Nanocurcumin Decreases Nucleotide-Binding Oligomerization Domain-Like Receptor Family Pyrin Domain-Containing 3 Complex Expressions in An Experimental Testicular Torsion Model

Abstract

Background:

Testicular torsion is a surgical emergency leads to severe acute ischemia injuries, and may eventually cause male infertility. The nucleotide-binding oligomerization domain (NOD)-like receptor family pyrin domaincontaining 3 (NLRP3) inflammasome is involved in testicular torsion pathophysiology. The aim of this study was to evaluate the effects of nanocurcumin (nCur) on testicular tissue and the NLRP3 inflammasome components.

Materials and Methods:

In this experimental study, male Wistar rats (n=36) were randomly divided into six equal groups: controls, ischemia-reperfusion (I/R), I/R+nCur (50 or 100 mg/kg thirty minutes before reperfusion), and I/ R+nCur (50 or 100 mg/kg thirty minutes before reperfusion and continued for seven days). The left testis was rotated 720 (2×360) degrees counterclockwise to induce testicular torsion. After two hours of ischemia, detorsion was performed. At the end of treatment, an orchiectomy was carried out. The testis histopathology and the mRNA levels of NLRP3, apoptosis-associated speck-like protein (ASC), and Caspase-1 were evaluated.

Results:

Our results revealed that, testicular I/R had a detrimental effect on testis histology such as the number of spermatogonia (14.5 ± 0.57, P<0.001) and the seminiferous tubules epithelium thickness (28.5 ± 11.7, P=0.007). It also significantly increased the expression of the NLRP3 inflammasome components (P<0.001). Treatment with nCur (in both doses) improved testicular damage and significantly reduced the expression of NLRP3 (P=0.007), ASC (P=0.003), and Caspase-1 (P<0.001).

Conclusion:

These results imply that nCur might be a useful therapeutic strategy in the field of reproductive medicine to diminish the side effects of testicular I/R via its anti-inflammatory properties and may be employed as adjuvant therapy to lessen testicular torsion complications.

Introduction

Every year, approximately 3.8 out of every 100,000 young males under the age of 18 are affected by a surgical emergency caused by torsion of the spermatic cord and its contents (1). This twisting initially prevents venous drainage, and then equalization of venous and arterial pressures leads to testicular ischemia and arterial flow impairment (2). This acute ischemia can damage the testicle and result in infertility (3). The length of torsion and the degree of rotation of the spermatic cord determine the extent of ischemia (2). To prevent testicular injury, early-stage detection and detorsion surgery are crucial. However, it is important to note that testicular detorsion surgery, which restores blood supply to ischemic testicular tissue may actually worsen tissue damage (3). This is because reactive oxygen species (ROS) are produced when oxygen-rich blood returns to the testis after reperfusion (4). Excessive ROS production affects proteins, lipids, and DNA, ultimately leading to the loss of germ cell. In addition, it causes lipid peroxidation and inflammation, both of which have a destructive effect on testicular tissue (3).

The production of cytosolic protein complexes called inflammasomes controls the host's immune response to microbial infection and cellular damage (5). Upon in flammasome activation, procaspase-1 converts to caspase-1, which facilitates the conversion of pro-interleukin-18 (IL-18) and pro-IL-1β into their active forms (6). There exist several types of inflammasomes, and the nucleotide-binding oligomerization domain (NOD)-like receptor family pyrin domain containing 3 (NLRP3) inflammasome has demonstrated significant involvement in several diseases (7), such as spinal cord injury (8), stroke (9), diabetic mellitus (10) and infertility (11). This inflammasome has three following components: a NOD-like receptor NLRP3, an adapter protein called apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and caspase-1 (12). In animal models of testicular ischemia and reperfusion, it has been shown that the NLRP3 inflammasome's activation is what causes inflammatory and apoptotic reactions (7). Given the diverse range of proteins involved in regulating inflammasome formation, it is possible to hypothesize that treatments targeting inflammasome components may be effective in preventing inflammasome activation and mitigating its detrimental consequences in injured tissues (13, 14).

Curcumin (Cur), the principal bioactive element of turmeric, possesses various therapeutic benefits such as anti-inflammatory, antioxidant, and anti-cancer properties (15). However, its therapeutic utility has been limited due to its poor water solubility and subsequent low systemic bioavailability. To overcome these restrictions, researchers have employed various techniques to reduce the particle size of Cur. Nanocurcumin (nCur), a nanoparticle formulation of Cur, has been shown to be more effective and more soluble than Cur (16). It has been found that nCur is more beneficial than Cur at minimizing the negative effects of varicocele on testicular tissue (17). Regarding the fact that Cur can suppress NLRP3 inflammasome activity (18), nCur also has this capacity and can insert anti-inflammatory properties (19). It could reduce the secretion of inflammatory cytokines such as IL-1β and IL-6 in patients suffering from COVID-19 (15). Additionally, administration of nCur to streptozocin-induced diabetic rats has been shown to reduce the number of apoptotic cells as well as the expression of NLRP3 and IL-1β (20). Considering the involvement of NLRP3 in the pathology of testicular ischemia and reperfusion (I/R), in this work, we sought to suppress NLRP3 inflammasome activity using nCur and lessen the damaging effects of I/R on testicular tissue.

Materials and Methods

Animals

Adult male Wistar rats (200-250 g, Pasteur, Iran) were divided randomly into six equal groups (6 in each group): i. Control, ii. I/R, iii. I/R+nCur50 (21), iv. I/ R+nCur100, v. I/R+8/nCur50, and vi. I/R+8/nCur100. nCur (SinaCurcumin™, Iran) was administered intraperitoneally. In groups III and IV, animals received a single dose of 50 and 100 mg/kg nCur 30 minutes before reperfusion, respectively, and in groups V and VI, the injection was continued for one week (totaling eight doses).

Surgical procedure

Animals were anesthetized with 100 mg/kg ketamine and 10 mg/kg xylazine (both from Alfasan, Iran). The abdominal area was cleaned and shaven. To reach the abdominal cavity, incisions were made in the skin and muscles of the peritoneum and abdominal wall. To produce testicular torsion, the left testicle was removed from the scrotum, placed within the abdominal cavity, and rotated 720° (2×360) counterclockwise for two hours (22). Finally, the testis was put back in place in its typical position, and the muscles and abdominal skin were sutured (3). Thirty minutes before reperfusion, the first dose of nCur was administered (23), and in two experimental groups, the treatment was continued for one week. All animals were sacrificed under deep anesthesia eight days after surgery, and a left orchiectomy was performed. Each testis was divided into two sections. One part was fixed with Bouin’s solution for histopathological analysis, and another part was placed in liquid nitrogen and kept at -70°C for later usage.

Testis histopathology

After fixation of testis tissue with Bouin fixative, tissue processing including dehydration, embedding, sectioning, and staining with hematoxylin and eosin was done. Using Image Tools Analysis Software, the quantity of spermatogonia and the thickness of the seminiferous tubule epithelium were measured at a 20x magnification in a minimum of 100 seminiferous tubules for each animal in each of the testis’s 20 microscopic fields (24).

RNA isolation and cDNA synthesis

In order to assess the level of gene expression in various studied groups, total RNA was extracted using the RNXplus reagent (Yekta Tajhiz Azma, Iran) in accordance with the manufacturer's instructions. The extracted RNA was dissolved in diethylpyrocarbonate-treated water (DEPC treated water; SinaClon, Iran), and its wavelength of 260 nm was measured spectrophotometrically. Next, using the RevertAid TM First Strand cDNA Synthesis Kit (Parstous, Iran), 2 μg of total RNA was used for cDNA synthesis in a total volume of 20 μl. The cDNA was kept at -70°C until it was used.

Quantitative reverse transcriptase polymerase chain reaction

Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed to assess the expression of NLRP3, ASC, Caspase-1, and Cyclo A (as an internal control). For this purpose, the Life Cycle real-time PCR system (Roche, USA) was used to do qRT-PCR. A total of 15 μl was used for qRT-PCR, which included 2 μl of cDNA (5-fold diluted), 0.5 μl of forward and reverse primer solutions at 5 mmol/l, and 7.5 μl of 2x SYBR green DNA PCR Master Mix (Yekta Tajhiz Azma, Iran). Table 1 contains a list of primer sequences. Every sample was loaded twice. A melt curve analysis was performed following each run to confirm the existence of primer dimers and non-specific PCR products. Using a relative formula based on the comparative CT method (ΔΔCT), the expression ratio was estimated.

Table 1.

