Abstract
Background: In Gabon, studies on the characterization of extended-spectrum beta-lactamase-producing Escherichia coli in young children with diarrhoea are almost nonexistent. The objective was to evaluate the prevalence of antibiotic resistance to extended-spectrum beta-lactamase-producing Escherichia coli in children at public hospitals in Franceville, Gabon. Methods: Seventy diarrhoea faecal samples were collected from children aged 0–5 years. The culture and isolation of colonies were carried out on MacConkey agar. The colonies were identified using VITEK 2. The determination of the extended-spectrum beta-lactamase’s profiles was accomplished using the double disk method. The identification of phylogroups and pathotypes was performed by PCR. Identification of the ESBL genes was performed by sequencing. Results: A total of 26 strains of Escherichia coli (33.0%) were identified from 78 bacterial isolates. Twenty (77.0%) Escherichia coli strains carried extended-spectrum beta-lactamases blaCTX-M-15 and 5.0% carried blaSHV-12 subtypes. Phylogroup D (62.0%) was predominant, followed by B1 (12.0%), B2 (8.0%) and E (4.0%). The bacterial pathogens causing diarrhoea were enterohemorrhagic E. coli (12.0%), typical enteropathogenic Escherichia coli (8.0%), atypical enteropathogenic Escherichia coli (4.0%), Enteroaggregative Escherichia coli (4.0%) and enteroinvasive E. coli (4.0%). Conclusions: This study showed a high prevalence of extended-spectrum beta-lactamase, Escherichia coli of phylogroup D and pathotype enterohemorrhagic Escherichia coli in children under 5 years old in public hospitals in Franceville, most probably due to the misuse or inappropriate consumption of beta-lactams.
Keywords: multi-resistance, Escherichia coli, extended-spectrum beta-lactamase, diarrheagenic Escherichia coli, children, public hospitals
1. Introduction
Diarrhoea is one of the leading causes of infant mortality and morbidity in developing countries [1]. In addition to the classical bacterial pathogens Shigella, Salmonella, Yersinia, Vibrio and Campylobacter spp., Escherichia coli (E. coli) strains cause many cases of diarrhoea [2]. Diarrhoea is defined by the World Health Organization as three or more loose or watery stools during a 24 h period [3]. Diarrheagenic E. coli (ECD) is one of the most important bacterial agents in the world.
Six intestinal pathotypes of ECD have been described: enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC) or Shiga toxin-producing E. coli (STEC), Enteroaggregative E. coli (EAEC) and diffuse adherent E. coli (DAEC) [4]. Their prevalence and epidemiology may be different depending on the area [4]. The treatment for them has been confronted with the emergence of acquired resistance, such as multi-resistant extended-spectrum beta-lactamase-producing E. coli (ESβLE) strains [5], which have a hospital origin (nosocomial infections) due to the systematic prescription of antibiotics by clinicians and patient self-medication [6].
The prevalence of ESβL-producing E. coli is somewhat high (45.0% in both Lambaréné and Libreville, Gabon) [7] compared to some central African countries such as Cameroon (12.0%) [8]. Among the ESβLs, CTX-M-type enzymes are most common, and their number has increased rapidly during the last 10 years [9]. The recent global increase has been caused mainly by the blaCTX-M-type gene [9]. ESβL-producing isolates, especially CTX-M-producing E. coli, exhibit an alarming trend as there is an increasing number of E. coli strains with co-resistance to other classes of antibiotics [10].
The worldwide dissemination of ESβL-producing Enterobacteriaceae in human medicine is an urgent problem that poses a serious challenge to the treatment of infectious diseases, particularly the emergence of CTX-M-15-producing E. coli [11]. blaCTX-M-15 is the most prevalent ESβL gene in human samples worldwide [12]. In addition, blaCTX-M-15 and blaSHV-11 genes are recognized as plasmid-mediated resistance genes [13].
There are four major phylogenetic groups of E. coli strains: A, B1, B2 and D. Commensal E. coli are found in groups A and B1, while the extra-intestinal groups are B2 and D [14]. Few studies are available on the association between ECD phylogenetic groups and antibiotic resistance [15].
Specific associations between phylogenetic groups and variants of blaCTX m have been suggested, particularly of blaCTX-M-14 and blaCTX-M-15, which are considered to be driven by epidemic E. coli strains belonging to phylogroup B2 [16].
In children from 0 to 5 years old, researchers do not have enough information on this phenomenon, hence the subject of our study, which aims at assessing the prevalence of antibiotic resistance in the E. coli in diarrhoeal patients attending public hospitals in the city of Franceville (Gabon).
2. Results
2.1. Isolation and Identification of Colonies
The culture and isolation of bacteria from 70 diarrhoeal faecal samples on MacConkey agar plates yielded 78 colonies, of which 58 (74.0%) were pink or red (called lactose-positive) and 20 (26.0%) were colourless or yellow (called lactose-negative). Only lactose-positive strains were considered. Twenty-six (26) strains (out of the 58 lactose-positive) were E. coli.
2.2. Phylogroups
Of the 26 E. coli identified, 22 (85.0%) E. coli strains belonged to phylogroups B1, B2, D and E, as follows: 3 (12.0%) B1, 2 (8.0%) B2, 16 (62.0%) D and 1 (4.0%) E. The ECDs were distributed among the phylogroups as follows: 3 (12.0%) EHEC in Group D, 1 (4.0%) atypical EPEC in Group E, 1 (4.0%) typical EPEC in Group D, 1EIEC (4.0%) in Group D and 1 (4.0%) EAEC in Group B2 (Table 1).
