Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2001 Mar;75(6):2771–2775. doi: 10.1128/JVI.75.6.2771-2775.2001

Multiple Groups of Novel Retroviral Genomes in Pigs and Related Species

Clive Patience 1,2, William M Switzer 3, Yasuhiro Takeuchi 1,4, David J Griffiths 1,4, Melanie E Goward 1, Walid Heneine 3, Jonathan P Stoye 5, Robin A Weiss 1,4,*
PMCID: PMC115901  PMID: 11222700

Abstract

In view of the concern over potential infection hazards in the use of porcine tissues and organs for xenotransplantation to humans, we investigated the diversity of porcine endogenous retrovirus (PERV) genomes in the DNA of domestic pigs and related species. In addition to the three known envelope subgroups of infectious gamma retroviruses (PERV-A, -B, and -C), classed together here as PERV group γ1, four novel groups of gamma retrovirus (γ2 to γ5) and four novel groups of beta retrovirus (β1 to β4) genomes were detected in pig DNA using generic and specific PCR primers. PCR quantification indicated that the retroviral genome copy number in the Landrace × Duroc F1 hybrid pig ranged from 2 (β2 and γ5) to approximately 50 (γ1). The γ1, γ2, and β4 genomes were transcribed into RNA in adult kidney tissue. Apart from γ1, the retroviral genomes are not known to be infectious, and sequencing of a small number of amplified genome fragments revealed stop codons in putative open reading frames in several cases. Analysis of DNA from wild boar and other species of Old World pigs (Suidae) and New World peccaries (Tayassuidae) showed that one retrovirus group, β2, was common to all species tested, while the others were present among all Old World species but absent from New World species. The PERV-C subgroup of γ1 genomes segregated among domestic pigs and were absent from two African species (red river hog and warthog). Thus domestic swine and their phylogenetic relatives harbor multiple groups of hitherto undescribed PERV genomes.


Because insufficient human donors are available for allotransplantation, xenotransplantation of pig tissues and organs is viewed as a means to alleviate this shortage (6). A significant concern for all forms of transplantation and especially xenotransplantation is the transfer to the recipient of pathogens along with the donor organ. Consequently, it is prudent to minimize the infectious burden that source tissues or organs may carry. While most known exogenous pathogens of pigs can be controlled by breeding under specific-pathogen-free conditions and barrier maintenance, microorganisms which give rise to intrauterine infection or are inherited in the germ line may be more problematic. Viruses, in particular pig endogenous retroviruses (PERVs), are seen as a major concern in this regard (6, 17).

The DNA of all vertebrate species studied to date contains multiple copies of DNA sequences that are related to exogenous retroviruses and are inherited in a Mendelian manner (3). These sequences, termed endogenous retroviruses (ERVs), represent the remains of ancient retroviral infection events of germ line cells. Once a retrovirus becomes endogenous, the provirus survives as part of the host genome rather than as an infectious agent. Consequently, over evolutionary time periods, one or more of the open reading frames (ORFs) of many ERV loci have become mutated and as a result can no longer encode infectious virus. However, replication-competent ERVs have been identified in several animal species, including chickens, mice, cats, primates, and pigs (3, 17). Although not normally pathogenic in the outbred natural host, ERVs have the potential to propagate to high viral loads and cause disease if they cross the species barrier.

The aim of this study was to broaden our knowledge of ERVs in pigs and related nonruminant Artiodactyla species belonging to the families Suidae and Tayassuidae (13). Most species of mammal studied in detail contain several distinguishable groups of ERV elements (3, 9) showing sequence similarity to the beta (B/D-type) and gamma (murine leukemia-related C-type) genera of retroviruses (8). To date, the only PERVs thoroughly studied are a single group of gamma retroviruses that can infect human and other cells in vitro (10, 17, 19, 20, 21). Since it is likely that other groups of PERV genomes exist, we employed degenerate PCR primers designed to hybridize with highly conserved regions of retroviral genomes (10, 12) to investigate genomic DNA from pigs and related species for the presence of novel PERVs.