Primer sequences of used gene

Gene		Primer sequences (5'-3')	Product length (bp)
NLRP3			314
	Sense	TCTGTTCATTGGCTGCGGAT
	Antisense	GCCTTTTTCGAACTTGCCGT
ASC			80
	Sense	GCTGCAGATGGACCCCATAG
	Antisense	ACATTGTGAGCTCCAAGCCA
Caspase-1			212
	Sense	CACGAGACCTGT GCGATCAT
	Antisense	CTTGAGGGAACCACTCGGTC
CycloA			196
	Sense	GGCAAATGCTGGACCAAACAC
	Antisense	TTAGAGTTGTCCACAGTCGGAGATG

Statistical analysis

The findings are shown as mean ± standard deviation. The statistical significance between the mean values was confirmed using one-way analysis of variance and Tukey’s post-hoc test. The criteria for statistical significance was set at P<0.05.

Ethical approval and consent to participate

The National Research Council’s guidelines were followed during this research. The Arak University of Medical Sciences Ethics Committee gave its approval to this research and animal care methods (IR.ARAKMU. REC.1401.018). All procedures were carried in accordance with the Animal Research: Reporting in Vivo Experiments (ARRIVE) guidelines .

Results

nCur improved testis histopathology

The histological alteration in the testicular tissue of rats in the study groups was assessed using Image J software. The cells connected to the basement membrane of the seminiferous tubule were counted in each group. The results showed a significant decrease in the quantity of spermatogonia and epithelium thickness one week after I/R induction compared to the control group (P=0.0001 and P=0.007 respectively, Figes.1, 2). Treatment with nCur significantly increased the number of spermatogonia, although this rise was not as great as in the control group. Interesting, animals given a single dosage of 50 mg/kg nCur had more spermatogonia than the other treatment groups (Fig .2A). When compared to the I/R group, the groups receiving nCur exhibited thicker epithelium; however, this difference was not statistically significant (P=0.135, Fig .2B).

Fig 1.

Testis histopathology evaluation by hematoxylin and eosin staining. A. Control, B. I/R, C. I/R+nCur50, D. I/R+8nCur50, E. I/R+nCur100, F. I/R+8nCur100. Light microscopy of testis tissue shows normal seminiferous tubules orientation containing spermatogonial cells as cells with dark nuclei attached to the basement in A, C, D, E and F, while vacuolization and decrease in the thickness of seminiferous epithelium are found in B. I/R; Ischemia-reperfusion and nCur; Nanocurcumin (scale bar: 50 μm).

Fig 2.

Comparison of the number of spermatogonia and the seminiferous tubule thickness in different experimental groups. It shows a noticeable increase in number of spermatogonia following nCur therapy. A. This increase was more prominent in the I/R+nCur50 group compared to the other groups (P=0.0001). ^***; Significant vs. control (P˂0.001), ^###; Significant vs. I/R (P<0.001), ^&; Significant vs. I/R+nCur50 (P˂0.05), ^&&; Significant vs. I/R+nCur50 (P˂0.01), ^&&&; Significant vs. I/R+nCur50 (P˂0.001). B. Treatment with nCur could not significantly increase the thickness of the seminiferous tubules (P>0.05). ^* ; Significant vs. control (P˂0.05) and ^**; Significant vs. control (P˂0.01), I/R; Ischemia-reperfusion, and nCur; Nanocurcumin.

nCur down-regulated NLRP3 expression

The gene expression of NLRP3 in testis tissue was examined using real-time PCR to confirm the anti-inflammatory effects of nCur-treated rats. As expected, one week following experimental I/R induction, NLRP3 gene expression considerably increased compared to the control group (P=0.0001). Treatment with nCur led to a significant decrease in the mRNA level of NLRP3 in the I/R+nCur100 (P=0.007) and I/R+8nCur100 (P=0.0008) groups compared to the I/R-induced animals (Fig .3). The other nCur treatment groups showed a decrease in the NLRP3 expression level, but it was not significant (P˃0.05).

Fig 3.

Real-time PCR analysis of NLRP3 mRNA expression in different experimental groups. Following treatment with nCur, the expression of NLRP3 was drastically reduced in the groups that received 100 mg/kg nCur (P=0.007 and P=0.0008). I/R; Ischemia-reperfusion, nCur; Nanocurcumin, PCR; Polymerase chain reaction, ^* ; Significant vs. control, P˂0.05, ^***; Significant vs. control, P˂0.001, ^##; Significant versus I/R, P˂0.01, and ^###; Significant versus I/R, P˂0.001.

nCur reduced ASC expression

Our results showed that one week after experimental I/R induction, the expression of ASC in the testicular tissue significantly increased compared to the control group (P<0.001). ASC mRNA levels were significantly reduced in all nCur experimental groups including I/ R+nCur100 (P=0.002), I/R+8nCur100 (P=0.003), and I/R+8nCur50 (P=0.001) compared to the I/R group. The expression of ASC in I/R+nCur50 (P=0.179) also decreased, but it was not as low as in the other groups (Fig .4).

