Skip to main content
Microorganisms logoLink to Microorganisms
. 2024 Oct 30;12(11):2181. doi: 10.3390/microorganisms12112181

Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health

Jessica I Licea-Herrera 1, Abraham Guerrero 2, Maribel Mireles-Martínez 1, Yuridia Rodríguez-González 1, Guadalupe Aguilera-Arreola 3, Araceli Contreras-Rodríguez 3, Susana Fernandez-Davila 1, Rocío Requena-Castro 1, Gildardo Rivera 1, Virgilio Bocanegra-García 1, Ana Verónica Martínez-Vázquez 1,*
Editor: Lilan Zhang
PMCID: PMC11596188  PMID: 39597570

Abstract

Pseudomonas aeruginosa is an opportunistic pathogen with a high capacity to adapt to different factors. The aim of this study is to analyze the pathogenicity in P. aeruginosa strains and their resistance to heavy metals and antibiotics, in agricultural soil of the state of Tamaulipas, Mexico. Susceptibility to 16 antibiotics was tested using the Kirby-Bauer method (CLSI). Eight virulence factors (FV) and six genes associated with heavy metal resistance were detected by PCR. As a result, P. aeruginosa was detected in 55% of the samples. The eight virulence factors were identified in ≥80% of the strains. The strains showed some level of resistance to only three antibiotics: 32.8% to ticarcillin, 40.8% to ticarcillin/clavulanic acid and 2.4% to aztreonam. The most frequent heavy metal resistance genes were arsC (92.8%) and copA (90.4%). However, copB and arsB genes were also identified in a percentage greater than 80%, and the least frequent genes were merA in 14.4% and czcA in 7.2%. Although P. aeruginosa strains showed a high percentage of factor virulence (potential ability to cause infections), their high levels of susceptibility to antibiotics lead to the assumption that infections are easily curable.

Keywords: Pseudomonas, agriculture, virulence, antimicrobial resistance, México

1. Introduction

Pseudomonas aeruginosa is the most prevalent opportunistic pathogen of environmental origin and is a major cause of bloodstream infections, ventilator-associated pneumonia, nosocomial urinary tract and surgical site infections [1,2,3]. It is the cause of 18–61% of hospital deaths due to nosocomial infections [4,5]. Pseudomonas spp. infections are difficult to treat owing to multiple factors, including the ability to cause direct damage to host tissue, high genomic plasticity, extensive intrinsic drug resistance and the progressive increase in antimicrobial resistance [6]. Thus, this bacterium has multiple antibiotic resistance phenotypes that could allow its survival during antibiotic treatment of an infection [7]. Therefore, P. aeruginosa has been included as one of the three bacterial species on the list of “priority pathogens” that urgently require the development of new treatment alternatives by the World Health Organization [8,9]. Its pathogenic profile stems from the large and variable arsenal of virulence factors and antibiotic resistance determinants harbored in P. aeruginosa’s genome, which confer remarkable ability to adapt to multiple conditions [1,10,11,12,13]. Although most studies on P. aeruginosa have been conducted in a hospital environment (clinical samples, utensils, surfaces, equipment and others), it is considered that this is only a temporary habitat, and that contamination has another origin [14]. That is why several studies have focused on studying soil, water, plants and animals as natural and permanent reservoirs for the bacteria [14,15,16].

Furthermore, as has been discussed in several studies, human, industrial and agricultural activities are intensifying the environmental resistome (i.e., the total collection of all genes that can directly or indirectly confer resistance to antibiotics in the environment) [15,17,18]. In this way, the increase in antibiotic resistance genes in the environment is stimulated, which further increases the number of resistant pathogenic microorganisms in different environments, thus endangering human health [19]. The mechanism of emergence and spread of antimicrobial resistance genes is a complex process, which includes multiple factors such as heavy metals [20], the aggressive use of antimicrobials in the intensive agriculture and livestock farming [21], wastewater treatment plant (WWTP) disposal [22] and use of antibiotics either as growth promoters and/or disease prevention of animals [23,24].

The proportion of P. aeruginosa strains demonstrating multidrug resistance is increasing worryingly worldwide [25]. In different countries, the prevalence of multidrug-resistant isolates varies from 14% to 30%, with carbapenem resistance occurring in 15–22% of cases, these isolates being those included in the WHO priority lists [6,25,26]. However, this antimicrobial resistance and virulence of P. aeruginosa strains may vary between different regions depending on various factors.

Given its ubiquitous distribution, its ability to infect/colonize a variety of hosts and its capacity for resistance to antibiotics, P. aeruginosa can be considered a model to study from a “one health” perspective [27,28]. In Mexico, few studies address the presence of Pseudomonas aeruginosa in the environment, so little is known about its resistance to antibiotics or heavy metal, and virulence. Therefore, the aim of this study was to evaluate the resistance to heavy metal and antibiotics, as well as the pathogenicity in P. aeruginosa strains from agricultural soil in the state of Tamaulipas, Mexico.

2. Materials and Methods

2.1. Samples Collection

A total of 100 agricultural soil samples were collected at different sites in the state of Tamaulipas, Mexico, in the years 2021–2023. In each site, samples of soil were taken at 20 cm depth. Each sample was placed individually in a plastic bag, labeled and stored in an icebox for transport to a laboratory in Centro de Biotecnología Genómica-IPN.

2.2. Isolation and Identification of Pseudomonas aeruginosa

All the samples were homogenized in peptone water (1:9 proportion) (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) and incubated for 18–24 h at 37 °C. Following homogenization, samples were inoculated in triplicate on CHROMagar Pseudomonas (CHROMagar, Paris, France) plates and incubated overnight at 37 °C. After incubation, presumptive colonies with morphological characteristics of P. aeruginosa were inoculated individually on trypticase soy agar (TSA) plates (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) and incubated for 24 h at 37 °C.

All the strains’ identities were confirmed using two methods: (a) Polymerase Chain Reaction (PCR) and (b) MALDI-TOF (Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry):

  • (a)

    PCR identification: DNA was extracted from bacterial culture using the cell lysis method [29]. One-day-old colonies were picked, suspended in 500 µL MiliQ water and lysed by incubation at 95 °C for 15 min. Afterwards they were centrifugated at 13,000 for 3 min. The supernatant was used to perform the PCR. DNA was stored at −20 °C until use.

The specific amplification primer used for PCR assay were rpoD (PsEG30F, 5′-ATYGAAATCGCCAAR CG-3′; PsEG790R, 5′-CGGTTGATKTCCTTGA-3′) for the genus Pseudomonas and ecfX (ECF5, 5′-AAGCGTTCGTCCTGCACAA-3′; ECF2, 5′-TCATCCTTCGCCTCCCTG-3) for the species P. aeruginosa [30,31], with a positive control P. aeruginosa ATCC 27853® and ATCC 9027®.