Table 1.
Distribution of pathogenic strains of E. coli by pathotype and phylogroups.
| Phylogroups n (%) | |||||||
|---|---|---|---|---|---|---|---|
| B1 | B2 | D | E | N.D. | |||
| EAEC | 1 (4) | - | 1 (4) | - | - | - | |
| EIEC | 1 (4) | - | - | 1 (4) | - | - | |
| ECD n (%) | EHEC | 3 (12) | - | - | 3 (12) | - | - |
| Atypical EPEC | 1 (4) | - | - | - | 1 (4) | - | |
| Typical EPEC | 2 (8) | - | - | 1 (4) | - | 1 (4) | |
| Commensal n (%) | E. coli | 3 (12) | 1 (4) | 11 (42) | - | 3 (12) | |
| Total n (%) | 3 (12) | 2 (8) | 16 (62) | 1 (4) | 4 (16) |
N.D. (Not Determined).
2.3. Pathogenic E. coli Strains
Of the 26 E. coli identified, 8 (31.0%) strains carried pathogenicity genes (ECD), while 18 (69.0%) did not. Among the pathogenic ECD strains, the pathotype EHEC was predominant as it occurred three times (12.0%), followed by two (8.0%) typical EPEC, one (4.0%) EAEC, one (4.0%) EIEC and one (4.0%) atypical EPEC (Table 1).
2.4. Antibiotic Susceptibility and Beta-Lactam Resistance Genes
Twenty strains of E. coli (77.0%) were positive in the ESβL screening test. For other antibiotics, resistance was reported for kanamycin (90.0%), ciprofloxacin (90.0%), trimethoprim/sulfamethoxazole (50.0%), tobramycin (45.0%), nalidixic acid (45.0%), tetracycline (40.0%), gentamicin (35.0%), netilmicin (30.0%), amikacin (25.0%), fosfomycin (15.0%), chloramphenicol (15.0%), ertapenem (10.0%) and imipenem (5.0%). Our results showed that 19 (95.0%) of the blaCTX-M-15 genes were single-carrier and 1 (5.0%) was double-carrier (blaCTX-M-15/blaSHV-12) (Table 2).
Table 2.
Profiles of ESβL resistance.
| Isolate | Antibiotics Profile | ESβL Genes |
|---|---|---|
| 60A | CIP KAN | blaCTX-M15 |
| 13A-1 | CIP KAN | blaCTX-M15 |
| 15-1 | CIP KAN | blaCTX-M15 |
| 41A-1 | CIP KAN | blaCTX-M15 |
| 42A-1 | CIP KAN | blaCTX-M15 |
| 46A-1 | CIP KAN | blaCTX-M15 |
| 83-A | CIP KAN | blaCTX-M15 |
| 54A-1 | CIP KAN TET | blaCTX-M15 |
| 42A | CIP KAN NAL | blaCTX-M15 |
| 47-1 | CIP KAN SXT | blaCTX-M15 |
| 90A-1 | CIP KAN | blaCTX-M15 |
| 47-2 | CHL CIP GEN KAN NAL TOB | blaCTX-M15 |
| 35A | CIP GEN KAN NAL NET SXT TET TOB | blaCTX-M15 |
| 5-1 | AMK CIP KAN NAL NET SXT TET TOB | blaCTX-M15 |
| 5B-1 | AMK CIP KAN NAL NET SXT TET TOB | blaCTX-M15 |
| 92A-2 | CIP GEN ERT FOS KAN SXT TET TOB | blaCTX-M15 |
| 62A-1 | AMK CIP GEN KAN NAL NET SXT TET TOB | blaCTX-M15 |
| 69-3 | CIP GEN ERT FOS IMP KAN NET SXT TOB | blaCTX-M15/SHV12 |
IMP = imipenem, ERT = ertapenem, GEN = gentamicin, TOB = tobramycin, NET = netilmicin, AMK = amikacin, CHL = chloramphenicol, TET = tetracycline, STX = trimethoprim/sulfonamide, NAL = nalidixic acid, CIP = ciprofloxacin, FOS = fosfomycin, AMP = Ampicillin, KAN = kanamycin.
2.5. The Prevalence and Phylogroup of MDR ECDs
Among these EsβL-producing E. coli, there were eight (31%) of ECD and five (20.0%) of MDR, with all CTX-M-15 belonging to phylogroup D (Table 3).
Table 3.
Prevalence of MDR among diarrhoeal E. coli pathotypes.
| ECD n (%) |
Phylogenic Group n (%) |
CIP n (%) |
KAN n (%) |
NAL n (%) |
NET n (%) |
SXT n (%) |
TET n (%) |
MDR n (%) |
ESβL Gene |
|---|---|---|---|---|---|---|---|---|---|
| EAEC | B2 | ||||||||
| 1 (4) | 1 (4) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | blaCTX-M-15 |
| EIEC | D | 0 | 0 | 0 | 0 | 1 (5) | 1 (5) | 1 (4) | blaCTX-M-15 |
| 1 (4) | 1 (4) | ||||||||
| EHEC | D3 (12) | 3 (15) | 3 (15) | 2 (10) | 1 (5) | 1 (5) | 2 (10) | 3 (12) | blaCTX-M-15 |
| 3 (11.5) | |||||||||
| Atypical EPEC | E1(4) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
| 1 (4) | |||||||||
| Typical EPEC | D1 (4) | 1 (5) | 1 (5) | 1 (5) | 0 | 0 | 0 | 1 (4) | blaCTX-M-15 |
| 2 (8) | |||||||||
| Total 8 (31) | 5 (20) |
GEN = gentamicin, TOB = tobramycin, NET = netilmicin, TET = tetracycline, STX = trimethoprim/sulfonamide, NAL = nalidixic acid, CIP = ciprofloxacin, FOS = fosfomycin, KAN = kanamycin, MDR = Multi-Drug Resistance.
2.6. Some Limitations of the Study
The limitations of our study could be linked to the geographical location of the study town (Franceville), the demographics of this town, and the animist beliefs of the populations:
-
-
Geographical limitations: Franceville is about 700 km from the country’s capital (by car). This made it difficult for us to obtain consumables and laboratory reagents.
-
-
Demographic limitations: The population of Franceville is very small (around 3%) compared to the population of Gabon. This could explain the small size of our sample.
-
-
Animist considerations: this could explain the refusal of some parents to give us faeces samples from their children.
3. Discussion
Childhood diarrhoeal diseases have always been a real concern for health institutions worldwide, causing malnutrition and stunting growth. They are one of the principal causes of mortality and morbidity in developing countries. Among the causes of acute bacterial diarrhoea, Escherichia coli (E. coli) is an important agent of endemic and epidemic diarrhoea across the world [17].
Children aged 0–5 years old interact with their external environment by putting things in their mouths. E. coli is one of the most frequently isolated opportunistic pathogens in human and animal faeces [18] and appears to be the leading cause of diarrhoea in children [17]. A study on the aetiology of acute diarrhoea in Tunisian children found a similar prevalence of E. coli (76.6%) in the diarrhoeal faeces of children [17].
A study conducted in Ouagadougou (Burkina Faso) between 2013 and 2015 obtained opposing results, with a higher prevalence of EPEC (25.0%) and a similar prevalence of EHEC (12.9%) compared to our results [19]. In another study, the prevalence of EAEC (14.8–23.5%) and EIEC (12.1–22.2%) were higher than EPEC (5.5–13.7%) and EHEC (1.6%) [20]. These trends show that EHEC and EPEC are the main causes of childhood diarrhoea in Tunisia, compared to our results and those of Burkina Faso, where EHEC and EPEC cause more diarrhoea. In developed countries, EPEC, ETEC and EAEC strains are the main causes of infantile diarrhoea [2]. Our results also showed that 18 (69.0%) E. coli strains did not carry pathogenicity genes, probably because they were commensal strains [21].
Pathogenic strains of E. coli are much more common in phylogenetic group B2 than in group D [22]. Otherwise, phylogroups B2 and D have more virulence properties, such as biofilm formation and haemolysin secretion, compared to isolates from phylogroups A and B1 [23]. Our results showed that the prevalence of phylogenetic group D (62.0%) was higher than that of B1 (12.0%) and B2 (8.0%). Additionally, group D carried pathogenic E. coli strains dominated by the EHEC gene. Moreover, among our 18 (69.0%) E. coli commensal strains, 11 (42.0%) belong to Group D, 3 (12.0%) to B1 and 1 (4.0%) to B2, compared to another study where commensal E. coli were associated with the D (28, 38.0%), A (26, 35.0%) and B2 (12 isolates, 16.0%) phylogroups [15].
In E. coli diarrhoeal diseases, treatment is mainly based on the use of third-generation cephalosporins (C3G), aminoglycoside and quinolones [19]. Beta-lactams and fluoroquinolones are the antibiotic classes most commonly used for treating enterobacteria infections in Gabon [24]. Also, aminoglycosides, phenicolates and tetracyclines are in these two classes of antibiotics [25]. Since the emergence of ESβL-producing Enterobacteriaceae, the therapeutic options remain combinations of aminopenicillins and beta-lactamase inhibitors, cephalosporins or fluoroquinolones [7]. However, the use of the appropriate antibiotic is often difficult due to the emergence of resistance [7]. Our study suggested that these E. coli strains presented high rates of antibiotic resistance for aminopenicillin, caboxypenicillin, ureopenicillin and monobactam. The lower resistance to carbapenems (imipenem (5.0%) and ertapenem (10.0%)) indicates that these antibiotics are still effective in the treatment of such diarrhoea. Additionally, the prevalence of resistance to kanamycin (96.0%), ciprofloxacin (90.0%), trimethoprim/sulfamethoxazole (50.0%), tobramycin (45.0%), tetracycline (40.0%) and gentamicin (35.0%) was higher than the resistance to fosfomycin (16.0%) and chloramphenicol (12.0%), suggesting that these antibiotics are often used in human clinical therapy in Gabon. These resistance rates are similar to the results recently published in Morocco, where the prevalence of typical antibiotic resistance was 82.0% for ciprofloxacin, 76.0% for trimethoprim/sulfamethoxazole, 66.0% for gentamicin, 56.0% for amikacin and 0.0% for imipenem [7,25]. A study in Lambaréné (Gabon) reported comparable prevalence rates [24]. The low percentages of resistance to carbapenems, fosfomycin and chloramphenicol in this study are like those of other studies, suggesting that these antibiotics are still very active against these pathogens. Also, it has been observed in Morocco that hospitalized patients have a significant prevalence of ESβL-producing E. coli (72.0%) [26]. This could be the result of an excessive use of beta-lactams, quinolones and aminoglycosides in this age group in human therapy [24]. Among the ESβLs, CTX-M-type enzymes are most common, and their number has increased rapidly over the last 10 years [9].
The global spread of ESβL-producing Enterobacteriaceae from human clinical strains is a challenge in the treatment of infectious diseases, particularly with the emergence of CTX-M-15-producing E. coli [11]. blaCTX-M-15 is the most prevalent ESβL gene in human samples worldwide [12]. We found 20 (100%) blaCTX-M-15 and 1 (5.0%) blaCTX-M-15/SHV-12 (Table 1) recognized as plasmid-mediated resistance genes [24]. Similar studies carried out at Albert Schweitzer Hospital in Lambaréné, Gabon [27], reported the presence of blaCTX m and blaSHV in hospitalized patients. This study confirms that blaCTX-M-15 and blaSHV-12 are circulating in the Gabonese population, especially in children from 0 to 5 years old.
Previous studies have shown that phylogroups A and B1 (stem commensal) have a high drug resistance profile with few virulence genes, unlike phylogroups B2 and D (pathogenic), which express multiple virulence factors and are more sensitive to antibiotics. In addition, some observations showed that the blaCTX-M-14 and blaCTX-M-15 genes are associated with phylogroups B2 and A [28]. E. coli strains of phylogroup D which were carrying the blaCTX-M-15 gene were predominantly of the EHEC pathotype D and are poorly described among children.
4. Material and Methods
4.1. Ethical Considerations
All patients gave their consent via a signature during the collection period. Anonymous numbers were assigned to participant patients and then transferred to their corresponding samples for confidentiality.
4.2. Sampling
Seventy samples of faecal diarrhoea from children aged 0 to 5 years were collected from 22 November 2016 to 29 May 2017, at the Centre hospitalier régional Amissa Bongo (CHRAB) and the Hôpital de coopération sino-gabonaise de Franceville (SGCHF), in the Haut-Ogooué province of southwest Gabon. These samples were taken with the consent of the children’s parents during consultations and at home during certain episodes of diarrhoea.
4.3. Culture, Isolation and Identification of Colonies
In the CIRMF Bacteriology Laboratory, each diarrhoeal sample was enriched with tryptone soy broth (BioMérieux, Marcy-l’Étoile, France) and incubated for 24 h. After incubation, 50 μL of each broth was inoculated on a MacConkey agar (MCA) (BioMérieux, Marcy-l’Étoile, France) plate and incubated at 37 °C for 24 h, according to a previous protocol [13]. The bacterial colonies were identified using the VITEK 2 system (BioMérieux, Marcy-l’Étoile, France).
4.4. Identification of Pathogenic Strains of E. coli by PCR
For each PCR, DNA was extracted by the boiling method, which was employed on a single colony of each isolate in a final volume of 100 µL of distilled water by incubating it at 95 °C for 10 min followed by a centrifugation step [29]. To identify the pathogenicity genes associated with our 26 E. coli strains, two multiplex PCRs were performed, PCR set-1 and PCR set-2. PCR set-1: 5 genes (Eae, pCVD432, LT, STp and STh) were amplified. To obtain a final volume of 50 μL each for 28 tubes, we mixed the following reagents: 25 μL of QIAGEN solution, 10 μL of Q solution, 0.2 μM Eae-f/Eae-r, 0.2 μM pCVD432-f/pCVD432-r, 0.2 μM ST-f/STp-r and 0.2 μM STh-f/STh-r supplemented by 5.2 μL water and 5 μL DNA. PCR set-2: 8 genes (bfp, cadf, ipab, ipah, cada, stx1, stx2 and vtcom) were amplified. To obtain a final volume of 50 μL each for 29 tubes, we mixed the following reagents: 25 μL of QIAGEN solution, 10 μL of Q solution, 0.2 μM Bfp-f/Bfp-r, 0.2 μM CadF-f/CadF-r, 0.2 μM IpaB-f/IpaB-r, 0.2 μM IpaH-f/IpaH-r, 0.2 μM CadA-f/CadA-r, 0.2 μM Stx1-f/Stx1-r, 0.2 μM Stx2-f/Stx2-r, 2.0 μM VTcom-f/VTcom-r supplemented with 6.8 μL of water and 5 μL of DNA. The PCR set-1 and set-2 reactions were performed under the following conditions: denaturation for 15 min at 95 °C and 30 cycles of 30 s at 95 °C, 30 s at 52 °C and 30 s at 72 °C, with a final extension step of 10 min at 72 °C and a hold at 4 °C (Table 4).
Table 4.
Identification of pathogenic strains of E. coli by PCR.
| PCR Reaction | Primer ID | Target | Primer Sequences | PCR Product (bp) | References |
|---|---|---|---|---|---|
| Quadruplex | chuA.1b | chuA | 5′-ATGGTACCGGACGAACCAAC-3′ | 288 | Clermont, O. et al. (2013) [30] |
| chuA.2 | 5′-TGCCGCCAGTACCAAAGACA-3′ | Clermont and colleagues (2000) [31] | |||
| yjaA.1b | yjaA | 5′-CAAACGTGAAGTGTCAGGAG-3′ | 211 | Clermont, O. et al. (2013) [30] | |
| yjaA.2b | 5′-AATGCGTTCCTCAACCTGTG-3′ | Clermont, O. et al. (2013) [30] | |||
| TspE4C2.1b | TspE4.C2 | 5′-CACTATTCGTAAGGTCATCC-3′ | 152 | Clermont, O. et al. (2013) [30] | |
| TspE4C2.2b | 5′-AGTTTATCGCTGCGGGTCGC-3′ | Clermont, O. et al. (2013) [30] | |||
| AceK.f | arpA | 5′-AACGCTATTCGCCAGCTTGC-3′ | 400 | Clermont, O. et al. (2013) [30] | |
| ArpA1.r | 5′-TCTCCCCATACCGTACGCTA-3′ | Clermont, O. et al. [32] | |||
| Group E | ArpAgpE.f | arpA | 5′-GATTCCATCTTGTCAAAATATGCC-3′ | 301 | Lescat and colleagues [33] |
| ArpAgpE.r | 5′-GAAAAGAAAAAGAATTCCCAAGAG-3′ | ||||
| Group C | trpAgpC.1 | trpA | 5′-AGTTTTATGCCCAGTGCGAG-3′ | 219 | Lescat and colleagues [33] |
| trpAgpC.2 | 5′-TCTGCGCCGGTCACGCCC-3′ | ||||
| Internal control | trpBA.f | trpA | 5′-CGGCGATAAAGACATCTTCAC-3′ | 489 | Clermont, O. et al. [30] |
| 5′-GCAACGCGGCCTGGCGGAAG-3′ |
4.5. Identification of Phylogenetic Groups of E. coli
Phylogenetic group classification (A, B1, B2, C, D, E and F) was performed using the Clermon method by amplification of the 4 genes chua, yjiaa, tspe4c2 and aceK in quadruplex PCR, as described previously [2] (Table 5). DNA extraction was performed via the boiling method.
Table 5.
Target genes for pathogenic E. coli characterization [26].
| PCR | Primer | Nucleotide Sequence | Strain | Size |
|---|---|---|---|---|
| Set-1 | ||||
| pCVD432 | CTGGCGAAAGACTGTATCAT | EAEC | 194 bp | |
| AAATGTATAGAAATCCGCTGTT | ||||
| LT | ACGGCGTTACTATCCTCTC | ETEC | 273 bp | |
| TGGTCTCGGTCAGATATGTG | ||||
| STp | TCTTTCCCCTCTTTTAGTCAG | ETEC | 166 bp | |
| ACAGGCAGGATTACAACAAAG | ||||
| STh | TTCACCTTTCCCTCAGGATG | ETEC | 120 bp | |
| CTATTCATGCTTTCAGGACCA | ||||
| Eae | TCAATGCAGTTCCGTTATCAGTT | EPEC/EHEC | 482 bp | |
| GTAAAGTCCGTTACCCCAACCTG | ||||
| Bfp | GGAAGTCAAATTCATGGGGGTAT | Typical EPEC | 300 bp | |
| GGAATCAGACGCAGACTGGTAGT | ||||
| Set-2 | ||||
| Eae | TCAATGCAGTTCCGTTATCAGTT | EPEC/EHEC | 482 bp | |
| GTAAAGTCCGTTACCCCAACCTG | ||||
| CadA | TTCAAAAACATCGATAACGA | EIEC | 680 bp | |
| ACGGTATGCACCGTGAAT | ||||
| Stx-1 | CAGTTAATGTGGTGGCGAAGG | EHEC | 384 bp | |
| CACCAGACAATGTAACCGCTG | ||||
| Stx-2 | ATCCTATTCCCGGGAGTTTACG | EHEC | 584 bp | |
| GCGTCATCGTATACACAGGAGC | ||||
| VTcom | GAGCGAAATAATTTATATGTG | EHEC | 518 bp | |
| TGATGATGGCAATTCAGTAT |
To obtain a final volume of 25 μL each for 24 tubes, we mixed the following reagents: 2.5 μL of buffer solution (TP), 0.4 mM of dNTPs, 2.5 mM of MgCl2, 0.2 μM of P1/P2, 0.2 μM of P3/P4 and 0.2 μM of P5/P6 supplemented with 11.3 μL of water and 5 μL of DNA. PCR was performed under the following conditions: denaturation for 5 min at 94 °C and 30 cycles of 30 s at 94 °C, 30 s at 59 °C and 30 s at 72 °C, with a final extension step of 7 min at 72 °C and hold at 4 °C.
4.6. Antibiotic Susceptibility Testing
Sensitivity studies were conducted according to the Clinical and Laboratory Standards Institute (CLSI) criteria [34]. Antibiotic resistance was assessed via the disk (SirScan Discs, France) diffusion test method on Mueller-Hinton (MH) agar (BioMérieux, Marcy-l’Étoile, France). ESβL production was performed using a double-disk synergy test [30] and confirmed phenotypically on MH agar when the difference in the inhibition zone diameter of one of the cephalosporins (cefotaxime or ceftazidime) alone and combined with a clavulanic acid disc was ≥5 mm.
4.7. Identification of ESβL Genes
For the molecular identification of ESβL genes (Table 1), DNA was extracted from a single colony for each isolate into a final volume of 100 μL of distilled water by incubation at 95 °C for 10 min followed by a centrifugation step. The presence of the blaCTX m (CTX m group 1, 2, 8, 9 and 25), blaTEM and blaSHV genes was assessed by multiplex PCR with primers (Table 1) according to a previously published method [35]. DNA from reference blaCTX-M-, blaTEM- and blaSHV-like-positive strains was used as a positive control. PCR products were visualized after electrophoresis on 1.5% agarose gels containing ethidium bromide, run at 100 V for 80 min. A 100-bp DNA ladder (Promega, Madison, WI, USA, accessed on 5 June 2017) was used as a size marker. PCR products were purified using the ExoSAP-IT BMC purification kit (GE Healthcare, Piscataway, NJ, USA) [36] and sequenced bi-directionally on a 3100 ABI Prism Genetic Analyzer (Applied Biosystems, Norwalk, CT, USA). Nucleotide sequence alignment and analyses were performed online using the BLAST programme available on the National Center for Biotechnology Information web page http://www.ncbi.nlm.nih.gov (accessed on 14 July 2017). The Statistical Package of Social Science Software 20 was used to determine the frequency of isolated strains and the prevalence of antibiotic resistance.
4.8. Accession Numbers
The genome of all genes has been deposited within NCBI/GenBank under the institutional numbers 5(1) blaCTX-M-15 [MK590053], 5B(1) blaCTX-M-15 [MK590054], 13A(1) blaCTX-M-15 [MK590055], 35A blaCTX-M-15 [MK590059], 42A(1) blaCTX-M-15 [MK590060], 42A blaCTX-M-15 [MK590061], 47(1) blaCTX-M-15 [MK590062], 54A(1) blaCTX-M-15 [ MK590063], 69(3) blaCTX-M-15 [MK590064], 90A(1) blaCTX-M-15 [MK590065], 92A(1) blaCTX-M-15 [MK590066], 10(1) blaCTX-M-15 [MK590067], 15(1) blaCTX-M-15 [ MK590068], 41A(1) blaCTX-M-15 [MK590069], 46A(1) blaCTX-M-15 [MK590070], 47(2) blaCTX-M-15 [MK590071], 60A(1) blaCTX-M-15 [MK590072], 62A(1) blaCTX-M-15 [MK590073], 83(1) blaCTX-M-15 [MK590074], 90A(2) blaCTX-M-15 [MK590075], 69(3) blaSHV-12 [MK590076].
5. Conclusions
Our data confirmed the circulation of blaCTX-M-15 and blaSHV-12 in hospitalized infants in Gabon. The results also confirm an emerging resistance to the first-line antibiotics used against bacterial infections in Gabonese hospitals. The alarming fact is that this resistance occurs in opportunistic pathogenic bacteria such as E. coli, and mostly its phylogroup D, which known to be virulent and normally susceptible to antibiotics. This alert will enable doctors to improve their antibiotic prescriptions for E. coli diarrhoea in small children.
Acknowledgments
The analysis of children’s faecal samples was performed thanks to a grant from the Agence Universitaire de la Francophonie (AUF) and CIMRF. We thank them for this opportunity. Special thanks to Professor Kazunari USHIDA (University of Chubu, Kasugai (Japan)) and Professor Sylvain GODREUIL (Laboratoire de bactériologie Hôpital Arnaud de Villeneuve—CHU de Montpellier), who trained us on the characterization of bacterial resistance to antibiotics, for all their useful advice and remarks. Finaly, we thank the IRET/CENAREST organisations.
Author Contributions
Conceptualization, R.O., P.P.M.N., S.G. and G.R.N.A.; Methodology, P.P.M.N., A.-C.D., L.E.D.O.Y. and R.W.L.; Software, P.P.M.N. and J.C.O.M.; Validation, R.O., A.-C.D. and P.P.M.N.; Formal Analysis, P.P.M.N., R.W.L. and A.-C.D.; Investigation, P.P.M.N.; Data Curation, P.P.M.N.; Resources, P.P.M.N. and R.O.; Writing—Original Draft Preparation, R.O., A.-C.D. and P.P.M.N.; Writing—Review and Editing, R.O., P.P.M.N., A.-C.D. and G.R.N.A.; Visualization, C.R.Z.K. and P.P.M.N.; Supervision, R.O.; Project Administration, R.O; Funding Acquisition, P.P.M.N. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
This study did not require ethical approval. But samples were taken with the consent of the children’s parents during consultations and at home during certain episodes of diarrhoea.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This research was funded by Agence Universitaire de la Francophonie (AUF) grant number [G925/BACGL2015/AO/PFD] and The APC was funded by and CIMRF.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Colomb-Cotinat M., Lacoste J., Brun-Buisson C., Jarlier V., Coignard B., Vaux S. Estimating the morbidity and mortality associated with infections due to multidrug-resistant bacteria (MDRB), France, 2012. Antimicrob. Resist. Infect. Control. 2016;5:1–11. doi: 10.1186/s13756-016-0154-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Presterl E., Kremsner P.G., Reichmann S., Zwick R.H., Winkler S., Graninger W., Aichelburg A. Frequency and virulence properties of diarrheagenic Escherichia coli in children with diarrhea in Gabon. Am. J. Trop. Med. Hyg. 2003;69:406–410. doi: 10.4269/ajtmh.2003.69.406. [DOI] [PubMed] [Google Scholar]
- 3.Levine G.A., Walson J.L., Atlas H.E., Lamberti L.M., Pavlinac P.B. Defining pediatric diarrhea in low-resource settings. J. Pediatr. Infect. Dis. Soc. 2017;6:289–293. doi: 10.1093/jpids/pix024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Huang Z., Pan H., Zhang P., Cao X., Ju W., Wang C., Zhang J., Meng J., Yuan Z., Xu X. Prevalence and antimicrobial resistance patterns of diarrheagenic Escherichia coli in Shanghai, China. J. Pediatr. Infect. Dis. 2016;35:835–839. doi: 10.1097/INF.0000000000001190. [DOI] [PubMed] [Google Scholar]
- 5.Yala J.F., Mabika R.M., Bisseye C., Kenguele H. Phenotypic and genotypic characterization of extended-spectrum-beta-lactamases producing-Enterobacteriaceae (ESβLE) in patients attending Omar Bongo Ondimba military hospital at Libreville (Gabon) Curr. Res. Microbiol. 2016;4:944–949. [Google Scholar]
- 6.Ahoyo T.A., Bankolé H.S., Adéoti F.M., Gbohoun A.A., Assavèdo S., Amoussou-Guénou M., Kindé-Gazard D.A., Pittet D. Prevalence of nosocomial infections and anti-infective therapy in Benin: Results of the first nationwide survey in 2012. Antimicrob. Resist. Infect. Control. 2014;3:17. doi: 10.1186/2047-2994-3-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Schaumburg F., Alabi A., Kokou C., Grobusch M.P., Köck R., Kaba H., Becker K., Adegnika A.A., Kremsner P.G., Peters G., et al. High burden of extended-spectrum β-lactamase-producing Enterobacteriaceae in Gabon. J. Antimicrob. Chemother. 2013;68:2140–2143. doi: 10.1093/jac/dkt164. [DOI] [PubMed] [Google Scholar]
- 8.Pieboji J.G. Ph.D. Thesis. Universite de Liege; Liège, Belgium: 2007. Caractérisation des Beta-Lactamases et leur Inhibition par les Extraits de Plantes Médicinales/Beta-Lactamase Characterization and Their Inhibition by Medicinal Plants Extract. [Google Scholar]
- 9.Cantón R., González-Alba J.M., Galán J.C. CTX-M enzymes: Origin and diffusion. Front. Microbiol. 2012;3:110. doi: 10.3389/fmicb.2012.00110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Woerther P.-L., Burdet C., Chachaty E., Andremont A. Trends in human fecal carriage of extended-spectrum β-lactamases in the community: Toward the globalization of CTX-M. Clin. Microbiol. Rev. 2013;26:744–758. doi: 10.1128/CMR.00023-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hansen K.H., Damborg P., Andreasen M., Nielsen S.S., Guardabassi L. Carriage and fecal counts of cefotaxime M-producing Escherichia coli in pigs: A longitudinal study. Appl. Environ. Microbiol. 2013;79:794–798. doi: 10.1128/AEM.02399-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ewers C., Bethe A., Semmler T., Guenther S., Wieler L. Extended-spectrum β-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: A global perspective. Clin. Microbiol. Infect. 2012;18:646–655. doi: 10.1111/j.1469-0691.2012.03850.x. [DOI] [PubMed] [Google Scholar]
- 13.Janatova M., Albrechtova K., Petrzelkova K.J., Dolejska M., Papousek I., Masarikova M., Cizek A., Todd A., Shutt K., Kalousova B., et al. Antimicrobial-resistant Enterobacteriaceae from humans and wildlife in Dzanga-Sangha Protected Area, Central African Republic. Vet. Microbiol. 2014;171:422–431. doi: 10.1016/j.vetmic.2014.02.014. [DOI] [PubMed] [Google Scholar]
- 14.Stoppe N.d.C., Silva J.S., Carlos C., Sato M.I.Z., Saraiva A.M., Ottoboni L.M.M., Torres T.T. Worldwide phylogenetic group patterns of Escherichia coli from commensal human and wastewater treatment plant isolates. Front. Microbiol. 2017;8:2512. doi: 10.3389/fmicb.2017.02512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Mosquito S., Pons M.J., Riveros M., Ruiz J., Ochoa T.J. Diarrheagenic Escherichia coli phylogroups are associated with antibiotic resistance and duration of diarrheal episode. Sci. World J. 2015;2015:610403. doi: 10.1155/2015/610403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Dubois V., De Barbeyrac B., Rogues A.-M., Arpin C., Coulange L., Andre C., M’Zali F., Megraud F., Quentin C. CTX-M-producing Escherichia coli in a maternity ward: A likely community importation and evidence of mother-to-neonate transmission. J. Antimicrob. Chemother. 2010;65:1368–1371. doi: 10.1093/jac/dkq153. [DOI] [PubMed] [Google Scholar]
- 17.Koko J., Ambara J., Ategbo S., Gahouma D. Epidemiology of acute bacterial diarrhea in children in Libreville, Gabon. Arch. Pediatr. Organe Off. Soc. Fr. Pediatr. 2013;20:432. doi: 10.1016/j.arcped.2013.01.017. [DOI] [PubMed] [Google Scholar]
- 18.Mbehang Nguema P.P., Tsuchida S., Ushida K. Bacteria culturing and isolation under field conditions of Moukalaba-Doudou National Park, Gabon, and preliminary survey on bacteria carrying antibiotic resistance genes. Tropics. 2015;23:165–174. doi: 10.3759/tropics.23.165. [DOI] [Google Scholar]
- 19.Konaté A., Dembélé R., Guessennd N.K., Kouadio F.K., Kouadio I.K., Ouattara M.B., Kaboré W.A.D., Kagambèga A., Cissé H., Ibrahim H.B., et al. Epidemiology and antibiotic resistance phenotypes of diarrheagenic Escherichia coli responsible for infantile gastroenteritis in Ouagadougou, Burkina Faso. Eur. J. Microbiol. Immunol. 2017;7:168–175. doi: 10.1556/1886.2017.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nejma I.B.S.-B., Zaafrane M.H., Hassine F., Sdiri-Loulizi K., Ben Said M., Aouni M., Mzoughi R. Etiology of acute diarrhea in Tunisian children with emphasis on diarrheagenic Escherichia coli: Prevalence and identification of E. coli virulence markers. Iran J. Public. Health. 2014;43:947–960. [PMC free article] [PubMed] [Google Scholar]
- 21.Singh T., Das S., Ramachandran V., Dar S.A., Snehaa K., Saha R., Shah D. Spectrum of diarrhoeagenic Escherichia coli in paediatric population suffering from diarrhoea and as commensals in healthy children. Indian J. Med. Microbiol. 2017;35:204. doi: 10.4103/ijmm.IJMM_16_21. [DOI] [PubMed] [Google Scholar]
- 22.Jauréguy F. Déterminants cliniques et bactériens au cours des infections extra-intestinales dues à Escherichia coli. Med. Sci. 2009;25:221–223. doi: 10.1051/medsci/2009253221. [DOI] [PubMed] [Google Scholar]
- 23.Jakobsen L., Spangholm D.J., Pedersen K., Jensen L.B., Emborg H.-D., Agersø Y., Aarestrup F.M., Hammerum A.M., Frimodt-Møller N. Broiler chickens, broiler chicken meat, pigs and pork as sources of ExPEC related virulence genes and resistance in Escherichia coli isolates from community-dwelling humans and UTI patients. Int. J. Food Microbiol. 2010;142:264–272. doi: 10.1016/j.ijfoodmicro.2010.06.025. [DOI] [PubMed] [Google Scholar]
- 24.Rerambiah L.K., Ndong J.-C., Massoua P.M.M., Medzegue S., Elisee-Ndam M., Mintsa-Ndong A., Siawaya J.F.D. Antimicrobial profiles of bacterial clinical isolates from the Gabonese National laboratory of public health: Data from routine activity. Int. J. Infect. Dis. 2014;29:48–53. doi: 10.1016/j.ijid.2014.01.015. [DOI] [PubMed] [Google Scholar]
- 25.Vlieghe E., Phoba M., Tamfun J.M., Jacobs J. Antibiotic resistance among bacterial pathogens in Central Africa: A review of the published literature between 1955 and 2008. Int. J. Antimicrob. Agents. 2009;34:295–303. doi: 10.1016/j.ijantimicag.2009.04.015. [DOI] [PubMed] [Google Scholar]
- 26.Sbiti M. Profil épidémiologique des entérobactéries uropathogènes productrices de bêta-lactamases à spectre élargi. Pan. Afr. Med. J. 2017;28:29. doi: 10.11604/pamj.2017.28.29.11402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Liakopoulos A., Mevius D.J., Olsen B., Bonnedahl J. The colistin resistance mcr-1 gene is going wild. J. Antimicrob. Chemother. 2016;71:2335–2336. doi: 10.1093/jac/dkw262. [DOI] [PubMed] [Google Scholar]
- 28.Cao X.L., Shen H., Xu Y.Y., Xu X.J., Zhang Z.F., Cheng L., Chen J.H., Arakawa Y. High prevalence of fosfomycin resistance gene fosA3 in blaCTX-M-harbouring Escherichia coli from urine in a Chinese tertiary hospital during 2010–2014. Epidemiol. Infect. 2017;145:818–824. doi: 10.1017/S0950268816002879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Peng X., Yu K.-Q., Deng G.-H., Jiang Y.-X., Wang Y., Zhang G.-X., Zhou H.-W. Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags. J. Microbiol. Methods. 2013;95:455–462. doi: 10.1016/j.mimet.2013.07.015. [DOI] [PubMed] [Google Scholar]
- 30.Clermont O., Christenson J.K., Denamur E., Gordon D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013;5:58–65. doi: 10.1111/1758-2229.12019. [DOI] [PubMed] [Google Scholar]
- 31.Clermont O., Bonacorsi S., Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000;66:4555–4558. doi: 10.1128/AEM.66.10.4555-4558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Clermont O., Bonacorsi S., Bingen E. Characterization of an anonymous molecular marker strongly linked to Escherichia coli strains causing neonatal meningitis. J. Clin. Microbiol. 2004;42:1770–1772. doi: 10.1128/JCM.42.4.1770-1772.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Lescat M., Clermont O., Woerther P.L., Glodt J., Dion S., Skurnik D., Djossou F., Dupont C., Perroz G., Picard B., et al. Commensal Escherichia coli strains in Guiana reveal a high genetic diversity with host-dependant population structure. Environ. Microbiol. Rep. 2013;5:49–57. doi: 10.1111/j.1758-2229.2012.00374.x. [DOI] [PubMed] [Google Scholar]
- 34.CLSI . Laboratory Standards Institute Antimicrobial Susceptibility Testing Standards M02-A12, M07-A10, and M11-A8. CLSI; Wayne, PA, USA: 2017. [Google Scholar]
- 35.Afiukwa F.N., Iroha R.I., Afiukwa A.C., Igwe O.D. First report of blaCTX-M-15 extended spectrum beta-lactamase (Esbl) producing E. coli isolated from cloacal swabs of birds in South Eastern Nigeria. Int. Arch. Biomed. Clin. Res. 2016;2:35–39. doi: 10.21276/iabcr.2016.2.2.8. [DOI] [Google Scholar]
- 36.Ouedraogo A.-S., Sanou M., Kissou A., Sanou S., Solaré H., Kaboré F., Poda A., Aberkane S., Bouzinbi N., Sano I., et al. High prevalence of extended-spectrum ß-lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect. Dis. 2016;16:326. doi: 10.1186/s12879-016-1655-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are contained within the article.