MATERIALS AND METHODS

Source and preparation of DNA.

High-molecular-weight DNA was prepared from Landrace × Duroc F1 domestic pig tissues obtained from the abattoir using standard phenol-chloroform extraction and quantified by UV spectrophotometry. Skin fibroblast monolayers from European wild boar (Sus scrofa scrofa), Bornean bearded pig (Sus barbatus), warthog (Phacochoerus aethiopicus), red river hog (Potamochoerus porcus), chacoan peccary (Catagonus wagneri), and collared peccary (Peccari tajacu) were obtained from the Center for Reproduction of Endangered Species, Zoological Society of San Diego, and maintained at 37°C in a 1:1 mixture of alpha minimal essential medium and fibroblast growth medium (Clonetics) supplemented with 20% fetal bovine serum, 1% glutamine, and penicillin-streptomycin. DNA was prepared from fibroblast cultures by lysis in extraction buffer as previously described (18). DNA from the bushpig (Potamochoerus larvatus) was kindly provided by the Central Veterinary Laboratory, Weybridge, U.K.

PCR and sequence analysis.

The primers used in this study are presented in Table 1. For detection of beta retroviruses, two established degenerate oligonucleotide pairs were used. The first pair was designed to detect an approximately 300-bp region of the reverse transcriptase (RT) region of the polymerase (pol) gene of beta retroviruses (12). The second primer pair consisted of a primer designed to a conserved motif in beta retrovirus gag CA proteins used in conjunction with the antisense beta pol primer used above. For gamma retroviruses, an 850-bp region of retrovirus protease (PR) and RT sequence was selected (10). PCR products were cloned into a plasmid vector (pBluescript, Stratagene) and transformed into Escherichia coli TG1 bacteria. Approximately 20 colonies from each PCR were sequenced using an Applied Biosystems 377 automated sequencer (Perkin-Elmer). Plasmid clones were assigned to distinct groups based on nucleotide sequence comparison using the FASTA program.

TABLE 1.

PCR primers used for PERV detection

Primer type Specificitya Sequencesb
Generic Beta polymerase TTCCCTTGGAATACTCCTGTTTTYGT
CATTCCTTGTGGTAAAACTTTCCAYTG
Beta Gag (sense orientation) GTIAAACAIYTAGCITATGAAAA
Gamma protease/ polymerase GTKTTIKTIGAYACIGGIKC
ATIAGIAKRTCRTCIACRTA
Specific Beta retroviruses
 β1 CGTGATTTAAGAGAAATAAAGC
ATATGTTTCATAGGCCCCTCG
 β2 AATTTCGGTAGGAGAAGGCAA
ATACATGAGTTAATAGCCCAGC
 β3 TTGTTAACAGATTTAAGAGGAG
CAGTTTCTAGGGGCTATATTG
 β4 GAGGTTRCTWCARGATTTAAG
RTATCTTTGGTAACKTCTC
Gamma retroviruses
 γ1 CGAATAACAAACCCATCACTG
ATTGGACAGGAACTAGGATGC
 γ2 AAATTGACAGAACCCCCTCTC
ATTAACAGTCCATGCTGAAGC
 γ3 CCCAAGACCCTTGCAACTTC
GTGATGGGTTCCASCAACCC
 γ4 ATGGCCCACGAAGGTTTTAG
GGGATCAAAATTCCAGTCTCC
 γ5 CCCAAGACTTGTGCAAATCC
ACCTGGTGGGTTTCAACAACC
Gamma 1  envelope
 γ1A CCTACCAGTTATAATCAATTTA
AGGTTGTATTGTAATCAGAGG
 γ1B TTCTGTAGGAGATGGAGCTGC
TGGTAGGAATCAATCCAGTGG
 γ1C CTGACCTGGATTAGAACTGGAAG
TATGTTAGAGGATGGTCCTGGTC
a

The primers are listed as first those used for generic, degenerate amplification of the two retrovirus subfamilies (beta and gamma), followed by those used for the specific amplification of the individual retroviral groups, and last for PERV γ1 envelope subgroups. 

b

Sense above, antisense below in each pair of primers. For degenerate primers, K is G + T, R is A + G, W is A + T, and Y is C + T. 