Fig 4.

The mRNA expression of ASC one week after testicular I/R in different groups. Treatment with nCur significantly decreased the expression of ASC in all treatment groups (P˂0.01), except for the group that received 50 mg/kg nCur as a single dose. I/R; Ischemia-reperfusion, nCur; Nanocurcumin, ^***; Significant vs. control (P˂0.001), ^##; Significant versus I/R (P˂0.01).

nCur decreased the expression of Caspase-1

Our findings demonstrated that I/R induction significantly increased in the expression of Caspase-1 compared to the control group (P=0.0001). Treatment with nCur in all groups could significantly reduce the expression of Caspase-1 compared to the I/R group (P<0.001, Fig .5).

Fig 5.

The expression level of Caspase-1 in different groups. nCur treatment showed a significantly decreased expression of Caspase-1 in comparison to the I/R group (P=0.0001). Treatment with nCur reduced the expression of caspase-1 in all treatment groups (P=0.0001). I/R; Ischemiareperfusion, nCur; Nanocurcumin, ^***; Significant vs. control (P˂0.001), and ^###; significant vs. I/R (P˂0.001).

Discussion

Testicular injury in I/R occurs due to a complex cascade of events that ultimately result in tissue damage. Ischemia, which is the loss of blood flow to the testis, leads to a lack of oxygen and nutrients, causing tissue damage and cell death (25). Therefore, our study showed that testicular I/R, resulted in tissue damage, decreased spermatogonial cell counts, and reduced thickness of the seminiferous tubule epithelium. Additionally, the expression levels of components of the NLRP3 inflammasome increased. However, nCur treatment in a manner dependent on both dose and time could diminish these histological damages and the expression of the NLRP3 inflammasome.

Testicular torsion, a frequent pediatric urologic emergency, results in a reduction in the blood flow to the testicular tissue. Previous studies have shown that testicular I/R can cause morphological damage to the tissue, potentially leading to testicular atrophy and male infertility (3). In this study, according to the histopathological analysis, the number of spermatogonial cells and the thickness of the epithelium of the seminiferous tubules were reduced.

When blood flow is restored during reperfusion, the sudden influx of oxygen and nutrients can cause additional damage to the already compromised tissue, leading to further injury (25). Germ cells are particularly vulnerable to ischemic injury due to their high metabolic activity and reliance on a constant supply of oxygen and nutrients for spermatogenesis. Therefore, the loss of blood flow and oxygen supply during ischemia can lead to the death of these cells, resulting in testicular injury and impaired fertility (26). On the other hand, the lack of oxygen supply during ischemia leads to the accumulation of ROS, which can induce peroxidation of cell membrane lipids, DNA damage and protein denaturation (27).

A group of intracellular molecules known as inflammasomes are activated after cell injury and in pathological conditions, and they can recognize signals arising from stress or cell damage (8). For the first time, Minutoli et al. (7) demonstrated that the well-known inflammasome complex, the NLRP3 inflammasome, contributes to the harmful effects of I/R on the testicular tissue. They showed that there was an increase in the levels of IL-1b, IL-18, and caspase-3 after testicular I/R. In this study, we also assessed the gene expression of the NLRP3 inflammasome components one week after I/R induction, and found increased mRNA levels of NLRP3, ASC, and Caspase-1 increased following I/R injury.