All PCR assays were performed in a 25 µL reaction mixture, containing 5x buffer (Promega, Madison, WI, USA), 25 mM MgCl2 (Promega, USA), 10 µM dNTPs (Bioline, Camarillo, CA, USA), 10 µM primers, 5 U/µL Taq DNA polymerase (Promega, USA) and sterile water. The reaction mixture was incubated in a thermocycler VeritiTM Thermal Cycler (Applied BiosystemsTM, Waltham, MA, USA). PCR amplifications started with an initial denaturation at 95 °C for 15 min, followed by 30 cycles of 95 °C for 45 s, 52 °C for 45 s, 72 °C for 45 s and then a final cycle at 72 °C for 7 min. PCR products were evaluated in 2.0% agarose gels with TBE 0.5X at 1.5% (w/v), with SYBR Gold (Invitrogen, Paisley, UK) and molecular marker (100 pb Promega, USA) at 100 V for 45 min.

  • (b)

    MALDI-TOF identification: Isolated colonies were identified using the Vitek MS Plus mass spectrometer (bioMerieux, Marcy l’Etoile, France) with the mass spectrum ranged from 2000 to 20,000 Da. A fresh colony isolated on trypticase soy agar (TSA) plates (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) and incubated 24 h at 37 °C was directly spotted on the MALDI plate with the help of a sterile toothpick and placed onto a steel micro scout plate following the manufacturer’s instructions. After the plate was placed in the instrument and the system was operated using the method for the identification of bacteria. For each bacterial sample, mass fingerprints were processed by Compute Engine and the advanced spectrum classifier (ASC) algorithm of the Vitek MS system which automatically identifies a species by comparing the obtained spectrum (presence or absence of specific peaks) with the spectra typical of each claimed species (Vitek MS IVD version 3.0.0). A confidence interval of 98–99% was considered acceptable for species level identification (ID).

2.3. Detection of Virulence Factors

The same gDNA extracted from the cell lysis method was used for the virulence factor genes detection. All isolates were analyzed by PCR to identify the presence of eight virulence-related genes (algD, exoS, plcH, plcN, toxA, aprA, lasB and rhlAB) (Table 1) [32,33,34]. The PCRs were performed using 5× buffer (Promega, USA), 25 mM MgCl2 (Promega, USA), 10 µM dNTPs (Bioline, USA), 10 µM primers, 5 U/µL Taq DNA polymerase (Promega, USA) and sterile water in a total reaction volume of 25 µL. Four PCR reactions (three multiplex and one singleplex) were performed for each strain. The PCR program was 95 °C for 3 min, 30 cycles of 95 °C for 1 min, 55 °C for 45 s, 72 °C for 1 min 30 s and 72 °C for 5 min. PCR products were visualized in 2.0% agarose gels.

Table 1.

Primers of virulence-related genes used in the study.

Target Genes Size
(bp)
Primer Sequence
5′ → 3′
Reference
algD 1310 ATGCGAATCAGCATCTTTGGT CTACCAGCAGATGCCCTCGGG [32]
exoS 504 CTTGAAGGGACTCGACAAGG TTCAGGTCCGCGTAGTGAAT [32]
plcH 307 GAAGCCATGGGCTACTTCAA AGAGTGACGAGGAGCGGTAG [32]
toxA 352 GGTAACCAGCTCAGCCACAT TGATGTCCAGGTCATGCTTC [32]
aprA 140 ACCCTGTCCTATTCGTTCC GATTGCAGCGACAACTTGG [34]
lasB 300 GGAATGAACGAAGCGTTCTC GGTCCAGTAGTAGCGGTTGG [32]
rhlAB 151 TCATGGAATTGTCACAACCGC ATACGGCAAAATCATGGCAAC [34]
plcN 466 GTTATCGCAACCAGCCCTAC AGGTCGAACACCTGGAACAC [32]

2.4. Antimicrobial Susceptibility Testing

The Kirby-Bauer disc diffusion method was employed according to the standard procedure described by the Clinical and Laboratory Standards Institute (CLSI) [35]. The isolates were tested against a panel of 16 antibiotics: piperacillin (P, 100 µg), piperacillin-tazobactam (TZP, 10/100 µg), ticarcillin (TIC, 10 µg), ticarcillin-clavulanic (75/10 µg, TIM), ceftazidime (30 µg, CAZ), cefepime (30 µg, FEP), aztreonam (30 µg, ATM), imipenem (10 µg, IPM), tobramycin (TM, 10 µg), meropenem (10 µg, MEM), gentamicin (10 µg, GM), amikacin (30 µg, AN), netilmicin (30 µg, NET), ciprofloxacin (5 µg, CIP), levofloxacin (5 µg, LEV) and norfloxacin (N, 10 µg).

Isolates were inoculated onto trypticase soy agar (TSA) plates (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) and incubated for 24 h at 37 °C. Bacterial suspensions were prepared from fresh culture into 0.9 saline water and turbidity was adjusted equivalent to a concentration of 0.5 McFarland. Each one was individually inoculated on Muller–Hinton agar plate (Becton Dickinson & Co., Franklin Lakes, NJ, USA) using a sterile cotton swab and antibiotic discs were dispensed on the surfaces of the inoculated plates, to then incubate at 37 °C for 24 h. After the incubation time, the diameter of the clear zone of inhibition around each antimicrobial disc was measured in millimeters (mm) and classified as resistant (R), intermediate (I) or susceptible (S) according to CLSI M100 document guidelines.

2.5. Detection Class 1 Integrons

All P. aeruginosa strains were analyzed by PCR to detect the presence of intl1 (encoding class 1) F: 5′-GGTCAAGGATCTGGATTTCG-3′/R: 5′-ACATGCGTGTAAATCATCGTC-3′ [36]. Negative controls (samples without a DNA template) and positive controls (samples with DNA from the collection of the Instituto Politécnico Nacional) were included in all PCR assays. The PCR reaction mixture was employed in 25 µL reaction volumes containing 5x buffer (Promega, USA), 25 mM MgCl2 (Promega, USA), 10 µM dNTPs (Bioline, USA), 10 µM primers, 5 U/µL Taq DNA polymerase (Promega, USA), DNA template and sterile water. PCR amplification was conducted following these conditions: 95 °C for 1 min, 30 cycles of 95 °C for 45 s, 54 °C for 45 s, 72 °C for 45 s and 72 °C for 7 min. PCR products were visualized in 2.0% agarose gels at 100 V for 45 min. A molecular marker was run concurrently (100 pb Promega, USA).