Divergent regions of the cloned representative member of each group were selected for amplification, and new primers were designed to specifically amplify each group. The specificity of the PCR amplification was confirmed by testing the primers on plasmid clones of the other retroviral families. Following PCR amplification from genomic DNA, if the PCR results were not definitive, the identity of ambiguous amplification products was confirmed by automated DNA sequencing. PCR conditions for specific group amplification were as follows: one cycle of 92°C for 1 min; 30 cycles of 94°C for 30 s, annealing for 45 s, and 72°C for 30 s; and one cycle of 72°C for 30 s. The annealing temperature was 56°C for all PCRs with the following exceptions: β1 (47°C), β4 (61°C), and γ1 ABC (61°C).

Amino acid sequences were determined using the DNAsis software package. The relationship to retroviral sequences was determined by Blast search of the Swissprot database at the National Center for Biotechnology Information server. The GAP program in the Wisconsin Package version 10.0 software (Genetics Computer Group, Madison, Wis.) was used to determine the identities between the sequences.

Expression of retrovirus RNA.

Total cellular RNA was purified using RNAsol (Biogenesis) following the manufacturer's protocol. cDNA was synthesized from approximately 5 μg of RNA using the 3′ degenerate PCR primer. PCR amplification was then performed using the specific primers for each PERV group on the cDNA prepared from 500 ng of total RNA. Cells and culture were as described previously (17).

Nucleotide sequence accession numbers.

The sequences of representative members of each group have been deposited in GenBank under accession numbers AF274705 through AF274713.

RESULTS

All PCR approaches were successful in amplifying retroviral sequences from the DNA of Landrace × Duroc F1 hybrids of the domestic pig. Multiple clones of sequence were investigated and could be classified into distinct groups of β and γ retroviral genomes (Tables 2 and 3). The sequences of representative members of each group have been deposited in GenBank. When multiple members of a single group were identified, the sequence deposited in GenBank represents that most closely related to potentially infectious ERV, i.e., with the fewest nonsense mutations. Insufficient clones were sequenced to encompass all the PERV genome variants present in pig DNA for each group. While the genome groups clearly belonged to either the beta or the gamma retrovirus subfamily (8), bootstrap values were not high enough to build meaningful phylogenetic trees of the relationship between groups.

TABLE 2.

Nucleotide sequence similarity of beta retrovirus sequences

Group % Similarity with virusa (PERV group):
β2 β3 β4 MMTV (β) SERV (β) MLV (γ) PERV (γ) BAEV (γ) GALV (γ) HERV-K10 (β)
β1 88 58 57 61 63 43 41 46 45 58
β2 40 61 69 68 44 43 51 47 57
β3 51 54 60 45 42 48 41 65
β4 67 67 39 45 41 42 60
a

MLV, murine leukemia virus; BAEV, baboon endogenous virus; GALV, gibbon ape leukemia virus. 

TABLE 3.

Nucleotide sequence similarity of gamma retrovirus sequences

Group % Similarity with virusa(PERV group):
γ2 γ3 γ4 γ5 MMTV (β) SERV (β) MLV (γ) PERV (γ) BAEV (γ) GALV (γ) HERV-K10 (β)
γ1 52 50 57 49 40 44 55 >95 62 63 39
γ2 51 54 51 39 43 68 53 53 54 42
γ3 47 81 38 44 49 49 52 48 46
γ4 52 39 42 50 57 55 57 44
γ5 39 41 50 48 49 46 37
a

See Table 2, footnote a. 

Nucleotide comparison of the beta retrovirus sequences (Table 2) indicated that the elements could be classified into four families, which can be differentiated by the sequences amplified between the pol-pol primers. However, the β2 sequence was not obtained using the pol-pol primers directly but only with the CA-pol combination. All clones from the β2 CA-pol amplification were identical and were closely related to the β1 group of pol-pol amplicons. Mutations in the β2 sequence in the region recognized by the sense pol primer probably explain the failure to amplify the β2 sequence with the pol primer pair. While three of the groups showed closest similarity to mouse mammary tumor virus (MMTV)/simian ERV (SERV), one group (β3) was distinct and was more closely related to the endogenous human ERV HERV-K. Although ORFs were present in two of the beta families (β2 and β3), it is difficult to determine their significance due to the limited length of the PCR products.

The gamma retroviral sequences could be divided into five distinct families (γ1 to γ5) based on their nucleotide similarities. A comparison of representative members of each group is presented in Table 3. One of the families (γ1) shows high sequence identity to the known infectious gamma retrovirus PERV sequences (1, 17), although the particular clone analyzed has a single stop codon that truncates the pol reading frame. All of the other families contained multiple mutations that rendered them incapable of encoding full-length PR-RT proteins. However, examination of all three forward reading frames in the five groups of gamma retrovirus genomes identified the presence of motifs characteristic of retroviral PR-RT proteins, confirming that the sequences were of retroviral origin (Table 4).

TABLE 4.

Presence of peptide motifs characteristic of gamma retrovirus elements

Group Protease motif GRD RT motifs
LPQG SP
γ1 GRD LPQG SP
γ2 G(R/K)Da L(L/P)QG SP
γ3 GRD LPQG SH
γ4 GWD LPQR SP
γ5 ERD LPQG SS
a

Entire motif deleted in some clones. 

The copy number of the PERV groups in the genome of Landrace × Duroc pigs was determined by PCR titration using the primers specific for each group. Pig genomic DNA was diluted in twofold steps and compared to amplifications of known-copy-number standards diluted in a background of murine (NIH 3T3) genomic DNA. Copy numbers varied between 2 (for the β2 and γ5 viruses) and 64 (γ1 virus) per porcine cell (Table 5). The copy number for the γ1 group, 32 to 64, is in agreement with our previous estimate, approximately 50, by a Southern blot analysis (11, 17), which showed considerable insertional proviral polymorphism among breeds of pig and individual animals.

TABLE 5.

Copy number, expression, and transmission of the various PERV groups

PERV group Copy no. range Expression in:
Porcine kidney tissue PK15 cells 293 cellsa 293/PERV- PK15a
β1 8–16 − − − −
β2 4–8 − − − −
β3 16–32 − − − −
β4 2–4 + − − −
γ1 32–64 + + − +
γ2 16–32 + − − −
γ3 4–8 − − − −
γ4 4–8 − − − −
γ5 2–4 − − − −
a

Human embryonic kidney cells uninfected (293 cells) and infected with PERV released from PK15 cells. 

Expression of the PERV groups was examined by RT-PCR of RNA extracted from the kidneys of Landrace × Duroc pigs. Expression was only detected for the β4, γ1, and γ2 groups (Table 5). It is known that the γ1 group, which is produced by several pig cell lines, including PK15 cells, can encode virus that can replicate in human cells. Therefore, PK15 cells and 293 cells that had been infected with PK15 cell supernatant were tested for beta and gamma PERV expression. PK15 cells were found to express only the γ1 group at detectable levels, and as expected, this was transmitted to 293 cells (Table 5). No beta or gamma retroviral sequences apart from γ1 were detected in the PERV-infected 293 cells.

We investigated how long the various PERV genomes have been present in the germ line of pigs by screening the DNA of various species of the families Suidae (Old World pigs) and related Tayassuidae (New World peccaries) of Artiodactyla (13). The distribution of the novel PERV families in domestic pigs and related species was investigated by PCR using the primers specific for each group. Table 6 shows that all the PERV groups were detected in the DNA of each species tested of Old World Suidae, including African and Asian species. Only one group (β2) was present in the DNA from the phylogenetically related New World peccary family (Tayassuidae). Within the γ1 PERV group, there are three subgroups of infectious gamma retrovirus families (PERV-A, -B, and -C), which utilize different cellular receptors for infection of human and porcine cells (19). PERV-A, -B, and -C vary in env sequence within the SU domain (1, 9). We therefore used primers which specifically detect each env subgroup (9) to examine their distribution (Table 6). While all Suidae members contained PERV-B, the warthog lacked detectable PERV-A and -C and the red river hog lacked PERV-C. Landrace × Duroc hybrids of the domestic pig segregated PERV-C sequences.