Activation of the NLRP3 inflammasome can have various implications, both in the context of acute injury and in chronic diseases (28, 29). Activation of the NLRP3 inflammasome can lead to inflammation and tissue damage in acute injuries like I/R (28). This is because the NLRP3 inflammasome can activate caspase-1, which in turn processes and releases proinflammatory cytokines such as IL-1β and IL-18. These cytokines can then trigger further inflammation and tissue damage in the affected area (7). In chronic diseases such as type 2 diabetes, obesity (30), and Alzheimer’s disease (31), activation of the NLRP3 inflammasome has been related to the pathophysiology of these disorders (30). Chronic activation of the NLRP3 inflammasome can result to persistent inflammation, tissue damage, and malfunction (32). In addition, inflammasome activity cleaves and activates gasdermin D, which is a protein that is involved in a specific kind of planned cell death called pyroptosis (33). Therapeutic interventions that trigger the NLRP3 inflammasome can be beneficial in reducing the negative effects associated with its activity. In our previous work, we administered resveratrol to inhibit the NLRP3 complex activity and its complications in a varicocele model rat (14). He et al. (34) found that Emodin has the ability to inhibit NLRP3 signaling and pyroptosis caused by I/R injury in the testis. In this study, nCur was used to reduce complications caused by NLRP3 activation following I/R. nCur, a soluble form of Cur, retains its biological properties, such as anti-inflammatory, antioxidant, and anticancer effects (35). Wei et al. (36) administered 200 mg/kg Cur via the tail vein to reduce xanthine oxidase activity and malondialdehyde levels in the testicular I/R model. So, we hypothesized that nCur can be effective for reducing the side effects of the testicular I/R model. nCur can reduce the levels of certain inflammatory cytokines such as tumor necrosis factor-alpha, IL1b, IL-18, and IL-6 in conditions like hemodialysis (37), multiple sclerosis (15), and COVID-19 (38). In this study, we administered nCur at different doses (50 and 100 mg/ kg) and different time courses (single or eight doses), and found that it decreased the mRNA levels of ASC, NLRP3, and Caspae-1 in a dose- and time-dependent way. The expression of NLRP3 was reduced after the injection of 100 mg/kg nCur at both time points, while the expression of ASC was reduced in all experimental groups except the animals that received 50 mg/kg nCur as a single dose. The expression of Caspase-1 was decreased after the injection of nCur in all groups. Furthermore, nCur treatment increased the number of spermatogonial cells, while no significant change was noticed in the epithelium thickness of the seminiferous tubules. These findings suggest that 100 mg/kg nCur was more effective in reducing NLRP3 inflammasome activity than 50 mg/kg nCur, and a single dose of 50 mg/kg nCur had better results on testicular tissue. To fully understand the reasons for this difference, further research would be needed. One possibility is that the single dose of 50 mg/kg nCur was not sufficient to completely inhibit inflammasome activation, but was still able to exert some protective effects on testis histology. Another possibility is that the mechanisms by which nCur exerts its effects on inflammasome activity and testis histology are different. nCur may exert its anti-inflammatory effects through multiple pathways, some of which may be more sensitive to the dose of nCur than others. It is also possible that nCur has direct effects on testis histology, independent of its effects on inflammasome activity (17).

Studies have demonstrated the strong anti-inflammatory properties of nCur, and one of the mechanisms by which it exerts this effect is by inhibiting the expression and activation of various transcription factors and pro-inflammatory cytokines. Studies have shown that nCur can prevent the activation of NF-κB and lower the amount of pro-inflammatory cytokines produced, which can help to alleviate inflammation and its associated symptoms (39). In general, antioxidants such as nCur may have a dual effect on testicular I/R injury. They can reduce the amount of damage caused by lipid peroxidation and also limit the activation of inflammatory responses that are triggered by ROS. This can help protect testicular tissue from damage and improve overall reproductive function (40). In this study, we showed the effectiveness of nCur in reducing the side effects of I/R injury on testicular tissue, however, there are several limitations to this study that should be noted. Firstly, it is important to consider that the results obtained using an animal model may not be directly applicable to humans and it needs further studies to determine the extent of this applicability. Secondly, we measured the changes in mRNA expression level and additional techniques like immunohistochemistry or Tunnel assay to determine changes in protein levels and cell death did not conduct.

Conclusion

This study showed that nCur treatment could reduce the activity of the components of the NLRP3 inflammasome and also cause testicular damage in a dose- and time-dependent manner. It seems that the use of nCur can be beneficial in reducing complications caused by testicular I/R. It is important to note that this study was conducted in a rat model, and more investigation is required to ascertain the possible advantages and restrictions of nCur depending on the kind and degree of testicular I/R injury in humans.

Authors’ Contributions

N.M.F.; Performed laboratory examinations and Writing manuscript. S.M.J.H., M.B.; Formal analysis, Investigation, and Writing manuscript. M.B.; Provided concept, Method of study, Supervision, Reviewing, and Editing manuscript. All authors read and approved the final manuscript.