2.6. Detection of Heavy Metal Resistance Genes

Six heavy metal resistance genes were screened by PCR: genes encoding copper (copA and copB), arsenic (arsA and arsB), mercury (merA) and cobalt/zinc/cadmium (czcA) (Table 2). The PCR reaction mixture contained 5x buffer (Promega, USA), 25 mM MgCl2 (Promega, USA), 10 µM dNTPs (Bioline, USA), 10 µM primers, 5 U/µL Taq DNA polymerase (Promega, USA) and DNA template. The volume of this mix was adjusted to 25 μL with sterile water. The PCR amplification conditions were as follows: initial denaturation at 95 °C for 1 min, followed by 30 cycles of denaturation at 95 °C for 45 s, annealing at 54–60 °C for 45 s, extension at 72 °C for 45 s and a final cycle of amplification at 72 °C for 7 min. Verification of PCR products was performed in horizontal electrophoresis using 2.0% agarose gel with 0.5× TBE and Sybr gold at 100 V for 45 min. A molecular marker was run concurrently (100 pb Promega, USA). The negative control consisted of all contents of the reaction mixture excluding template DNA, which was substituted with 1 μL sterile water. The DNA bands were visualized and photographed under UV light.

Table 2.

Primers of heavy metal resistance genes used in the study.

Target Genes Size
(bp)
Primer Sequence
5′ → 3′
Reference
copA 475 CGGTCTCTACGAATACCGCTTCAA
GAAATAGCTCATTGCCGAGGCGTT
[37]
copB 364 TTCCTGCTCGACCAGTTGGAATAC
GGTTGGTCAACAGGATGTCGTACT
[37]
arsB 410 GGTCTATGCGCTGGAGCAATTGAA
TGCTGGGCATGTTGTTCATTACCG
[37]
arsC 205 GCAGCATTCTTTCCGAAGCCATGT
TCGCAAACGGTGATGACGATGT
[37]
merA 932 GTGCCGTCCAAGATCATGAT
TAGCCYACRGTSGCSACYTG
[38]
czcA 206 GTTCACCTTGCTCTTCGCCATGTT
ACAGGTTGCGGATGAAGGAGATCA
[37]

3. Results

3.1. Samples Collection

A total of 100 agricultural soil samples were collected from different locations in 24 municipalities from the state of Tamaulipas, Mexico. According to the USDA system, the texture of the samples was classified into 10 types of soil, mainly sandy clay loam (20%), clay loam (19%), silty loam (18%) and loam (16%). Soil samples were obtained from 12 different types of crops; the majority were collected from sorghum (29%), corn (24%), orange (16%) and sugar cane (13%).

3.2. Isolation and Identification of Pseudomonas aeruginosa

In the identification by molecular methods (PCR) of the 100 agricultural soil samples, the genus Pseudomonas was identified in 89% of samples and the P. aeruginosa species in 55%.

From each sample, between 1 and 3 strains were identified (depending on availability), making a total of 285 strains analyzed in this study. After molecular identification by MALDI-TOF, 125 strains of Pseudomonas aeruginosa were confirmed.

The 125 strains confirmed as P. aeruginosa were isolated from 55 soil samples, of which 27.2% (15/55) were silty loam, 23.6% (13/55) sandy clay loam and 16.3% (9/55) clay loam. Considering the type of crop present, 25.4% (14/55) were orange, 23.6% (13/55) corn, 21.8% (12/55) sorghum, 9.0% (5/55) sugar cane and six types of crops were in lower percentages (≤6.0%).

3.3. Detection of Virulence Factors

The individual prevalence of the virulence factors analyzed was over 80% for the P. aeruginosa strains. The most prevalent virulence factor was aprA, present in 97.6% (122/125), followed by lasB and plcN, both present in 96% (120/125) of the strains. On the other hand, the virulence factor with the lowest presence was algD, present in 84.8% (106/125) of the strains (Figure 1). A total of 72% (90/125) of P. aeruginosa strains had the eight virulence factors analyzed.

Figure 1.

Figure 1

Prevalence of virulence factors in P. aeruginosa isolated from agricultural soil in Tamaulipas, Mexico.

3.4. Antimicrobial Susceptibility Testing

Among the 125 P. aeruginosa strains analyzed, 58.4% (73/125) showed resistance or intermediate resistance to at least one of the antibiotics tested. The strains were resistant or intermediate resistant to only 3 of the 16 antibiotics tested: ticarcillin, ticarcillin-clavulanic acid and aztreonam. A total of 32.8% (41/125) of the strains were intermediate resistant to ticarcillin, 4.0% (5/125) were resistant to ticarcillin/clavulanic acid, 36.8% (46/125) were intermediate resistant to ticarcillin/clavulanic acid, 0.8% (1/125) was resistant to aztreonam and 1.6% (2/125) were intermediate resistant to aztreonam. Considering both resistance and intermediate resistance, 2.4% (3/125) were co-resistant to TIM + ATM. While 14.4% (18/125) showed simultaneous intermediate resistance to TIM + TIC, no multiresistant strain was detected.

The results obtained between the antibiotics that showed some level of resistance (TIC, ATM and TIM) and the virulence factors were correlated (Figure 2). A strong positive correlation was observed between the ATM and aprA gene (−0.70 ***), ATM and lasB (−0.53 ***), ATM and exoS (−0.45 ***), ATM and rhlA (−0.45 ***), ATM and plcH (−0.41 ***) and TIM and lasB gene (−0.34 ***). In addition, a moderate positive correlation was detected between the TIM and exoS gene (−0.27 **), TIM and plcH (−0.25 **), TIM and aprA (−0.24 **) and TIM and rhlA gene (−0.24 **).

Figure 2.

Figure 2

Correlation matrix between the antibiotics ticarcillin (TIC), ticarcillin-clavulanic (TIM), aztreonam (ATM), and the virulence factors. The intensity of the color is proportional to the correlation coefficient (−0.1 to 1.0), the * indicates significant Pearson correlation (p < 0.05), ** indicates moderate positive correlation and *** indicates strong positive correlation.

3.5. Detection Class 1 Integrons

The class 1 integrons (int1) were not identified in any of the 125 P. aeruginosa strains analyzed.

3.6. Detection of Heavy Metal Resistance Genes

The most prevalent heavy metal resistance genes were arsC and copA, present in 92.8% (116/125) and 90.4% (113/125) of P. aeruginosa strains, respectively. However, copB and arsB genes were also identified in a percentage higher than 80%, and the least prevalent genes were merA, identified in 14.4% of the strains, and czcA, identified in 7.2% of the strains (Figure 3).

Figure 3.

Figure 3

Prevalence of heavy metal resistance genes in P. aeruginosa isolated from agricultural soils.

Considering the 73 strains that showed co-resistance to heavy metals and antibiotics (in the case of antibiotic resistance and intermediate resistance), 95.8% (70/73) exhibited one of the genes associated with resistance to copper (copA or copB). Of these, 90.4% (66/73) had the copA gene and 90.4% (66/73) had copB, while 84.9% showed both genes (copA and copB). Among the genes associated with arsenic resistance, of these strains 89.0% (65/73) presented the arsB gene and 93.1% (68/73) the arsC gene. In 84.9% (62/73), both genes (arsB and arsC) were detected, while the gene associated with resistance to mercury (merA) was only detected in 12.3% (9/73) and the gene associated with resistance to cobalt/zinc/cadmium (czc) in 5.4% (4/73).

Now, considering the resistance to each antibiotic individually, among the 41 strains that showed intermediate resistance to TIC, 78.0% (32/41) had the copA gene, 85.3% (35/41) the copB gene, 80.4% (33/41) the arsB gene, 85.3% (35/41) the arsC gene, 12.1% (5/41) the merA gene and 7.3% (3/41) the czc gene. Of the 51 strains that showed resistance or intermediate resistance to TIM, 88.2% (45/51) presented the copA gene, 90.1% (46/51) copB, 86.2% (44/51) arsB, 92.1% (47/51) arsC, 9.8% (5/51) mercA and 3.9% czc. Of the three strains that showed resistance or intermediate resistance to ATM and TIM, only one strain presented the copA and arsC genes. In the other two strains, no genes associated with resistance to heavy metals were detected.

The correlation between antibiotic resistance (TIC, ATM and TIM) and heavy metal genes (arsB, arsC, copA, copB, czcA, mercA) is represented in Figure 4. The results showed a strong positive correlation between the antibiotic aztreonam and the genes for copper (copA with −0.33 *** and copB with −0.40 ***) and arsenic (arsB with −0.39 *** and arsC with −0.39 ***).

Figure 4.

Figure 4

Correlation matrix between the antibiotics ticarcillin (TIC), ticarcillin-clavulanic (TIM), aztreonam (ATM) and the heavy metal genes. Values (Pearson’s R) are different from ‘zero’ with a significance level of p < 0.05). The * indicates significant positive correlation, ** indicates moderate positive correlation and *** indicates strong positive correlation.

4. Discussion

Pseudomonas aeruginosa is a bacterium that can be found in various habitats due to its broad metabolic versatility that improves its distribution, proliferation and survival despite adverse physical and chemical conditions, thus enhancing its ecological success and potential threat to public health [39,40,41]. In this study, 100 agricultural soil samples were analyzed, and in 89% of the samples Pseudomonas spp. was detected, and 55% of those strains were confirmed as P. aeruginosa.

The prevalence or distribution of Pseudomonas aeruginosa may be due to several factors. Some authors have argued that bacteria are not randomly distributed, but are in different microenvironments (i.e., mainly in pores of different sizes and shapes) in the soil [42]. So, we consider the type of soil in which the strains were detected. Although 10 different types of soil were identified in the samples taken for this study, P. aeruginosa strains were isolated mainly from silt loam (15/18), sandy clay loam (13/20) and clay loam (9/19) soils. Another factor in the environment that could be related to the presence or absence of P. aeruginosa in the soil is the type of existing crop. Most strains were isolated from soil with orange (14/16), maize (13/24) and sorghum (12/29) crops. Statistically, the number of samples analyzed in this study is not sufficient to establish an association between the type of soil and the presence of P. aeruginosa, but these are the first results generated in the region. We hope that they will be a basis for directing studies in this objective.

In the current study for Tamaulipas, a prevalence of 55% of P. aeruginosa was detected, with results similar to those reported in other regions, such as 67% in Bangladesh [30] and 51.1% in Lithuania [43], but higher than what was published for the United States, with 37.5% [16], or India, with 33.8% [44].

P. aeruginosa is often described as a common soil bacterium [45]; however, it must be considered that its presence in agricultural soil can also be enriched by irrigation water, wastewater or livestock feces. Several studies have detected the presence of P. aeruginosa in surface waters and wastewater in a concentration from 19% to 70% [42,46,47,48]. This high prevalence indicates sites closely associated with human activities [45].

Along the course of a river or irrigation canal, water may mix with drainage water from domestic, industrial or other sources, increasing the possibility of transporting and accumulating bacteria such as P. aeruginosa in agricultural soil.

In Mexico, a previous study by Gutiérrez and collaborators [49] analyzed irrigation water samples in Michoacan and reported a 46% prevalence of P. aeruginosa. This is a similar percentage to what we detected in the current soil study for Tamaulipas (55%). Although in our study we did not include an analysis of the prevalence of P. aeruginosa in irrigation water, it is clear that irrigation water is an important factor influencing its presence in soil. Therefore, we will carry out a continuity study with rivers and irrigation canals in Tamaulipas.

Although a prevalence of P. aeruginosa greater than 50% was detected in agricultural soil samples from Tamaulipas, this does not necessarily imply a risk to public health. The pathogenicity of these strains depends on the virulence factors (VF) present, which allow bacterial colonization, penetration, damage to host tissues and successful infection [50]. Thus, only by knowing the factor virulence present can the potential risk that these strains represent for public health be evaluated.

In this study, 100% (125/125) of the strains P. aeruginosa had at least 2 VFs, 97.6% (122/125) had more than 3 VFs and 72.0% (90/125) had the totality of the VFs (8) analyzed. This result is higher compared to the strains analyzed in Brazilian agricultural soils, where 46% showed 1 to 3 VFs, and 39% presented 4 to 6 VFs [33]. In the current results for Tamaulipas agricultural soil, all analyzed VFs had a prevalence greater than 80%.

Toxin A (toxA), which can suppress protein synthesis and affect macrophage action, was present in 87.2% of the soil isolates in this study. This prevalence is lower than that reported by Gutierrez et al. [49] for irrigation water in Michoacan, Mexico, where they report the toxA gene in 100% of the strains analyzed. By contrast, alkaline protease (aprA), which can interfere with fibrin formation and inactivate host defense proteins, was detected in 97.6% of agricultural soil strains. This is similar to the 95.3% reported by Kaszab et al. [51] in environmental samples from Germany (soil, groundwater, compost, wastewater). For its part, elastase B exoenzyme (lasB), an elastolytic zinc metalloproteinase and one of the virulence factors necessary for the process of initial pathogenesis and elastin degradation, was present in 96.0% of the strains. This percentage is like that reported by Kaszab et al. [51] (100%) or Gutierrez et al. [49] (98.0%) in environmental samples.

These virulence factors have been reported in high percentages in isolates from clinical samples, being associated with infections in humans, so we can assume that their presence in environmental isolates may represent a risk to public health. For example, Ghanem et al. [52] reported from different clinical specimens in Egypt the identification of toxA in 76.8%, aprA in 85.6%, lasB in 89.6%, algD in 80% and exoS in 84%. For their part, Vlada et al. [53] reported 100% of aprA and 96.7% of lasB for clinical samples from India. Although the presence of these virulence factors gives the strain the ability to develop an infection, its concomitant susceptibility to antibiotics will make it possible to determine whether such an infection can be easily treated or complicated to the point of death.