TABLE 6.

Presence of PERV pol sequences in pigs and related species

Family and species pol sequences
env subgroups
β1 β2 β3 β4 γ1 γ2 γ3 γ4 γ5 γ1-A γ1-B γ1-C
Suidae
 Domestic piga (Sus scrofa) + + + + + + + + + + + ±
 European wild boar (Sus scrofa) + + + + + + + + + + + +
 Bornean bearded pig (Sus barbatus) + + + + + + + + + + + +
 Bushpig (Potamochoerus larvatus) + + + + + + + + + + + +
 Red river hog (Potamochoerus porcus) + + + + + + + + + + + −
 Warthog (Phacochoerus aethiopicus) + + + + + + + + + − + −
Tayassuidae
 Chocoan peccary (Catogonus wagneri) − + − − − − − − − − − −
 Collared peccary (Peccari tajacu) − + − − − − − − − − − −
a

Landrace × Duroc F1 hybrid. 

DISCUSSION

PERVs remain a major safety concern for porcine xenotransplantation despite the fact that most copies present in the pig genome are likely to be replication defective. To date, all investigations into PERVs have focused on a single group of gamma retrovirus sequences (the γ1 group), as at least two members have been shown to be infectious for human cells (11, 17, 20, 21). Here we have shown that several distinct groups of PERV genomes also form part of the pig genome and might therefore represent an additional infectious risk for xenotransplantation, either in their own right or by interaction with the replication-competent PERVs. An accompanying article also identifies β-PERV (5). Knowledge of the diversity of PERVs will allow the development of effective systems to monitor PERV transmission in human recipients of xenografts, as previously done for PERV-γ1 (7, 14, 15).

Analysis of genomic DNA from pigs identified, in addition to the known PERV genomes, four novel groups of gamma PERV sequences and four novel groups related to the beta retroviruses, with various genome copy numbers. Although the PCR approach was efficient in identifying a wide variety of retroviral groups, there is a possibility that additional groups not identified in this study exist. However, other groups are unlikely to represent an infectious risk, as this PCR approach was designed to highly conserved regions of the active site of essential enzymes for retroviral replication. If these regions are mutated or deleted, it is unlikely that the virus could represent an infectious entity.

For PERV sequences to represent an infectious risk in xenotransplantation, they require ORFs that encode the major viral proteins. Of the beta pol sequences, only two (β2 and β3) possessed an ORF. The β3 product was very short (250 nucleotides), and so the significance of this result is difficult to interpret. Although longer PCR products were obtained for the β2 group, of the six clones sequenced, all appeared identical and were deleted and mutated in the motif recognized by the 5′ pol primer which forms part of the active site of RT. It is therefore unlikely that this group will contain members with infectious potential. Nevertheless, it will be important to obtain further sequence data from these loci. The clones obtained for the remaining gamma retrovirus groups, with the exception of γ1, all seem to represent members of highly mutated PERV groups. As such, these elements are unlikely to encode infectious particles in their own right. Although they might still be able to interact with other loci by either recombination or complementation, their significance for xenotransplantation is diminished.

In order to examine further the potential of the novel PERV elements to represent an infectious risk for xenotransplantation, the expression of the sequences was examined in kidney tissue and in the PK15 pig cell line. Expression of more PERV groups was observed in fresh kidney tissue (β4, γ1, and γ2) than in the PK15 kidney cell line (γ1). It will be important to determine whether virus particles released from primary kidney cultures contain β4 and γ2 retrovirus sequences in addition to γ1 and whether other tissues express these PERV groups. In this study, pseudotyping or cross-packaging (16) of the novel PERV families by the γ1 group of PERV produced by PK15 cells was not evident, again suggesting that the γ1 group remains the main infectious concern for xenotransplantation. The possibility of recombination between PERVs and HERVs should be investigated if either became mobilized in xenotransplantation.

The various PERV families may have entered the pig lineage at different time points during the evolution and divergence of porcine species. If this were the case, then certain species and strains of pig may carry a reduced PERV burden and be advantageous as a source of xenotransplants. Analysis of pig species (Suidae) revealed that each of those tested contained all the gamma and beta retrovirus groups. In addition, one of the beta retrovirus groups (β2) was also present in the DNA of two genera of peccary (Tayassuidae). This finding indicates that the β2 group entered the germ line prior to the separation of Old World pigs from New World peccaries that occurred over 20 million years ago (13). The remaining PERV groups all appear to have entered the lineage after the divergence of the Tayassuidae lineage and before speciation within the Suidae lineage, as previously reported for PERV γ1 (2).

Given that PERVs are ancient proviruses, it is likely that all domestic pig breeds will carry multiple PERV genomes. Our previous analysis of the γ1 group (PERV-A and -B envelope subgroups) indicated polymorphisms and common genomes in diverse strains of domestic pigs (7), including the Chinese Meishan pig, which may well have been domesticated independently of the European and Middle Eastern strains (4, 13). However, within the γ1 PERV genomes, segregation of the three envelope subgroups is still occurring in domestic pigs, as is evident for the PERV-C genomes. With regard to xenotransplantation, analysis of particular domestic pig breeds should place emphasis on detecting genetic polymorphisms of replication-competent PERV.

In conclusion, several new groups of PERV were identified in the genome of domestic pigs and related Artiodactyla species. The PERV groups are present as multiple copies in the genome and in three instances are transcribed in the kidney. However, it is likely that most of the groups represent highly mutated, transcriptionally inert, or noninfectious genetic elements which are unlikely to contribute a serious risk to xenotransplantation. Although this report does not exhaustively describe all PERV genomes and as such cannot exclude the existence of additional full-length PERV loci, it adds considerably to our knowledge of the PERV elements carried and expressed by pigs and related species.

ACKNOWLEDGMENTS

This work was supported by the Medical Research Council UK and BioTransplant Incorporated USA.

We thank Beth Oldmixon for excellent technical assistance.

REFERENCES

  • 1.Akiyoshi D E, Denaro M, Zhu H, Greenstein J L, Banerjee P, Fishman J A. Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J Virol. 1998;72:4503–4507. doi: 10.1128/jvi.72.5.4503-4507.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Benveniste R E, Todaro G J. Evolution of type C viral genes: preservation of ancestral murine type C viral sequences in pig cellular DNA. Proc Natl Acad Sci USA. 1975;72:4090–4094. doi: 10.1073/pnas.72.10.4090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Boeke J D, Stoye J P. Retrotransposons, endogenous retroviruses, and the evolution of retroelements. In: Coffin J M, Hughes S H, Varmus H E, editors. Retroviruses. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1997. pp. 343–435. [PubMed] [Google Scholar]
  • 4.Diamond J. Guns, germs and steel. London, U.K: Vintage, Random House; 1997. [Google Scholar]
  • 5.Ericsson T, Oldmixon B, Blomberg J, Rosa M, Patience C, Andersson G. Identification of novel porcine endogenous betaretrovirus sequences in minature swine. J Virol. 2001;75:2765–2770. doi: 10.1128/JVI.75.6.2765-2770.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fishman J A, Sachs D, Shaikh R, editors. Xenotransplantation: scientific frontiers and public policy. Ann NY Acad Sci. 1998;862:1–251. [PubMed] [Google Scholar]
  • 7.Heneine W, Tibell A, Switzer W M, Sandstrom P, Rosales G V, Mathews A, Korsgren O, Chapman L E, Folks T M, Groth C G. No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet. 1998;352:695–699. doi: 10.1016/S0140-6736(98)07145-1. [DOI] [PubMed] [Google Scholar]
  • 8.Hunter E, Casey J, Hahn B, Hayami M, Korber B, Kurth R, Neil J, Rethwilm A, Sonigo P, Stoye J. Retroviridae. In: Van Regenmortel M H, Fauquet C M, Bishop D H L, Carsten E B, Estes M K, Lemon S M, Maniloff J, Mayo M A, McGeoch D J, Pringle C R, Wickner R B, editors. Virus taxonomy: the classification and nomenclature of viruses, VIIth ICTV Report. San Diego, Calif: Academic Press; 2000. pp. 369–387. [Google Scholar]
  • 9.Le Tissier P, Stoye J P, Takeuchi Y, Patience C, Weiss R A. Two sets of human-tropic pig retrovirus. Nature. 1997;389:681–682. doi: 10.1038/39489. [DOI] [PubMed] [Google Scholar]
  • 10.Martin J, Herniou E, Cook J, O'Neill R W, Tristem M. Human endogenous retrovirus type I-related viruses have an apparently widespread distribution within vertebrates. J Virol. 1997;71:437–443. doi: 10.1128/jvi.71.1.437-443.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Martin U, Kiessig V, Blusch J H, Haverich A, von der Helm K, Herden T, Steinhoff G. Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet. 1998;352:692–694. doi: 10.1016/S0140-6736(98)07144-X. [DOI] [PubMed] [Google Scholar]
  • 12.Medstrand P, Lindeskog M, Blomberg J. Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals. J Gen Virol. 1992;73:2463–2466. doi: 10.1099/0022-1317-73-9-2463. [DOI] [PubMed] [Google Scholar]
  • 13.Oliver W L R, editor. Pigs, peccaries and hippos. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources; 1993. [Google Scholar]
  • 14.Paradis K, Langford G, Long Z, Heneine W, Sandstrom P, Switzer W M, Chapman L E, Lockey C, Onions D, Otto E. Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science. 1999;285:1236–1241. doi: 10.1126/science.285.5431.1236. [DOI] [PubMed] [Google Scholar]
  • 15.Patience C, Patton G S, Takeuchi Y, Weiss R A, McClure M O, Rydberg L, Breimer M E. No evidence of pig DNA or retroviral infection in patients with short-term extracorporeal connection to pig kidneys. Lancet. 1998;352:699–701. doi: 10.1016/S0140-6736(98)04369-4. [DOI] [PubMed] [Google Scholar]
  • 16.Patience C, Takeuchi Y, Cosset F L, Weiss R A. Packaging of endogenous retroviral sequences in retroviral vectors produced by murine and human packaging cells. J Virol. 1998;72:2671–2676. doi: 10.1128/jvi.72.4.2671-2676.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Patience C, Takeuchi Y, Weiss R A. Infection of human cells by an endogenous retrovirus of pigs. Nat Med. 1997;3:282–286. doi: 10.1038/nm0397-282. [DOI] [PubMed] [Google Scholar]
  • 18.Rigby S P, Griffiths D J, Weiss R A, Venables P J. Human retrovirus-5 proviral DNA is rarely detected in salivary gland biopsy tissues from patients with Sjögren's syndrome. Arthritis Rheum. 1997;40:2016–2021. doi: 10.1002/art.1780401114. [DOI] [PubMed] [Google Scholar]
  • 19.Takeuchi Y, Patience C, Magre S, Weiss R A, Banerjee P T, Le Tissier P, Stoye J P. Host range and interference studies of three classes of pig endogenous retrovirus. J Virol. 1998;72:9986–9991. doi: 10.1128/jvi.72.12.9986-9991.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wilson C A, Wong S, Muller J, Davidson C E, Rose T M, Burd P. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J Virol. 1998;72:3082–3087. doi: 10.1128/jvi.72.4.3082-3087.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wilson C A, Wong S, VanBrocklin M, Federspiel M J. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J Virol. 2000;74:49–56. doi: 10.1128/jvi.74.1.49-56.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES