Abstract
The prevalence of obesity-associated precocious puberty is gradually increasing, but the relationship between gut flora and obesity-associated precocious puberty remains unclear.We analysed the gut flora characteristics of a clinical sample of 30 girls aged 5–8 years using 16s rRNA sequencing. An obesity rat model and a rat model of gut flora transplantation were also constructed. Body weight, body length, abdominal girth, food intake, vulva opening time, and gonadal index were monitored. The secretion levels of estradiol (E2), total cholesterol (TC), follicle-stimulating hormone (FSH), luteinizing hormone (LH), and thyroglobulin (Tg) were analyzed by ELISA. In addition, ovarian and uterine development was observed by HE staining. The mRNA and protein levels of kisspeptin-1 (Kiss-1) and gonadotropin-releasing.We found that the relative abundance of Dialister, Bacteroides, Bifidobacterium, Collinsella, and Romboutsia may be associated with obesity-associated precocious puberty. Obesity promotes gonadal development, and the gut flora of patients with obesity and obesity-associated precocious puberty regulated the gene and protein expression of Kiss-1 and GnRH, promoting precocious puberty and hypothalamic-gonadal axis hormone secretion in rats. In contrast, probiotic intervention slowed gonadal development, reduced hormone secretion, and attenuated hypothalamic-gonadal axis activity. Gut flora promoted obesity-associated precocious puberty by influencing the hypothalamic-gonadal axis, and probiotics have a therapeutic and preventive role in obesity-associated precocious puberty, which may be associated with the Kiss-1/GnRH pathway. These findings may provide some new strategies for clinical treatment and prevention of obesity-associated precocious puberty in girls.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-024-80140-8.
Keywords: Gut flora, Obesity, Precocious puberty, Children
Subject terms: Bacteria, Bacterial pathogenesis, Bacterial physiology, Clinical microbiology, Gastroenterology
Introduction
With the improvement of living standards, changes in dietary structure and environment, and other factors, more and more children are experiencing precocious puberty, which has become one of the most common endocrine diseases in children, and the incidence rate is increasing year by year1. Precocious puberty seriously endangers the physical and mental health of immature children, especially girls (This may be related to biological development; The main biological difference is the postnatal testicular developmental events that are required for pubertal activation in boys whereas the ovary is fully developed at the time of birth and does not require any major developmental transition during the prepubertal stage and solely depends upon the gonadotropins for its activation. So young girls are naturally prone to precocious puberty2–5). It can lead to risk-taking behaviors in healthy adolescents, short stature, and obesity in adults, as well as an increased risk of diabetes mellitus and pre-menopausal breast cancers in children with precocious puberty in adulthood6. Therefore, exploring the mechanism of precocious puberty in girls and improving the current situation of precocious puberty in girls are hot and challenging issues that need to be solved urgently.
Gut flora and obesity are increasingly linked, and the two influence each other7. Intestinal microbes weigh approximately 1–2 kg and contain more than 100 times as many genes as the human genome8. Gut flora has a critical symbiotic relationship with the human body throughout evolution and also protects and supports the host’s intestinal mucosal structures9. In recent years, it has been found that gut flora is involved in the control of body mass and energy balance and that disorders of gut flora can promote obesity and type II diabetes mellitus in humans. At the same time, gut flora disorders can affect the body’s energy intake and metabolic balance, thus changing the body phenotype10–12.
No direct experimental data shows the correlation between gut flora and precocious puberty in children. Therefore, this study proposes to analyze the structure and differences in the composition of gut flora in normal, obesity non-premature, and obesity-premature girls using 16 S rRNA gene sequencing technology. Secondly, we will construct an obesity rat model to observe the role of obesity in the progression of precocious puberty and use the gut flora transplantation technology to study the effect of gut flora of obesity precocious girls on the growth and development of rats and the onset of obesity-associated precocious puberty; Finally, we will use different probiotic interventions to observe the role of probiotics in improving the development of obesity precociousness. Our study may provide new ideas for preventing and treating obesity-associated precocious puberty in girls, as well as some basis for the clinical application of probiotics to intervene in obesity-associated precocious puberty in children.
Materials and methods
Recruitment of study participants
After the clinical samples were collected, 16 S rRNA gene sequencing technology was used to analyze the composition and differences of intestinal microbiota in normal, obesity non-precocious puberty and obesity-associated precocious puberty girls. The subjects of this study were girls who visited our hospital. Patients who met the inclusion criteria were introduced to the purpose and content of the study, and publicity materials were distributed. Informed consent was obtained from parents / legal guardian, and one-on-one questionnaires were arranged to ensure the accuracy and consistency of the questionnaires, of which special parts had to be surveyed under the guidance of the investigator. All diagnoses involved in the study were confirmed by two or more physicians.
Inclusion criteria of research subjects
Inclusion criteria for the obesity group: age 5–8 years old, meeting the diagnostic criteria for childhood obesity6, excluding obesity caused by other diseases, such as hormonal drug-induced and central nervous system diseases and other related obesity and metabolic syndrome. Patients were not taking probiotics or antibiotics, had no symptoms of gastrointestinal disorders, and had no history of infections or vaccinations during the 2 weeks prior to stool sample collection. The patients were divided into an obesity-associated precocious puberty group and an obesity non-precocious puberty group with 10 patients in each group. The diagnosis of precocious puberty was in accordance with international diagnostic criteria13,14 and girls with secondary central precocious puberty were excluded.
Inclusion criteria for the normal body mass group
Ten healthy, non-obesity girls aged 5–8 years with normal development (no secondary sexual characteristics and no menstruation) were selected as the control group. No probiotics, antibiotics, gastrointestinal symptoms, infections or vaccinations during the 2 weeks prior to stool sampling. Fresh morning faeces of the study subjects were placed in sterile dry boxes and delivered to the laboratory within 4 h at 4 °C and stored in a -80 °C refrigerator. The study was reviewed and approved by Ethics Committee of Jinhua People’s Hospital (No. IBR-20220009-R).
Animals and treatments
SD rat obesity model
Ten female SD rats and six male SD rats (Shanghai Slake Animal Co. China) were randomly divided into two groups: the parental model group (n = 5 females, n = 3 males) and the parental control group (n = 5 females, n = 3 males). The model group was fed with high-fat chow for 8 weeks, while the control group was fed with normal rat chow. 8 weeks later, the parental rats in the model group with body mass 20% greater than that of the control group were screened for mating, and female littermates bred from rats in the parental model group set as the model group, and female littermates bred from rats in the parental control group served as the control group. The model group was modelled in the same way as the parental rats and fed for 5 weeks after weaning at 21 days of age, whereas the control group was fed with normal feed for 5 weeks15–19.
From 21 days of age onwards, we observed the opening of the vulva every day, and after the opening of the vulva, we performed vaginal smears every day to observe the estrous cycle, and weighed the littermates. Body length and abdominal circumference were measured once every fortnight. Both groups of experimental mice ended the experiment at 56 days of age, and blood was taken from the abdominal aorta, and the uterus and ovaries were sampled. Ovarian index and uterine index were calculated based on organ index = organ wet weight/body weight. Hypothalamic tissues were rapidly isolated and placed in liquid nitrogen for freezing. Probiotic intervention: a combination of 3 probiotics (bifidobacterium, Limosilactobacillus, Romboutsia) was treated daily by gavage from modelling day 21 until execution.
Transplantation model of gut flora
Twenty-five 2-week-old female SD rats were randomly divided into five groups, the control group (control), the healthy girl’s gut flora group (healthy), the obesity girl’s flora group (obesity), the obesity precocious girl’s flora group (obesity precocious), and the obesity precocious girl’s flora + probiotic group (obesity precocious + precocious), with five rats in each group. SD rats were fed for 2 weeks, and the faeces of healthy girls, obesity girls and obesity precocious girls were transplanted into the intestinal tract of SD male rats (5 g of faeces + 100 ml of physiological saline were mixed and filtered, and the filtrate was extracted; the filtrate was enemas at 1.6 ml/kg). The control group was not given special treatment. Specific enema method: 10% chloral hydrate 400 mg/kg intraperitoneal injection of anaesthetized rats, take the supine position, 3.5 F rubber hose inserted into the colon from the anus 8–10 cm, keep the anus high position for about 5 min.
General records
The probiotic group was administered to the rats at 28 days of age. In the other groups, body mass (g), food intake (g), excreta, and activity were measured daily from 28 days of age, and body length (cm) and abdominal circumference (cm) were measured every 2 weeks. 5 weeks later, the rats were anaesthetised (1% pentasorbital sodium (40 mg/kg)) and bled to death. This study was reviewed and approved by Ethics Committee of Jinhua People’s Hospital (No. IBR-20220009-R), furthermore, all methods were performed in accordance with the relevant guidelines and regulations; and this study was reported in accordance with ARRIVE guidelines.
RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)
After extraction of total RNA from different subgroups of hypothalamus, the purity and concentration of the RNA were determined, and the RNA was reverse-transcribed to cDNA using the Revertaid First Strand cDNA Synthesis Kit (Thermo). cDNA, primers, and DEPC water were added to a 20-µL system and mixed, and automated sample amplification was performed using the SsoAdvance Universal SYBR Green SuperMix (Bio-Rad) system to amplify the samples. The cycling conditions were (i) pre-denaturation (1 cycle at 95 °C for 30 s), (ii) cycling reaction (40 cycles at 95 °C for 10 s and 60 °C for 30 s), (iii) dissolution profile (95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s for 1 cycle). The results were calculated using Bio-Rad CFX Manager 3.1 software. Finally, the relative expression levels of the target genes were determined using the 2-ΔΔCt method. The primers used are listed in Table 1.
Table 1.
The primers of target genes.
| Name | Sequence(5′-3′) |
|---|---|
| GAPDH | AATGGGCAGCCGTTAGGAAA |
| GCGCCCAATACGACCAAATC | |
| Kiss-1 | CCCACTTTGGGGAGCCATTA |
| CAGTAGCAGCTGGCTTCCTC | |
| Gn-RH | AAAATGTATGCATAGCAGCAATAGA |
| TGAGTTCATTTTGGGAATTTGGAA |
Western blotting analysis
Total proteins were extracted from the tissues by adding an appropriate amount of RIPA lysis buffer (Beo Tianmei Biotech, China). Quantification was performed using the BCA method. The proteins were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk. The PVDF membrane was then cut and incubated overnight at 4 °C with primary antibody and then incubated with secondary antibody for 1 h at room temperature. The PVDF membrane was washed for 30 min after antibody binding and developed with enhanced ECL reagent, and the results were detected using a gel imaging system. The following antibodies were used: Kiss-1 (1:1000, Abcam, UK), Gn-RH (1:1000, Shanghai Sangon Biotechnology Co., Ltd.). The secondary antibody used was goat anti-rabbit secondary antibody (1:10000). The relative protein expression was calculated by the ImageJ system using GAPDH as a reference.
HE staining
Uterus and ovarian tissues were fixed embedded and sectioned. Firstly, de-waxing treatment using xylene was carried out twice at room temperature for 20 min each time; Then ethanol was treated with different concentrations (70-100%). Mayer hematoxylin staining for 5 min followed by alkaline PBS washing for 2 min for bluing and 3 min for rinsing in running water. Next, eosin staining, 10 min at room temperature followed by a quick wash in distilled water. Using 70%, 80%, and 90% ethanol, speed washing; then 95% ethanol washing for 30 s; 100% ethanol, washing for 3 min, 2 times and then using xylene, washing for 5 min, 2 times. Finally, the tissue slides were sealed with neutral gum and photographed for observation.
Enzyme-linked immunosorbent assay (Elisa)
Serum samples from each group were collected into 1.5 ml EP tubes. Samples and reagents were used after multiplicative dilution and antibody dilution. After setting up the standard and sample wells, the samples were incubated at 37 °C for 90 min. Then, add biotin-labelled antibody, cover with new membrane and incubate at 37 °C for 1 h. After antibody incubation, 100ul/well of HRP-Streptavidin Affinity Binding Complex (SABC) working solution was added and incubated for half an hour with the membrane covered. Finally, 90ul of TMB substrate was added to each well and incubated for 10–20 min covered with a membrane, stopping the reaction when the colour changed gradually. After the colour changed from blue to yellow, 50ul of termination buffer was added to each well and the absorbance value of OD450 was measured to calculate the relative expression levels of estradiol (E2), total cholesterol (TC), follicle stimulating hormone (FSH), luteinising hormone (LH) and thyroglobulin (Tg) in each sample.
Statistical analysis
All the data were statistically analyzed using GraphPad Prism software (Graph Pad Software, Inc., USA). The measurement data are expressed as the means ± standard deviations. Comparisons between two groups were made using a t test (normally distributed information), and multiple comparisons were made using one-way ANOVA (normal distribution with chi-square variance). Nonparametric tests were used if the data were not normally distributed or if the variance was not homogeneous. The results were considered statistically significant at a P value < 0.05.
Results
The composition of gut flora varies between populations
In the 16 S rDNA sequencing results, we first analysed the sample quality and sequencing depth, as shown in Supplementary Tables 1 and Supplementary Table 2, with 30 cases with valid data quality and sufficient sequencing depth. Next, we selected the relative abundance top 30 from 618 colony species (Supplementary Table 3). Analysed at the genus level, Bacteroides had the highest relative abundance, followed by Bifidobacterium and Faecalibacterium (Fig. 1).
Fig. 1.
Abundance of top 30 gut flora stacked bar chart (A total of 30 samples, 10 in each group).
In addition, there was a significant imbalance in the ratio of Baceteroidetes/Firmicutes in the obesity and obesity-related precocious puberty groups (Fig. 2A). Further by heat map analysis, it was found that the relative abundance of Dialister and Bacteroides showed an increasing trend (P < 0.05) in obesity and obesity-associated precocious puberty group compared to the control group, while the relative abundance of Bifidobacterium, Collinsella, and Romboutsia showed a decreasing trend (P < 0.05), which suggested that these floras may be associated with both obesity and precocious puberty. Furthermore, in the obesity-associated precocious puberty group, the abundance of Ruminococcus_gnavus, Agathobacter, Fusicatenibacter and Erysipelotrichaceae_UCG-003 were significantly lower than the control group and obesity group. However, the abundance of Phascolarctobacterium, Alistipes, Subdoligranulum, Faecalibacterium, Lachnospiraceae_unclassified, Eubacterium_eligens_group in the obesity-associated precocious puberty group were significantly higher than in the control group and obesity group (P < 0.05, Fig. 2B). In addition, plasma leptin levels were significantly imbalanced (Fig. 2C). These results suggest that gut flora may be involved in obesity-related precocious puberty.
Fig. 2.
Characteristics of intestinal flora among different populations. (A): Ratio of Baceteroidetes/Firmicutes. (B): Abundance of top 30 gut flora heat map analysis (A total of 30 samples, 10 in each group). (C): Serum leptin levels were examined by Elsa. (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001 vs. normal group; Results were analyzed by one-way ANOVA)
Gut flora promoted obesity-associated precocious puberty in rats
Obesity promotes gonadal development
To further explore the role played by gut flora in obesity-associated precocious puberty, we constructed an obesity rat model and a gut flora transplantation model. We initially explored the therapeutic role of probiotics. In the obesity rat model, body weight was monitored daily from 21 days of age; Abdominal girth and body length were measured biweekly. The rate of change in abdominal girth, body weight and body length of rats in the obesity model group was significantly increased compared to the control group, which was somewhat improved by the probiotic intervention (Fig. 3A–C). Meanwhile, the model group had a shorter opening time of the vulva and a significant increase in uterine and ovarian indices, which were improved by probiotics (Fig. 3D–F). These data illustrated that obesity affects the development of sexual organs in rats and that probiotics have a therapeutic effect on obesity.
Fig. 3.
General condition monitoring in obesity model rats. (A): Rats were tested for body length every two weeks. (B): Rats were tested for abdominal girth every two weeks (C): Rats were tested for body weight every two weeks. (D): Vulva opening time. (E), (F): Uterus and ovaries index. (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001 vs. normal group; Results were analyzed by one-way ANOVA).
We examined the secretory function of the hypothalamic-gonadal axis further to explore the effects of obesity on the gonads. As demonstrated in Fig. 4A–E, Tg, TC, LH, FSH, and E2 secretion levels were significantly increased in the obesity rat model compared to the control group and significantly down-regulated after the probiotic intervention. The mRNA and protein levels of Kiss-1 and Gn-RH were examined by using q-PCR and Western blotting. Both mRNA and protein levels of Kiss-1 and Gn-RH were significantly up-regulated in the obesity model group, which were inhibited by probiotics (Fig. 4F–H).
Fig. 4.
Hypothalamic-gonadal axis function tests. (A)–(E): Secretion levels of Tg (A), TC (B), LH (C), FSH (D), and E2 (E). (F), (G): The mRNA levels of Kiss-1 and Gn-RH were examined by q-pcr. (H): The protein levels of Kiss-1 and Gn-RH were examined by Western blotting (Gels/blots were cut from different parts and exposed, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001 vs. normal group; Results were analyzed by one-way ANOVA).
We also further assessed the development of the ovary and uterus using HE staining. In the control group, the follicles of rats were mainly primordial follicles with tightly arranged luteal cells; in the Obesity model group, multiple mature follicles and secondary follicles were seen, and the luteal cells were partially collapsed and lysed. However, the Obesity model + Probiotics group had fewer follicles than the Obesity model group, with predominantly primary and secondary oocytes and tightly arranged luteocytes. In the HE staining of the uterus, the endometrial layer, plasma layer, and myometrium in the control group were normal and structurally complete, and the endometrium was rich in tubular glands. In the Obesity model group, the endometrial structure was destroyed, the interstitial structure was loose, and the endometrial glands were rare. The Obesity model + Probiotics group had a more complete endometrial structure and more endometrial glands than the Obesity model group (Fig. 5). All of the above results suggest that obesity promotes the onset of precocious puberty and that probiotics can delay the development of sexual organs.
Fig. 5.
HE staining assessed ovarian and uterine development. (A): The development of the ovary was observed by HE staining. (B): Uterine development observed by HE staining.
Gut flora from obesity patients promoted precocious puberty in rats
Based on these findings above, we constructed a gut flora transplantation rat model to explore whether obesity-associated precocious puberty was associated with gut flora. Abdominal girth, body weight, food intake, and body length were significantly higher in both obesity and obesity precocious groups, especially in the obesity precocious group, compared to the control group (Fig. 6A–D); Type phenomena were also observed in the secretion levels of Tg, TC, LH, FSH, and E2, as well as in the levels of Kiss-1 and Gn-RH mRNA and proteins (Figs. 6E–K and 7A); However, the above results can be partially reversed by probiotics.
Fig. 6.
General conditions and hormone secretion levels in patient gut flora transplanted rats. (A)–(D): Monitoring of abdominal circumference (A), body weight (B), food intake (C) and body length (D) in rats. (E)–(I): Secretion levels of Tg(E), TC(H), LH(G), FSH(G), and E2(I). J-K: The mRNA levels of Kiss-1 and Gn-RH were examined by using q-pcr. (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001 vs. normal group; Results were analyzed by one-way ANOVA).
Fig. 7.
Hypothalamic protein levels and HE staining of the uterus and ovaries. (A): The protein levels of Kiss-1 and Gn-RH were examined by using Western blotting. (B): The development of the ovary was observed by HE staining. (C): Uterine development observed by HE staining. (Gels/blots were cut from different parts and exposed, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001 vs. normal group; Results were analyzed by one-way ANOVA).
In addition, we further verified the above conclusions using HE staining. In the ovarian HE results, the control group of rats had predominantly primordial follicles and primary follicles with tightly arranged luteal cells; the obesity group saw multiple atretic follicles and a small number of primary follicles with partially collapsed and lysed luteal cells. In the obesity precocious group, a large number of mature follicles and secondary follicles were seen, and the luteal cells were loosely arranged, with most of the luteal cells collapsed and lysed. However, there were fewer follicular cells in the probiotics group than in the obesity precocious group; fewer atretic follicles were seen, and the luteal cells were more tightly arranged and intact (Fig. 7B).
In the uterine HE results, the endometrial layer, plasma layer, and myometrium were clearly visible in the control group, and the lamina propria of the mucosa contained abundant tubular glands. In the Obesity group, the endometrial structure was disrupted, the mesenchymal structure was loose, and the uterine glands were rare; and in the obesity precocious group, the endometrium was severely detached, with a markedly disrupted structure, sparse mesenchyme, and an incomplete epithelial structure; Fewer uterine glands. After using the probiotics to intervene, the structure of the uterus was significantly improved, the endometrium was intact, and the number of glands increased (Fig. 7C). These data suggest that gut flora derived from patients with obesity and obesity-associated precocious puberty promotes gonadal maturation in rats. Gut flora plays a vital role in obesity patients with precocious puberty, and probiotics had preventive and therapeutic effects on precocious puberty, which may be related to the Kiss-1 and Gn-RH pathway.
Discussion
Gut flora lived symbiosis with the host, contributing to homeostasis and regulating immune function. However, dysbiosis of the microbiota can lead to bodily dysfunction and disease20–23. Our study found that Ruminococcus_gnavus, Agathobacter, Fusicatenibacter Erysipelotrichaceae_UCG-003, Phascolarctobacterium, Alistipes, Subdoligranulum, Faecalibacterium, Lachnospiraceae_unclassified, and Eubacterium_eligens_group may be precocious puberty-associated floras. Our study also further confirms the results of previous studies, such as Dialister and Bacteroides flora were increased, Bifidobacterium and Romboutsia were decreased in obese patients24–27.
There is a close relationship between obesity and precocious puberty, and the accumulation of fat promotes precocious puberty in children28. In addition, it has been found that obesity regulates gonadal development through the kiss-1/GnRH pathway, and overexpression of the KiSS-1R gene leads to the development of precocious puberty29. Moreover, gut flora is, in turn, associated with obesity7,8,30–32. In this study, we further demonstrated that obesity may promote precocious puberty by modulating the kiss-1/GnRH pathway. In addition, in a rat model of intestinal flora transplantation, we found that rats transplanted with intestinal flora from obese and obese patients with precocious puberty had abnormal activation of the kiss-1/GnRH pathway, increased secretion of hormones from the hypothalamic-gonadal axis, and accelerated gonadal development. When we intervened using probiotics, rats showed reduced obesity symptoms, decreased hypothalamic-gonadal axis activity, suppressed gonadal development, and decreased kiss-1 and GnRH gene and protein levels. These results suggest that probiotics have preventive and therapeutic effects on obesity and precocious puberty, which may be related to the kiss-1/GnRH pathway.
However, our research still needs to be answered. For example, it is still unclear which group or groups dominate among the flora associated with obesity. These flora with relevance had not been further investigated. We found some unique flora in obesity-associated precocious puberty, which suggests that obesity and precocious puberty may be mutually etiological, and the relationship between obesity and precocious puberty still needs to be further explored. In addition, the animal model we used was the SD rat, which may be somewhat different from the primate model. Finally, we found that probiotics have preventive and therapeutic effects on obesity-associated precocious puberty, and it is not known whether this is mediated only through the kiss-1/GnRH pathway.
In summary, our study found that gut flora promoted obesity-associated precocious puberty by influencing the hypothalamic-gonadal axis, and probiotics have a therapeutic and preventive role in obesity-associated precocious puberty, which may be associated with the Kiss-1/GnRH pathway. These findings may provide some new strategies for clinical treatment and prevention of obesity-associated precocious puberty in girls.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
Not applicable.
Author contributions
M.G. conceived and designed the study. Y.Q. and X.F. conducted most of the experiments and data analysis, and wrote the manuscript. Y.C., and M.D. participated in collecting data and helped to draft the manuscript. All authors reviewed and approved the manuscript.
Funding
1. This research was supported by The Jinhua Science and Technology Plan Project 2022-3-115. 2. The Basic Public Welfare Research Program of Zhejiang Province (Grant No. LGD22H160010).
Data availability
Data Availability Statement: The datasets supporting the conclusions of this article are included within the article (Due to the principle of confidentiality of the article, all data are reasonably accessible to corresponding authors).
Declarations
Competing interests
The authors declare no competing interests.
Ethical approval
Study approval statement: This study protocol was reviewed and approved by the Ethics Committee of Jinhua People’s Hospital (No. IBR-20220009-R).
Human or animal rights
All participants were informed about the study and signed an informed consent form, and the study was approved by the Ethics Committee of Jinhua People’s Hospital (No. IBR-20220009-R).
Consent for publication
The authors declared that all participants consented to the publication of this study.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Wu, S. et al. Diagnostic value of pituitary volume in girls with precocious puberty. BMC Pediatr.20(1), 425 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gu, Q., Du, Q., Xia, L., et al. Mechanistic insights into EGCG’s preventive effects on obesity-induced precocious puberty through multi-omics analyses (Food Funct, 2024). [DOI] [PubMed]
- 3.Read, J.E. et al. Disorders of Puberty and Neurodevelopment: A Shared Etiology? (Ann N Y Acad Sci, 2024). [DOI] [PMC free article] [PubMed]
- 4.Krishna K.B. & Silverman, L.A. Diagnosis of central precocious puberty. Endocrinol. Metab. Clin. North. Am.53(2), 217–227 (2024). [DOI] [PubMed] [Google Scholar]
- 5.Huttunen, H. et al. Central precocious puberty in boys: Secular trend and clinical features. Eur. J. Endocrinol.190(3), 211–219 (2024). [DOI] [PubMed] [Google Scholar]
- 6.Hampl, S.E. et al. Clinical practice Guideline for the evaluation and treatment of children and adolescents with obesity. Pediatrics, 151(2). (2023). [DOI] [PubMed]
- 7.Gomes, A.C., Hoffmann, C. & Mota, J.F. The human gut microbiota: Metabolism and perspective in obesity. Gut Microbes. 9(4), 308–325 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gérard, P. Gut microbiota and obesity. Cell. Mol. Life Sci.73(1), 147–162 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Puljiz, Z. et al. Obesity, gut microbiota, and metabolome: From pathophysiology to nutritional interventions. Nutrients, 15(10). (2023). [DOI] [PMC free article] [PubMed]
- 10.Maruvada, P. & Leone, V. The human microbiome and obesity: Moving beyond associations. Cell. Host Microbe. 22(5), 589–599 (2017). [DOI] [PubMed] [Google Scholar]
- 11.Ma, Q. et al. Research progress in the relationship between type 2 diabetes mellitus and intestinal flora. Biomed. Pharmacother.117, 109138 (2019). [DOI] [PubMed] [Google Scholar]
- 12.Barratt, M.J., Ahmed, T. & Gordon, J.I. Gut microbiome development and childhood undernutrition. Cell. Host Microbe. 30(5), 617–626 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bradley S H, Lawrence N, Steele C, et al. Precocious puberty. Bmj. 368, l6597. (2020). [DOI] [PubMed] [Google Scholar]
- 14.Latronico, A.C., Brito, V.N. & Carel, J.C. Causes, diagnosis, and treatment of central precocious puberty. Lancet Diabetes Endocrinol.4(3), 265–274 (2016). [DOI] [PubMed] [Google Scholar]
- 15.Frigoli, G.F., Quadreli, D.H. & Santos, D.P.D. et al. Low protein uptake during peripuberty impairs the testis, epididymis, and spermatozoa in pubertal and adult Wistar rats. J. Dev. Orig Health Dis.15, e23 (2024). [DOI] [PubMed] [Google Scholar]
- 16.Granger, K. et al. Murine uterine gland branching is necessary for gland function in implantation. Mol. Hum. Reprod., 30(6). (2024). [DOI] [PMC free article] [PubMed]
- 17.Heijmans, N. et al. Transcriptomic analysis of pubertal and adult virgin mouse mammary epithelial and stromal cell populations. J. Mammary Gland Biol. Neoplasia. 29(1), 13 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sisk-Hackworth, L. et al. Genetic hypogonadal (Gnrh1(hpg)) mouse model uncovers influence of reproductive axis on maturation of the gut microbiome during puberty. bioRxiv, (2024).
- 19.Ullah, R. et al. Alternate-day fasting delays pubertal development in normal-weight mice but prevents high-fat diet-induced obesity and precocious puberty. Nutr. Diabetes. 14(1), 82 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hou, K. et al. Microbiota in health and diseases. Signal. Transduct. Target. Ther.7(1), 135 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bai, Z. et al. Gut microbiome and metabolome alterations in overweight or obese adult population after weight-loss bifidobacterium breve BBr60 intervention: a randomized controlled trial. Int. J. Mol. Sci., 25(20). (2024). [DOI] [PMC free article] [PubMed]
- 22.Jiang, C., Zhan, Q. & Zeng C. The 5-HT-related gut-brain axis in obesity. Life Sci., 123171. (2024). [DOI] [PubMed]
- 23.Lietzén, M.S. et al. Regular exercise training induces more changes on intestinal glucose uptake from blood and microbiota composition in leaner compared to heavier individuals in monozygotic twins discordant for BMI. Nutrients, 16(20). (2024). [DOI] [PMC free article] [PubMed]
- 24.Raglan, O., Macintyre, D.A., Mitra, A. et al. The association between obesity and weight loss after bariatric surgery on the vaginal microbiota. Microbiome9(1), 124 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zafar, H. & Saier, Jr. M.H. Gut Bacteroides species in health and disease. Gut Microbes. 13(1), 1–20 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gong, H. et al. The abundance of bifidobacterium in relation to visceral obesity and serum uric acid. Sci. Rep.12(1), 13073 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ruan, S. et al. The synergic effects and mechanism of KGM-DMY complex in the prevention of obesity and enhancement of fatigue resistance in mice. Food Funct.14(6), 2607–2620 (2023). [DOI] [PubMed] [Google Scholar]
- 28.Wang, M. et al. Microbial reconstitution reverses early female puberty induced by maternal high-fat diet during lactation. Endocrinology, 161(2). (2020). [DOI] [PMC free article] [PubMed]
- 29.Teles, M.G., Silveira, L.F., Tusset, C. et al. New genetic factors implicated in human GnRH-dependent precocious puberty: The role of kisspeptin system. Mol. Cell. Endocrinol.346(1–2), 84–90 (2011). [DOI] [PubMed] [Google Scholar]
- 30.Asadi, A. et al. Obesity and gut-microbiota-brain axis: A narrative review. J. Clin. Lab. Anal.36(5), e24420 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Patterson, E., Ryan, P.M., Cryan, J.F. et al. Gut microbiota, obesity and diabetes. Postgrad. Med. J.92(1087), 286–300 (2016). [DOI] [PubMed] [Google Scholar]
- 32.Tseng, C.H. & Wu C.Y. The gut microbiome in obesity. J. Formos. Med. Assoc.118(Suppl 1), S3–s9 (2019). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data Availability Statement: The datasets supporting the conclusions of this article are included within the article (Due to the principle of confidentiality of the article, all data are reasonably accessible to corresponding authors).