Resistant profiles of P. aeruginosa showed resistance or intermediate resistance to only 3 antibiotics of the 16 tested: ticarcillin (TIC, 32.8%), ticarcillin/clavulanic acid (TIM, 40.8%) and aztreonam (ATM, 2.4%), showing susceptibility to the rest of the antibiotics.

While strains with some level of resistance to the antibiotics ticarcillin and ticarcillin clavulanic acid were isolated from samples from all over the state of Tamaulipas, the strains that were resistant to aztreonam were only obtained from the south of the state (municipalities of Mante and Altamira with silt loam soil growing sorghum and onion), without being found in any other area.

A study for agricultural soil in Brazil tested a panel of antibiotics similar to the current study in Tamaulipas, Mexico [54]. Coincidentally, they also report P. aeruginosa strains resistant to ATM and TIM, but in a much higher percentage (ATM, 92.5% and TIM, 85%). Furthermore, the strains from Brazil showed a low percentage of resistance (≤10%) to MEM, TET and PBM, which the strains from Tamaulipas did not present.

Previous studies in other geographic areas showed differences with respect to resistance profile. For example, Pseudomonas spp. isolated from agricultural fields in Lithuania showed no resistance against TIM, but high resistance to ATM (86%), and displayed low resistance against other antibiotic families like carbapenemics [43]. In contrast, P. aeruginosa strains isolated from soil associated with an industrial area in Bangladesh showed 0% of resistance to ATM, CAZ and CIP, but greater resistance (40–100%) to GM, PC, MEM, AN and IPM.

Now, if the P. aeruginosa strains isolated from agricultural soil in Tamaulipas showed resistance to ATM and TIC, Gutierrez et al., [49] by contrast, did not report any resistance to these antibiotics in strains from irrigation water in Michoacan. However, while the strains in the current study only showed some level of resistance to 3 antibiotics, resistance to 11 antibiotics was observed in strains from irrigation water from Michoacan.

However, although the Tamaulipas strains only showed some level of resistance to 3 antibiotics, ATM and TIC are commonly used in clinical practice, especially in the treatment of patients with cystic fibrosis [54].

On the other hand, among the P. aeruginosa strains in the current study, no multi-antibiotic resistance (MDR) was detected. This agrees with the absence of the class 1 integron in the strains analyzed, since it has been established that integrons act as the main reason for multiple resistance in Gram-negative bacteria [55,56]. The absence of MDR strains and the high levels of susceptibility to most of the antibiotics tested may indicate that an infection caused by these strains could have effective treatments. This is a positive result, considering that the treatment of P. aeruginosa is often challenging because the organism has an intrinsic resistance to many antibiotics and can acquire resistance during therapy through various mechanisms [57].

As part of the results, a Pearson correlation analysis was performed between the antibiotics that showed some level of resistance (TIC, TIM and ATM) and the virulence factors. Only strong correlation (***) and moderate correlation (**) values were observed between the antibiotics ticarcillin-clavulanic acid (TIM), aztreonam (ATM) and some of the virulence factors. For ticarcillin (TIC), there was no significance value in relation to any of the virulence factors analyzed. Among the virulence factors, only exoS, plcH, aprA, lasB and rhlAB presented strong or moderate correlation values with TIM or ATM, while algD, plcN and toxA did not show significant values with any antibiotic.

The prevalence of antimicrobial-resistant strains depends on several factors. In recent years, the development of antibiotic resistance has been related with resistance to heavy metals, since they are encoded by genes that are physically linked to mobile genetic elements [58]. More importantly, heavy metals can induce selective pressure on microbial populations, leading to antimicrobial resistance through a mechanism called “co-selection” [59].

The P. aeruginosa strains isolated in the current study showed the presence of genes associated with heavy metal resistance, mainly to arsenic (arsB and arsC: 80–92.8%) and copper (copA and copB: 80–90%). As far as we reviewed, we did not find any studies in Mexico with which to compare the current results. However, the study carried out by Pitondo et al. [33] in Brazil also coincides with ours, identifying the highest frequency of genes associated with arsenic and copper. On the other hand, the gene czcA is related to resistance to cadmium, zinc and cobalt, which in Brazil registered a presence of 46%, and in the current study of Tamaulipas were only detected in 7.2% of the strains. For the gene mercA associated with resistance to mercury, in both studies it showed low prevalence (Brazil 2.3% and in Tamaulipas 14.4%).

A Pearson correlation analysis was performed between antibiotic resistance (TIC, ATM and TIM) and heavy metal genes (arsB, arsC, copA, copB, czcA, mercA). The results showed correlation values only between the antibiotic aztreonam and the genes associated with copper and arsenic. The antibiotics ticarcillin (TIC) and ticarcillin-clavulanic (TIM) did not show any positive correlation values with any of the heavy metal resistance genes. While the genes associated with copper and arsenic resistance showed positive correlation values, the genes czcA and mercA did not show any positive correlation values.

To our knowledge, these are the first published data for antibiotic and heavy metal resistance in Pseudomonas aeruginosa of environmental origin in Tamaulipas. To better understand the results obtained, monitoring will be carried out including the characteristics of the agricultural soil, the type of crop and the antibiotic concentration.

5. Conclusions

The results show that agricultural soil in Tamaulipas is a reservoir of Pseudomonas aeruginosa strains with a high prevalence of virulence factors, with the potential to cause infections. However, these strains analyzed showed high levels of resistance to only three antibiotics, indicating that potential infections could be effectively treated.

Author Contributions

Conceptualization, A.V.M.-V. and J.I.L.-H.; methodology, J.I.L.-H., Y.R.-G., M.M.-M., G.A.-A., S.F.-D., A.C.-R., R.R.-C.; formal analysis, A.G. and V.B.-G.; writing—original draft preparation, J.I.L.-H.; writing—review and editing, A.V.M.-V., A.G., M.M.-M., G.R. and V.B.-G. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This study was supported by the Instituto Politécnico Nacional. Project SIP20211218 and SIP20201297.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Jurado-Martín I., Sainz-Mejías M., McClean S. Pseudomonas aeruginosa: An Audacious Pathogen with an Adaptable Arsenal of Virulence Factors. Int. J. Mol. Sci. 2021;22:3128. doi: 10.3390/ijms22063128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Martínez-Solano L., Macia M.D., Fajardo A., Oliver A., Martinez J.L. Chronic Pseudomonas aeruginosa Infection in Chronic Obstructive Pulmonary Disease. Clin. Infect. Dis. 2008;47:1526–1533. doi: 10.1086/593186. [DOI] [PubMed] [Google Scholar]
  • 3.Botelho J., Grosso F., Peixe L. Antibiotic Resistance in Pseudomonas aeruginosa—Mechanisms, Epidemiology and Evolution. Drug Resist. Updat. 2019;44:100640. doi: 10.1016/j.drup.2019.07.002. [DOI] [PubMed] [Google Scholar]
  • 4.Hirsch E.B., Tam V.H. Impact of Multidrug-Resistant Pseudomonas aeruginosa Infection on Patient Outcomes. Expert Rev. Pharmacoecon. Outcomes Res. 2010;10:441–451. doi: 10.1586/erp.10.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ghorbani G., Rahimi E., Shakerian A. Antibiotic Resistance’s Genotypic and Phenotypic Characteristics and the Frequency of Virulence Factors in P. Aeruginosa Isolates Isolated from Water Samples in Iran. BioMed Res. Int. 2022;2022:7076433. doi: 10.1155/2022/7076433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bocharova Y., Savinova T., Lazareva A., Polikarpova S., Gordinskaya N., Mayanskiy N., Chebotar I. Genotypes, Carbapenemase Carriage, Integron Diversity and oprD Alterations among Carbapenem-Resistant Pseudomonas Aeruginosa from Russia. Int. J. Antimicrob. Agents. 2020;55:105899. doi: 10.1016/j.ijantimicag.2020.105899. [DOI] [PubMed] [Google Scholar]
  • 7.Sindeldecker D., Stoodley P. The Many Antibiotic Resistance and Tolerance Strategies of Pseudomonas Aeruginosa. Biofilm. 2021;3:100056. doi: 10.1016/j.bioflm.2021.100056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gómez-Martínez J., Rocha-Gracia R.D.C., Bello-López E., Cevallos M.A., Castañeda-Lucio M., Sáenz Y., Jiménez-Flores G., Cortés-Cortés G., López-García A., Lozano-Zarain P. Comparative Genomics of Pseudomonas Aeruginosa Strains Isolated from Different Ecological Niches. Antibiotics. 2023;12:866. doi: 10.3390/antibiotics12050866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tacconelli E., Carrara E., Savoldi A., Harbarth S., Mendelson M., Monnet D.L., Pulcini C., Kahlmeter G., Kluytmans J., Carmeli Y., et al. Discovery, Research, and Development of New Antibiotics: The WHO Priority List of Antibiotic-Resistant Bacteria and Tuberculosis. Lancet Infect. Dis. 2018;18:318–327. doi: 10.1016/S1473-3099(17)30753-3. [DOI] [PubMed] [Google Scholar]
  • 10.Moradali M.F., Ghods S., Rehm B.H.A. Pseudomonas Aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017;7:39. doi: 10.3389/fcimb.2017.00039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Maurice N.M., Bedi B., Sadikot R.T. Pseudomonas aeruginosa Biofilms: Host Response and Clinical Implications in Lung Infections. Am. J. Respir. Cell Mol. Biol. 2018;58:428–439. doi: 10.1165/rcmb.2017-0321TR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Francis V.I., Stevenson E.C., Porter S.L. Two-Component Systems Required for Virulence in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2017;364:fnx104. doi: 10.1093/femsle/fnx104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Riquelme S.A., Liimatta K., Wong Fok Lung T., Fields B., Ahn D., Chen D., Lozano C., Sáenz Y., Uhlemann A.-C., Kahl B.C., et al. Pseudomonas Aeruginosa Utilizes Host-Derived Itaconate to Redirect Its Metabolism to Promote Biofilm Formation. Cell Metab. 2020;31:1091–1106.e6. doi: 10.1016/j.cmet.2020.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Allel K., Day L., Hamilton A., Lin L., Furuya-Kanamori L., Moore C.E., Van Boeckel T., Laxminarayan R., Yakob L. Global Antimicrobial-Resistance Drivers: An Ecological Country-Level Study at the Human–Animal Interface. Lancet Planet. Health. 2023;7:e291–e303. doi: 10.1016/S2542-5196(23)00026-8. [DOI] [PubMed] [Google Scholar]
  • 15.Denissen J., Reyneke B., Waso-Reyneke M., Havenga B., Barnard T., Khan S., Khan W. Prevalence of ESKAPE Pathogens in the Environment: Antibiotic Resistance Status, Community-Acquired Infection and Risk to Human Health. Int. J. Hyg. Environ. Health. 2022;244:114006. doi: 10.1016/j.ijheh.2022.114006. [DOI] [PubMed] [Google Scholar]
  • 16.Lopez N.V., Farsar C.J., Harmon D.E., Ruiz C. Urban and Agricultural Soils in Southern California Are a Reservoir of Carbapenem-resistant Bacteria. MicrobiologyOpen. 2020;9:1247–1263. doi: 10.1002/mbo3.1034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Butiuc-Keul A., Carpa R., Podar D., Szekeres E., Muntean V., Iordache D., Farkas A. Antibiotic Resistance in Pseudomonas spp. Through the Urban Water Cycle. Curr. Microbiol. 2021;78:1227–1237. doi: 10.1007/s00284-021-02389-w. [DOI] [PubMed] [Google Scholar]
  • 18.Irfan M., Almotiri A., AlZeyadi Z.A. Antimicrobial Resistance and Its Drivers—A Review. Antibiotics. 2022;11:1362. doi: 10.3390/antibiotics11101362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Berendonk T.U., Manaia C.M., Merlin C., Fatta-Kassinos D., Cytryn E., Walsh F., Bürgmann H., Sørum H., Norström M., Pons M.-N., et al. Tackling Antibiotic Resistance: The Environmental Framework. Nat. Rev. Microbiol. 2015;13:310–317. doi: 10.1038/nrmicro3439. [DOI] [PubMed] [Google Scholar]
  • 20.Pal C., Asiani K., Arya S., Rensing C., Stekel D.J., Larsson D.G.J., Hobman J.L. Advances in Microbial Physiology. Volume 70. Elsevier; Amsterdam, The Netherlands: 2017. Metal Resistance and Its Association With Antibiotic Resistance; pp. 261–313. [DOI] [PubMed] [Google Scholar]
  • 21.Samanta I., Bandyopadhyay S. Antimicrobial Resistance in Agriculture. Elsevier; Amsterdam, The Netherlands: 2020. The Emergence of Antimicrobial-Resistant Bacteria in Livestock, Poultry and Agriculture; pp. 19–27. [Google Scholar]
  • 22.Park J.-H., Kim Y.-J., Binn-Kim, Seo K.-H. Spread of Multidrug-Resistant Escherichia coli Harboring Integron via Swine Farm Waste Water Treatment Plant. Ecotoxicol. Environ. Saf. 2018;149:36–42. doi: 10.1016/j.ecoenv.2017.10.071. [DOI] [PubMed] [Google Scholar]
  • 23.Zhang S., Abbas M., Rehman M.U., Huang Y., Zhou R., Gong S., Yang H., Chen S., Wang M., Cheng A. Dissemination of Antibiotic Resistance Genes (ARGs) via Integrons in Escherichia coli: A Risk to Human Health. Environ. Pollut. 2020;266:115260. doi: 10.1016/j.envpol.2020.115260. [DOI] [PubMed] [Google Scholar]
  • 24.Ghosh C., Sarkar P., Issa R., Haldar J. Alternatives to Conventional Antibiotics in the Era of Antimicrobial Resistance. Trends Microbiol. 2019;27:323–338. doi: 10.1016/j.tim.2018.12.010. [DOI] [PubMed] [Google Scholar]
  • 25.Nguyen L., Garcia J., Gruenberg K., MacDougall C. Multidrug-Resistant Pseudomonas Infections: Hard to Treat, But Hope on the Horizon? Curr. Infect. Dis. Rep. 2018;20:23. doi: 10.1007/s11908-018-0629-6. [DOI] [PubMed] [Google Scholar]
  • 26.Ruiz-Garbajosa P., Cantón R. Epidemiology of Antibiotic Resistance in Pseudomonas aeruginosa. Implications for Empiric and Definitive Therapy. Rev. Esp. Quimioter. 2017;30((Suppl. S1)):8–12. [PubMed] [Google Scholar]
  • 27.Hernando-Amado S., Coque T.M., Baquero F., Martínez J.L. Defining and Combating Antibiotic Resistance from One Health and Global Health Perspectives. Nat. Microbiol. 2019;4:1432–1442. doi: 10.1038/s41564-019-0503-9. [DOI] [PubMed] [Google Scholar]
  • 28.Laborda P., Sanz-García F., Hernando-Amado S., Martínez J.L. Pseudomonas Aeruginosa: An Antibiotic Resilient Pathogen with Environmental Origin. Curr. Opin. Microbiol. 2021;64:125–132. doi: 10.1016/j.mib.2021.09.010. [DOI] [PubMed] [Google Scholar]
  • 29.Güssow D., Clackson T. Direct Clone Characterization from Plaques and Colonies by the Polymerase Chain Reaction. Nucleic Acids Res. 1989;17:4000. doi: 10.1093/nar/17.10.4000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Talukder A., Rahman M.M., Chowdhury M.M.H., Mobashshera T.A., Islam N.N. Plasmid Profiling of Multiple Antibiotic-Resistant Pseudomonas aeruginosa Isolated from Soil of the Industrial Area in Chittagong, Bangladesh. Beni Suef Univ. J. Basic Appl. Sci. 2021;10:44. doi: 10.1186/s43088-021-00131-w. [DOI] [Google Scholar]
  • 31.Lauritsen J.G., Hansen M.L., Bech P.K., Jelsbak L., Gram L., Strube M.L. Identification and Differentiation of Pseudomonas Species in Field Samples Using an rpoD Amplicon Sequencing Methodology. mSystems. 2021;6:e00704-21. doi: 10.1128/msystems.00704-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lanotte P., Watt S., Mereghetti L., Dartiguelongue N., Rastegar-Lari A., Goudeau A., Quentin R. Genetic Features of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients Compared with Those of Isolates from Other Origins. J. Med. Microbiol. 2004;53:73–81. doi: 10.1099/jmm.0.05324-0. [DOI] [PubMed] [Google Scholar]
  • 33.Pitondo-Silva A., Gonçalves G.B., Stehling E.G. Heavy Metal Resistance and Virulence Profile in Pseudomonas aeruginosa Isolated from Brazilian Soils. Apmis. 2016;124:681–688. doi: 10.1111/apm.12553. [DOI] [PubMed] [Google Scholar]
  • 34.Zhu H., Bandara R., Conibear T.C.R., Thuruthyil S.J., Rice S.A., Kjelleberg S., Givskov M., Willcox M.D.P. Pseudomonas aeruginosa with LasI Quorum-Sensing Deficiency during Corneal Infection. Investig. Opthalmology Vis. Sci. 2004;45:1897. doi: 10.1167/iovs.03-0980. [DOI] [PubMed] [Google Scholar]
  • 35.Weinstein M.P. Performance Standards for Antimicrobial Susceptibility Testing: Supplement M100. 30th ed. Clinical and Laboratory Standards Institute; Wayne, PA, USA: 2020. [Google Scholar]
  • 36.Kargar M., Mohammadalipour Z., Doosti A., Lorzadeh S., Japoni-Nejad A. High Prevalence of Class 1 to 3 Integrons Among Multidrug-Resistant Diarrheagenic Escherichia coli in Southwest of Iran. Osong Public Health Res. Perspect. 2014;5:193–198. doi: 10.1016/j.phrp.2014.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bouskill N.J., Barnhart E.P., Galloway T.S., Handy R.D., Ford T.E. Quantification of Changing Pseudomonas aeruginosa sodA, htpX and Mt Gene Abundance in Response to Trace Metal Toxicity: A Potential in Situ Biomarker of Environmental Health: Microbial Molecular Biomarkers. FEMS Microbiol. Ecol. 2007;60:276–286. doi: 10.1111/j.1574-6941.2007.00296.x. [DOI] [PubMed] [Google Scholar]
  • 38.Deredjian A., Colinon C., Brothier E., Favre-Bonté S., Cournoyer B., Nazaret S. Antibiotic and Metal Resistance among Hospital and Outdoor Strains of Pseudomonas aeruginosa. Res. Microbiol. 2011;162:689–700. doi: 10.1016/j.resmic.2011.06.007. [DOI] [PubMed] [Google Scholar]
  • 39.Deredjian A., Colinon C., Hien E., Brothier E., Youenou B., Cournoyer B., Dequiedt S., Hartmann A., Jolivet C., Houot S., et al. Low Occurrence of Pseudomonas aeruginosa in Agricultural Soils with and without Organic Amendment. Front. Cell. Infect. Microbiol. 2014;4:53. doi: 10.3389/fcimb.2014.00053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Elshafiee E.A., Nader S.M., Dorgham S.M., Hamza D.A. Carbapenem-Resistant Pseudomonas aeruginosa Originating from Farm Animals and People in Egypt. J. Vet. Res. 2019;63:333–337. doi: 10.2478/jvetres-2019-0049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hosu M.C., Vasaikar S., Okuthe G.E., Apalata T. Molecular Detection of Antibiotic-Resistant Genes in Pseudomonas aeruginosa from Nonclinical Environment: Public Health Implications in Mthatha, Eastern Cape Province, South Africa. Int. J. Microbiol. 2021;2021:8861074. doi: 10.1155/2021/8861074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Juyal A., Otten W., Baveye P.C., Eickhorst T. Influence of Soil Structure on the Spread of Pseudomonas fluorescens in Soil at Microscale. Eur. J. Soil Sci. 2021;72:141–153. doi: 10.1111/ejss.12975. [DOI] [Google Scholar]
  • 43.Armalytė J., Skerniškytė J., Bakienė E., Krasauskas R., Šiugždinienė R., Kareivienė V., Kerzienė S., Klimienė I., Sužiedėlienė E., Ružauskas M. Microbial Diversity and Antimicrobial Resistance Profile in Microbiota From Soils of Conventional and Organic Farming Systems. Front. Microbiol. 2019;10:892. doi: 10.3389/fmicb.2019.00892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kumar S., Adhikary A., Saini R., Bhardwaj P. Pseudomonas: A Major Bacteria in Heavy Metal Contaminated Soil of South-West Punjab, India. Int. J. Plant Environ. 2019;5:26–32. doi: 10.18811/ijpen.v5i01.5. [DOI] [Google Scholar]
  • 45.Crone S., Vives-Flórez M., Kvich L., Saunders A.M., Malone M., Nicolaisen M.H., Martínez-García E., Rojas-Acosta C., Catalina Gomez-Puerto M., Calum H., et al. The Environmental Occurrence of Pseudomonas aeruginosa. Apmis. 2020;128:220–231. doi: 10.1111/apm.13010. [DOI] [PubMed] [Google Scholar]
  • 46.Bhasin S., Shukla N.A., Shrivastava S. Bacterial Diversity of River Kshipra with Relation to Human Health. Environ. Conserv. J. 2020;21:63–74. doi: 10.36953/ECJ.2020.211207. [DOI] [Google Scholar]
  • 47.Govender R., Amoah I.D., Adegoke A.A., Singh G., Kumari S., Swalaha F.M., Bux F., Stenström T.A. Identification, Antibiotic Resistance, and Virulence Profiling of Aeromonas and Pseudomonas Species from Wastewater and Surface Water. Environ. Monit. Assess. 2021;193:294. doi: 10.1007/s10661-021-09046-6. [DOI] [PubMed] [Google Scholar]
  • 48.Magalhães M.J.T.L., Pontes G., Serra P.T., Balieiro A., Castro D., Pieri F.A., Crainey J.L., Nogueira P.A., Orlandi P.P. Multidrug Resistant Pseudomonas Aeruginosa Survey in a Stream Receiving Effluents from Ineffective Wastewater Hospital Plants. BMC Microbiol. 2016;16:193. doi: 10.1186/s12866-016-0798-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gutiérrez Cárdenas O.G., Navarro Ibarra L.F., Loeza Lara P.D., Del Río Rodríguez O.G., Jiménez Mejía R. Perfiles de Resistencia a Antibióticos y Metales Pesados En Pseudomonas aeruginosa Potencialmente Patógenas Aisladas de Agua de Uso Agrícola. Nova Sci. 2017;9:97. doi: 10.21640/ns.v9i19.957. [DOI] [Google Scholar]
  • 50.Abdulateef S.A., Aal Owaif H.A., Department of Plant Biotechnology, College of Biotechnology, Al-Nahrain University, Baghdad, Iraq. Hussein M.H. Department of Molecular and Medical Biotechnology, College of Biotechnology, Al-Nahrain University, Baghdad, Iraq. Importance of Virulence Factors in Bacterial Pathogenicity: A Review. Int. J. Med. Sci. Clin. Res. Stud. 2023;3:765–769. doi: 10.47191/ijmscrs/v3-i4-35. [DOI] [Google Scholar]
  • 51.Kaszab E., Radó J., Kriszt B., Pászti J., Lesinszki V., Szabó A., Tóth G., Khaledi A., Szoboszlay S. Groundwater, Soil and Compost, as Possible Sources of Virulent and Antibiotic-Resistant Pseudomonas aeruginosa. Int. J. Environ. Health Res. 2021;31:848–860. doi: 10.1080/09603123.2019.1691719. [DOI] [PubMed] [Google Scholar]
  • 52.Ghanem S.M., Abd El-Baky R.M., Abourehab M.A., Fadl G.F., Gamil N.G. Prevalence of Quorum Sensing and Virulence Factor Genes Among Pseudomonas aeruginosa Isolated from Patients Suffering from Different Infections and Their Association with Antimicrobial Resistance. Infect. Drug Resist. 2023;16:2371–2385. doi: 10.2147/IDR.S403441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Vadla S., Girija Aseervatham Selvi S., Mantravadi H. Detection of Quorum Sensing Virulence Factor Genes and Its Consanguinity to Antibiotic Sensitivity Profile in the Clinical Isolates of Pseudomonas aeruginosa. Iran. J. Basic Med. Sci. 2023;26:899. doi: 10.22038/ijbms.2023.67981.14992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pitondo-Silva A., Martins V.V., Fernandes A.F.T., Stehling E.G. High Level of Resistance to Aztreonam and Ticarcillin in Pseudomonas aeruginosa Isolated from Soil of Different Crops in Brazil. Sci. Total Environ. 2014;473–474:155–158. doi: 10.1016/j.scitotenv.2013.12.021. [DOI] [PubMed] [Google Scholar]
  • 55.Partridge S.R., Tsafnat G., Coiera E., Iredell J.R. Gene Cassettes and Cassette Arrays in Mobile Resistance Integrons. FEMS Microbiol. Rev. 2009;33:757–784. doi: 10.1111/j.1574-6976.2009.00175.x. [DOI] [PubMed] [Google Scholar]
  • 56.Sabbagh P., Rajabnia M., Maali A., Ferdosi-Shahandashti E. Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial Pathogens. Iran. J. Basic Med. Sci. 2021;24:136. doi: 10.22038/ijbms.2020.48905.11208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Weiner L.M., Webb A.K., Limbago B., Dudeck M.A., Patel J., Kallen A.J., Edwards J.R., Sievert D.M. Antimicrobial-Resistant Pathogens Associated With Healthcare-Associated Infections: Summary of Data Reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2011–2014. Infect. Control Hosp. Epidemiol. 2016;37:1288–1301. doi: 10.1017/ice.2016.174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yu Z., Gunn L., Wall P., Fanning S. Antimicrobial Resistance and Its Association with Tolerance to Heavy Metals in Agriculture Production. Food Microbiol. 2017;64:23–32. doi: 10.1016/j.fm.2016.12.009. [DOI] [PubMed] [Google Scholar]
  • 59.Bazzi W., Abou Fayad A.G., Nasser A., Haraoui L.-P., Dewachi O., Abou-Sitta G., Nguyen V.-K., Abara A., Karah N., Landecker H., et al. Heavy Metal Toxicity in Armed Conflicts Potentiates AMR in A. Baumannii by Selecting for Antibiotic and Heavy Metal Co-Resistance Mechanisms. Front. Microbiol. 2020;11:68. doi: 10.3389/fmicb.2020.00068. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.


Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES