.313 | 2.294 | 0.130 | 0.79 | 0.58–1.07 | 0.292 | 0.313 | 1.727 | 0.189 | 0.90 | 0.78–1.05 |
| rs469783 | 96785820 | C | 0.538 | 0.462 | 4.884 | 0.027 | 1.35 | 1.03–1.77 | 0.515 | 0.462 | 9.595 | 0.002 | 1.24 | 1.08–1.42 |
| rs469758 | 96786011 | C | 0.537 | 0.463 | 4.733 | 0.030 | 1.35 | 1.03–1.76 | 0.510 | 0.463 | 7.133 | 0.008 | 1.21 | 1.05–1.38 |
| rs10050860 | 96786506 | T | 0.043 | 0.025 | 2.319 | 0.128 | 1.76 | 0.84–3.66 | 0.026 | 0.025 | 0.008 | 0.931 | 1.02 | 0.64–1.62 |
| rs30187 | 96788627 | T | 0.533 | 0.459 | 4.801 | 0.028 | 1.35 | 1.03–1.76 | 0.506 | 0.459 | 7.662 | 0.006 | 1.21 | 1.06–1.38 |
| rs26510 | 96790207 | C | 0.537 | 0.459 | 5.269 | 0.022 | 1.37 | 1.05–1.78 | 0.507 | 0.459 | 7.702 | 0.006 | 1.21 | 1.06–1.38 |
| rs77311599 | 96793259 | T | 0.029 | 0.038 | 0.477 | 0.490 | 0.76 | 0.35–1.67 | 0.026 | 0.038 | 4.335 | 0.037 | 0.66 | 0.45–0.98 |
| rs27434 | 96793809 | A | 0.530 | 0.457 | 4.514 | 0.034 | 1.34 | 1.02–1.76 | 0.493 | 0.457 | 4.319 | 0.038 | 1.16 | 1.01 to 1.32 |
| rs2287987 | 96793832 | C | 0.067 | 0.055 | 0.629 | 0.428 | 1.25 | 0.72–2.15 | 0.056 | 0.055 | 0.025 | 0.875 | 1.02 | 0.76–1.38 |
| rs998509 | 96797092 | A | 0.107 | 0.168 | 6.000 | 0.014 | 0.59 | 0.39–0.90 | 0.146 | 0.168 | 2.904 | 0.088 | 0.85 | 0.71–1.03 |
| rs766222717 | 96797330 | C | 0.105 | 0.166 | 5.930 | 0.015 | 0.59 | 0.38–0.91 | 0.140 | 0.166 | 4.574 | 0.032 | 0.81 | 0.67–0.98 |
| rs26653 | 96803547 | G | 0.433 | 0.500 | 3.734 | 0.053 | 0.77 | 0.58–1.00 | 0.470 | 0.500 | 2.938 | 0.087 | 0.89 | 0.78–1.02 |
| rs3734016 | 96803761 | T | 0.103 | 0.168 | 6.816 | 0.009 | 0.57 | 0.37–0.87 | 0.137 | 0.168 | 6.110 | 0.013 | 0.79 | 0.65–0.95 |
| rs151949 | 96808142 | T | 0.275 | 0.278 | 0.009 | 0.924 | 0.99 | 0.73–1.33 | 0.280 | 0.278 | 0.017 | 0.895 | 1.01 | 0.87–1.18 |
Note: Case indicates case group; Control indicates control group.
Abbreviations: Allele, allele; MAF, minimum allele frequency; SNP, single nucleotide polymorphism.
The age of onset was then divided into early‐onset (age of onset ≤ 40 years) and late‐onset PsV (age of onset > 40 years) for stratified analysis (519 early‐onset PsV and 965 healthy controls; 369 late‐onset PsV and 965 healthy controls). The results showed that among early‐onset PsV, there were eight genetic variants of ERAP1 genetic variants associated with PsV: rs27044, rs469783, rs469758, rs30187, rs26510, rs27434, rs766222717, and rs3734016 (p < 0.05). Two ERAP1 genetic variants were associated with disease in late‐onset PsV: rs27980 and rs3734016 (p < 0.05) (Table 7).
TABLE 7.
Association of 18 ERAP1 variants with PsV stratified by onset age.
| SNP | BP | Allele | Early‐onset psoriasis (519 cases and 965 controls) | Late‐onset psoriasis (369 cases and 965 controls) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MAF | χ 2 | p | OR | 95% CI | MAF | χ 2 | p | OR | 95% CI | |||||
| Case | Control | Case | Control | |||||||||||
| rs27980 | 96762191 | G | 0.472 | 0.500 | 1.980 | 0.159 | 0.90 | 0.77–1.04 | 0.454 | 0.500 | 4.282 | 0.039 | 0.83 | 0.70–0.99 |
| rs27042 | 96781236 | A | 0.251 | 0.272 | 1.463 | 0.226 | 0.90 | 0.76–1.07 | 0.283 | 0.272 | 0.373 | 0.541 | 1.06 | 0.88–1.28 |
| rs27044 | 96783148 | G | 0.494 | 0.440 | 7.873 | 0.005 | 1.24 | 1.07–1.45 | 0.458 | 0.440 | 0.667 | 0.414 | 1.07 | 0.91–1.27 |
| rs17482078 | 96783162 | T | 0.050 | 0.054 | 0.256 | 0.613 | 0.92 | 0.65–1.29 | 0.068 | 0.054 | 1.765 | 0.184 | 1.27 | 0.89–1.79 |
| rs469876 | 96785702 | G | 0.280 | 0.313 | 3.479 | 0.062 | 0.85 | 0.72–1.01 | 0.301 | 0.313 | 0.381 | 0.537 | 0.94 | 0.78–1.14 |
| rs469783 | 96785820 | C | 0.530 | 0.462 | 12.460 | 4.16E‐04 | 1.31 | 1.13–1.53 | 0.501 | 0.462 | 3.304 | 0.069 | 1.17 | 0.99–1.39 |
| rs469758 | 96786011 | C | 0.524 | 0.463 | 9.694 | 0.002 | 1.28 | 1.09–1.49 | 0.499 | 0.463 | 2.621 | 0.105 | 1.15 | 0.97–1.37 |
| rs10050860 | 96786506 | T | 0.027 | 0.025 | 0.049 | 0.826 | 1.06 | 0.64–1.76 | 0.030 | 0.025 | 0.477 | 0.490 | 1.22 | 0.70–2.13 |
| rs30187 | 96788627 | T | 0.517 | 0.459 | 9.048 | 0.003 | 1.26 | 1.08–1.47 | 0.500 | 0.459 | 3.689 | 0.055 | 1.18 | 0.10–1.40 |
| rs26510 | 96790207 | C | 0.519 | 0.459 | 9.800 | 0.002 | 1.27 | 1.09–1.48 | 0.499 | 0.459 | 3.350 | 0.067 | 1.17 | 0.99–1.39 |
| rs77311599 | 96793259 | T | 0.026 | 0.038 | 2.907 | 0.088 | 0.68 | 0.43–1.06 | 0.026 | 0.038 | 2.475 | 0.116 | 0.67 | 0.40–1.11 |
| rs27434 | 96793809 | A | 0.499 | 0.457 | 4.721 | 0.030 | 1.19 | 1.02–1.38 | 0.496 | 0.457 | 3.226 | 0.073 | 1.17 | 0.99–1.39 |
| rs2287987 | 96793832 | C | 0.051 | 0.055 | 0.143 | 0.706 | 0.94 | 0.67–1.32 | 0.066 | 0.055 | 1.226 | 0.268 | 1.22 | 0.86–1.74 |
| rs998509 | 96797092 | A | 0.144 | 0.168 | 2.941 | 0.086 | 0.83 | 0.67–1.03 | 0.137 | 0.168 | 3.694 | 0.055 | 0.79 | 0.62–1.01 |
| rs766222717 | 96797330 | C | 0.135 | 0.166 | 5.113 | 0.024 | 0.78 | 0.63–0.97 | 0.136 | 0.166 | 3.752 | 0.053 | 0.79 | 0.62–1.00 |
| rs26653 | 96803547 | G | 0.462 | 0.500 | 3.800 | 0.051 | 0.86 | 0.74–1.00 | 0.469 | 0.500 | 1.896 | 0.169 | 0.89 | 0.75–1.05 |
| rs3734016 | 96803761 | T | 0.133 | 0.168 | 6.046 | 0.014 | 0.76 | 0.62–0.95 | 0.131 | 0.168 | 5.411 | 0.020 | 0.75 | 0.58–0.96 |
| rs151949 | 96808142 | T | 0.278 | 0.278 | 0.000 | 0.994 | 1.00 | 0.84–1.19 | 0.282 | 0.278 | 0.030 | 0.862 | 1.02 | 0.84–1.23 |
Note: Case indicates case group; Control indicates control group.
Abbreviations: Allele, allele; MAF, minimum allele frequency; SNP, single nucleotide polymorphism.
3.4. Haplotype Analysis of the Association Between ERAP1 and PsV
We examined haplotypes in the validation samples by using not only the 12 associated variants (rs27980, rs27044, rs469783, rs469758, rs30187, rs26510, rs77311599, rs27434, rs998509, rs766222717, rs26653, rs3734016) but also the four associated nonsynonymous mutation (rs27044, rs30187, rs26653, and rs3734016). The haplotype analysis of the 12 associated variants showed that a risk haplotype (TCCCTCCAGACC) was significantly associated with PsV (p = 0.00528, OR = 1.679 (1.03–2.74)) (Table 8). However, the haplotype analysis of the four associated nonsynonymous mutations showed that three risk haplotypes were associated with PsV (p = 0.000154) (Table 9). The most risk haplotype was E730/K528/R127/E56, with OR = 1.946 (1.26; 2.99). All four associated nonsynonymous mutations were highly LD with each other (Table 10).
TABLE 8.
Haplotype analysis of 12 associated SNPs in validated stage.
| Haplotypes | All samples a | HLA‐C*06:02 positive samples b | HLA‐C*06:02 negative samples c | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Freq of haplotype | OR (95% CI) | Freq of haplotype | OR (95% CI) | Freq of haplotype | OR (95% CI) | ||||
| Case | Control | Case | Control | Case | Control | ||||
| GCTTCTCGGAGC | 0.241 | 0.255 | 1 | 0.232 | 0.254 | 1 | 0.255 | 0.253 | 1 |
| GGCCTCCAGACC | 0.084 | 0.073 | 1.247 (0.94; 1.65) | 0.080 | 0.089 | 1.018 (0.603; 1.72) | 0.092 | 0.072 | 1.236 (0.84; 1.82) |
| TCTTCTCGGAGC | 0.079 | 0.069 | 1.186 (0.883; 1.59) | 0.077 | 0.086 | 0.9622 (0.567; 1.63) | 0.080 | 0.066 | 1.173 (0.765; 1.8) |
| TGCCTCCAGACC | 0.381 | 0.358 | 1.122 (0.952; 1.32) | 0.401 | 0.341 | 1.298 (0.938; 1.8) | 0.352 | 0.362 | 0.9707 (0.773; 1.22) |
| GCTTCTCGACGT | 0.129 | 0.153 | 0.8483 (0.682; 1.06) | 0.128 | 0.134 | 0.9908 (0.651; 1.51) | 0.129 | 0.158 | 0.7862 (0.577; 1.07) |
| TCTTCTTGGACC | 0.026 | 0.037 | 0.6994 (0.468; 1.05) | 0.029 | 0.046 | 0.666 (0.346; 1.28) | 0.021 | 0.035 | 0.783 (0.249; 2.46) |
| TCCCTCCAGACC | 0.025 | 0.016 | 1.679 (1.03; 2.74) | 0.022 | 0.017 | 1.359 (0.506; 3.65) | 0.031 | 0.016 | 0.568 (0.304; 1.06) |
| TCTTCTCGACGT | 0.000 | 0.010 | — | 0.000 | 0.000 | — | 0.000 | 0.011 | 1.988 (1.06; 3.73) |
| GCCCTCCAGACC | 0.000 | 0.000 | — | 0.000 | 0.011 | — | 0.000 | 0.000 | — |
Likelihood ratio test: χ 2 = 18.4, df = 6, p = 0.00528.
Likelihood ratio test: χ 2 = 6, df = 6, p = 0.423.
Likelihood ratio test: χ 2 = 14.6, df = 7, p = 0.042.
TABLE 9.
Haplotype analysis of four associated nonsynonymous mutations in validated stage.
| Allotypes | Haplotypes | All samples a | HLA‐C*06:02 positive samples b | HLA‐C*06:02 negative samples c | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Freq of haplotype | OR (95% CI) | Freq of haplotype | OR (95% CI) | Freq of haplotype | OR (95% CI) | |||||
| Case | Control | Case | Control | Case | Control | |||||
| E730/R528/P127/K56 | CCGT | 0.132 | 0.165 | 1 | 0.136 | 0.142 | 1 | 0.136 | 0.170 | 1) |
| E730/R528/P127/E56 | CCGC | 0.327 | 0.326 | 1.257 (1.03; 1.54) | 0.344 | 0.339 | 1.049 (0.71; 1.55) | 0.344 | 0.322 | 1.32 (0.998; 1.75) |
| Q730/K528/R127/E56 | GTCC | 0.468 | 0.431 | 1.373 (1.13; 1.66) | 0.448 | 0.430 | 1.3 (0.889; 1.9) | 0.448 | 0.433 | 1.291 (0.987; 1.69) |
| E730/K528/R127/E56 | CTCC | 0.035 | 0.022 | 1.946 (1.26; 2.99) | 0.040 | 0.027 | 1.249 (0.55; 2.84) | 0.040 | 0.020 | 2.383 (1.35; 4.2) |
| E730/R528/R127/E56 | CCCC | 0.030 | 0.047 | 0.7841 (0.536; 1.15) | 0.023 | 0.055 | 0.6986 (0.362; 1.35) | 0.023 | 0.046 | 0.6162 (0.339; 1.12) |
Likelihood ratio test: χ 2 = 22.6, df = 4, p = 0.000154.
Likelihood ratio test: χ 2 = 5.56, df = 4, p = 0.235.
Likelihood ratio test: χ 2 = 17, df = 4, p = 0.00191.
TABLE 10.
LD analysis of four associated nonsynonymous mutations (r 2/D′).
| Mutations | rs27044 | rs30187 | rs26653 | rs3734016 |
|---|---|---|---|---|
| rs27044 | 1 | |||
| rs30187 | 0.882/0.988 | 1 | ||
| rs26653 | 0.737/0.965 | 0.833/0.976 | 1 | |
| rs3734016 | 0.148/0.993 | 0.166/1.000 | 0.190/1.000 | 1 |
4. Discussion
Psoriasis is a common chronic, inflammatory, and relapsing disease that can be divided into PsV, erythrodermic psoriasis, pustular psoriasis, and articular psoriasis. Psoriasis is associated with a variety of common diseases, including arthritis, cardiovascular disease, obesity, hypertension, and diabetes (Zhu et al. 2013). PsV is generally recognized as a genetic disorder that is influenced by ethnic, regional, and environmental factors. Genetic studies have shown that PSORS1 on chromosome 6p21.3 is the most significant genetic factor associated with PsV, and the possible risk allele in PSORS1 is HLA‐C*06:02 (Dand et al. 2019). ERAP1 is a gene associated with PsV, located on chromosome 5q15, and encodes an aminopeptidase that belongs to the M1 family of zinc‐finger metallomatrix peptidases. Recent studies have shown that the interaction of ERAP1 with related ERAP2 is crucially involved in PsV (Marusina et al. 2023; Zhang et al. 2022; Wu and Zhao 2021; Wiśniewski et al. 2018).
Two distinct conformational states of ERAP1 were observed, namely, the open form and the closed form. Domain IV in the closed form interacts with domains I and II, but in one open form domain IV is oriented away from domain II. The structural difference between the two forms is attributed to the differences in the conformation of domain III, resulting in a dramatic topological change in domain IV, and the closed form of ERAP1 creates an active catalytic pocket in the large cavity formed by domains I, II, and IV (Hanson et al. 2019). Lys528 is located on the surface of domain III, where it forms an interface between domain III and domains II and IV. Allelic alterations in s528 may affect the conformational dynamics of ERAP1 and lead to changes in its catalytic properties. R725Q and Q730E decrease the activity of the peptide N‐terminal and ERAP1 expression, respectively, resulting in an overall decrease in MHC class I expression (Reeves et al. 2013).
Genetic variants of ERAP1 rs72773968 (T12I), rs3734016 (E56K), rs26653 (P127R), rs26618 (I276M), rs27895 (G346D), rs2287987 (M349V), rs30187 (K528R), rs10050860 (D575N), rs17482078 (R725Q), and rs27044 (Q730E) have been shown to be associated with ankylosing spondylitis and Behcet's disease (García‐Medel et al. 2012; Remmers et al. 2015). Haplotype K528 / Q730 has been reported to be a risk factor for PsV, while P127 and E730 are protective factors for PsV (Ombrello, Kastner, and Remmers 2015). Polymorphisms in the ERAP1 gene may alter the conformational structure, specificity, and activity of proteins. rs17482078 (R725Q) and rs27044 (Q730E) located on the internal surface of the C‐terminal cavity may affect substrate sequence or specificity. rs26653 (R127P), rs30187 (K528R), and rs10050860 (D575N) are located in the linker region and are able to indirectly affect the specificity and activity of the enzyme (Tri, Tran, et al. 2015). In various autoimmune diseases ERAP1 variants show interactions with MHC class I risk alleles. The interaction between HLA‐C*06:02 and ERAP1 may affect PsV, but the specific mechanism remains unknown (Alvarez‐Navarro 2014; López de Castro 2018).
To screen significant genetic variants, we performed second‐generation sequencing of all 27 exons of ERAP1 in 142 patients with PsV and 100 healthy controls and identified 13 significant genetic variants, including rs27980, rs27042, rs27044, rs469876, rs469783, rs469758, rs26510, rs27434, rs998509, rs766222717, rs3734016, rs151949, and rs77153199. To minimize error, a large sample size was used for second‐stage validation sequencing. The results of primary screening sequencing and validation sequencing were combined by CMH method, and we showed that the significant genetic variant rs26653_G in the validation stage was not significant in the pooled statistical analysis (p = 0.098), and rs469876_G, which was not significant in the validation stage, was associated with PsV in the pooled analysis (p = 0.013).
HLA‐C*06:02 has the strongest association with PsV and is a risk factor for the pathogenesis of PsV (Zhou et al. 2016). ERAP1 plays a role in processing peptides for presentation to class I MHC, and HLA‐C*06:02 belongs to MHC class I molecules (Ghosh, Di Marco, and Stevanović 2019). HLA‐C*06:02 has specific peptide binding motifs and peptide presentation capacity and triggers CD8+ T cell‐specific immune responses. We grouped HLA‐C*06:02 negativity and positivity with the 18 selected gene variants selected for validation sequencing, and the results showed that when HLA‐C*06:02 was positive, rs469783_C, rs469758_C, and rs26510_C were associated with the onset of PsV and were risk factors for the onset of PsV. However, when HLA‐C*06:02 was negative, there was no significant correlation at the above 18 gene loci. These results suggest that ERAP1 may produce or destroy psoriatogenic peptides for antigen presentation by HLA‐C*06:02, and different genetic variants of ERAP1 may do it with different efficiency.
In the previous study, Fu et al. (2018) analyzed 143 cases in China and showed that the CC genotype and C allele of rs26653 were significantly associated with an increased risk of early‐onset PsV but not late‐onset PsV. It is well known that early‐onset PsV is much stronger associated with HLA‐C*06:02 than late‐onset disease. However, there was no significant difference in rs26653 early‐onset versus late‐onset PsV in our study.
Previous reports have indicated that a large proportion of patients with PsV have a family history, and the chance of developing PsV is increased in first‐ or second‐degree relatives of patients with PsV (Masouri et al. 2016). Fu et al. (2018) performed correlation analysis based on family history and showed that rs26653_CC genotype was significantly associated with increased risk of PsV in patients with family history, and there was no significant association between rs26653 genetic variants and PsV risk in patients without a family history. However, there was no significant association between rs26653 and negative or positive family history in our study. The reason may be due to the fact that Northern Han from Inner Mongolia are different from Southern Han but similar to Mongols by many molecular polymorphisms (Tian et al. 2024; Gu et al. 2022; Yu and Li 2021).
In conclusion, by two‐stage association analysis we found that 12 genetic variants of ERAP1 gene were associated with PsV in Inner Mongolia Han nationality. HLA‐C*06:02 may interact with ERAP1 gene and affect the risk of PsV in Inner Mongolia Han nationality. In HLA‐C*06:02 positive samples, ERAP1 genetic variants rs469783_C, rs469758_C, and rs26510_C were associated with PsV and were risk factors for PsV. A risk haplotype of four‐nonsynonymous mutation (E730/K528/R127/E56) is associated with PsV, which might interact with HLA‐C*06:02.
Author Contributions
X.L., J.B., L.A., F.‐R.Y., B.Y., Y.‐P.H., N.L., W.‐Y.D., Z.‐Q.S., and X.‐X.L. collected and analyzed the samples and performed data analysis. J.‐W.H. designed and supervised the study and wrote the manuscript. All authors read and approved the manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (81660513, 82260619), Natural Science Foundation of Inner Mongolia (2022MS08005, 2018MS08030), Inner Mongolia Science and Technology Plan (2019GG082), and scientific and technological innovative research team for inner Mongolia medical university of “Basic and clinical research of psoriasis” (YKD2022TD030).
Funding: This study was supported by the National Natural Science Foundation of China (81660513, 82260619), Natural Science Foundation of Inner Mongolia (2022MS08005, 2018MS08030), Inner Mongolia Science and Technology Plan (2019GG082), and scientific and technological innovative research team for inner Mongolia medical university of “Basic and clinical research of psoriasis” (YKD2022TD030).
Xin Li and Jia Bao contributed equally to this work.
Data Availability Statement
All data are available upon request to the corresponding author.
References
- Alvarez‐Navarro, C. 2014. “López de Castro JA.ERAP1, Function and Role in Ankylosing Spondylitis and Other MHC‐Associated Diseases.” Molecular Immunology 57, no. 1: 12–21. [DOI] [PubMed] [Google Scholar]
- Bergboer, J. G. , Oostveen A. M., de Jager M. E., et al. 2012. “Paediatric‐Onset Psoriasis Is Associated With ERAP1 and IL23R Loci, LCE3CLCE3B Deletion and HLA‐C*06:02.” British Journal of Dermatology 167, no. 4: 922–925. [DOI] [PubMed] [Google Scholar]
- Dand, N. , Duckworth M., Baudry D., et al. 2019. “HLA‐C*06:02 Genotype Is a Predictive Biomarker of Biologic Treatment Response in Psoriasis.” Journal of Allergy and Clinical Immunology 143, no. 6: 2120–2130. [DOI] [PubMed] [Google Scholar]
- Das, A. , Chandra A., Chakraborty J., et al. 2017. “Associations of ERAP1 Coding Variants and Domain Specific Interaction With HLA‐C*06:02 in the Early Onset Psoriasis Patients of India.” Human Immunology 78, no. 11–12: 724–730. [DOI] [PubMed] [Google Scholar]
- Fanoni, D. , Venegoni L., Vergani B., et al. 2019. “Evidence for a Role of Autoinflammation in Early‐Phase Psoriasis.” Clinical and Experimental Immunology 198, no. 3: 283–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fu, Y. , Li X., Chen Y., Liu R., Wang R., and Bai N.. 2018. “Association of ERAP1 Gene Polymorphisms With the Susceptibility to Psoriasis Vulgaris: A Case‐Control Study.” Medicine 97, no. 41: e12828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- García‐Medel, N. , Sanz‐Bravo A., Van Nguyen D., et al. 2012. “Functional Interaction of the Ankylosing Spondylitis‐Associated Endoplasmic Reticulum Aminopeptidase 1 Polymorphism and HLA‐B27 In Vivo.” Molecular & Cellular Proteomics 11, no. 11: 1416–1429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghosh, M. , Di Marco M., and Stevanović S.. 2019. “Identification of MHC Ligands and Establishing MHC Class I Peptide Motifs.” Methods in Molecular Biology 1988: 137–147. [DOI] [PubMed] [Google Scholar]
- Gu, J. Q. , Zhao H., Guo X. Y., Sun H. Y., Xu J. Y., and Wei Y. L.. 2022. “A High‐Performance SNP Panel Developed by Machine‐Learning Approaches for Characterizing Genetic Differences of Southern and Northern Han Chinese, Korean, and Japanese Individuals.” Electrophoresis 43, no. 11: 1183–1192. [DOI] [PubMed] [Google Scholar]
- Guo, Q. , Qi J., Liang X., et al. 2023. “Analysis of Differentially Expressed Genes in Verruca Vulgaris vs. Adjacent Normal Skin by RNA‐Sequencing.” Biocell 47, no. 11: 2435–2443. [Google Scholar]
- Hanson, A. L. , Morton C. J., Parker M. W., Bessette D., and Kenna T. J.. 2019. “The Genetics, Structure and Function of the M1 Aminopeptidase Oxytocinase Subfamily and Their Therapeutic Potential in Immune‐Mediated Disease.” Human Immunology 80, no. 5: 281–289. [DOI] [PubMed] [Google Scholar]
- López de Castro, J. A. 2018. “How ERAP1 and ERAP2 Shape the Peptidomes of Disease‐Associated MHC‐I Proteins.” Frontiers in Immunology 9: 2463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lysell, J. , Pukadyov L., Kockum I., et al. 2013. “Genetic Association With ERAP1 in Psoriasis Is Confined to Disease Onset After Puberty and Not Dependent on HLA‐C*06:02.” Journal of Investigative Dermatology 133, no. 2: 411–417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marusina, A. I. , Ji‐Xu A., Le S. T., et al. 2023. “Cell‐Specific and Variant‐Linked Alterations in Expression of ERAP1, ERAP2, and LNPEP Aminopeptidases in Psoriasis.” Journal of Investigative Dermatology 143: 1157–1167.e10. [DOI] [PubMed] [Google Scholar]
- Masouri, S. , Stefanaki I., Ntritsos G., et al. 2016. “A Pharmacogenetic Study of Psoriasis Risk Variants in a Greek Population and Prediction of Responses to Anti‐TNF‐α and Anti‐IL‐12/23 Agents.” Molecular Diagnosis & Therapy 20, no. 3: 221–225. [DOI] [PubMed] [Google Scholar]
- Ombrello, M. J. , Kastner D. L., and Remmers E. F.. 2015. “Endoplasmic Reticulum‐Associated Amino‐Peptidase 1 and Rheumatic Disease: Genetics.” Current Opinion in Rheumatology 27, no. 4: 349–356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Reeves, E. , Edwards C. J., Elliott T., and James E.. 2013. “Naturally Occurring ERAP1 Haplotypes Encode Functionally Distinct Alleles With Fine Substrate Specificity.” Journal of Immunology 191, no. 1: 35–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Remmers, E. F. , Takeuchi M., Ombrello M. J., et al. 2015. “Identification of ERAP1 Protein Allotypes in the Turkish Population and Evaluation of Their Contributions to Behçet's Disease Risk.” Pediatric Rheumatology Online Journal 13, no. 1: 14.25943381 [Google Scholar]
- Shahid, M. , Rehman K., Akash M. S. H., et al. 2023. “Biochemical Association Between the Prevalence of Genetic Polymorphism and Myocardial Infarction.” Biocell 47, no. 3: 473–484. [Google Scholar]
- Szentkereszty‐Kovács, Z. , Fiatal S., Szegedi A., et al. 2019. “The Prevalence of ADH1B and OPRM1 Alleles Predisposing for Alcohol Disposal Are Increased Consumption in the Hungarian Psoriasis Population.” Archives of Dermatological Research 311, no. 6: 435–442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang, H. , Jin X., Li Y., et al. 2014. “A Large‐Scale Screen for Coding Predisposing Variants to Psoriasis.” Nature Genetics 46, no. 1: 45–50. [DOI] [PubMed] [Google Scholar]
- Tian, W. , Li L. X., Cheng W., Jin H. K., and Zhang S. S.. 2024. “Leukocyte Immunoglobulin‐Like Receptor A3 Gene Deletion in Five Chinese Populations and Protective Association With Nasopharyngeal Carcinoma.” International Journal of Immunogenetics 51, no. 1: 32–38. [DOI] [PubMed] [Google Scholar]
- Tri, M. , and Tran P. D.. 2015. “Endoplasmic Reticulum Aminopeptidase 1 and Rheumatic Disease: Functional Variation.” Current Opinion in Rheumatology 27, no. 4: 357–363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wiśniewski, A. , Matusiak Ł., Szczerkowska‐Dobosz A., Nowak I., Łuszczek W., and Kuśnierczyk P.. 2018. “The Association of ERAP1 and ERAP2 Single Nucleotide Polymorphisms and Their Haplotypes With Psoriasis Vulgaris Is Dependent on the Presence or Absence of the HLA‐C*06:02 Allele and Age at Disease Onset.” Human Immunology 79, no. 2: 109–116. [DOI] [PubMed] [Google Scholar]
- Wu, X. , and Zhao Z.. 2021. “Associations Between ERAP1 Gene Polymorphisms and Psoriasis Susceptibility: A Meta‐Analysis of Case‐Control Studies.” BioMed Research International 2021: 5515868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiaolan, D. , Tinglin W., Qi S., et al. 2010. “Epidemiological Survey of Psoriasis in Six Provinces and Cities of China.” Chinese Journal of Dermatovenereology 24, no. 7: 598–601. [Google Scholar]
- Yang, Q. , Liu H., Qu L., et al. 2013. “Investigation of 20 Non‐HLA (Human Leucocyte Antigen) Susceptibility Psoriasis Loci in Chinese Patients With Psoriatic Arthritis and Psoriasis Vulgaris.” British Journal of Dermatology 168, no. 5: 1060–1065. [DOI] [PubMed] [Google Scholar]
- Yu, X. , and Li H.. 2021. “Origin of Ethnic Groups, Linguistic Families, and Civilizations in China Viewed From the Y Chromosome.” Molecular Genetics and Genomics 296, no. 4: 783–797. [DOI] [PubMed] [Google Scholar]
- Zhang, C. , Qin Q., Li Y., et al. 2022. “Multifactor Dimensionality Reduction Reveals the Effect of Interaction Between ERAP1 and IFIH1 Polymorphisms in Psoriasis Susceptibility Genes.” Frontiers in Genetics 13: 1009589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhen, Q. , Yang Z., Wang W., et al. 2019. “Genetic Study on Small Insertions and Deletions in Psoriasis Reveals a Role in Complex Human Diseases.” Journal of Investigative Dermatology 139, no. 11: 2302–2312. [DOI] [PubMed] [Google Scholar]
- Zhou, F. , Cao H., Zuo X., et al. 2016. “Deep Sequencing of the MHC Region in the Chinese Population Contributes to Studies of Complex Disease.” Nature Genetics 48, no. 7: 740–746. [DOI] [PubMed] [Google Scholar]
- Zhu, K. J. , Zhang C., Li M., Zhu C. Y., Shi G., and Fan Y. M.. 2013. “Leptin Levels in Patients With Psoriasis: A Meta‐Analysis.” Clinical and Experimental Dermatology 38, no. 5: 478–483. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data are available upon request to the corresponding author.
