Pathogenicity of the LDLR c.97C>T (p.Gln33Ter) Mutation in Familial Hypercholesterolemia

ABSTRACT

Background

Familial hypercholesterolemia (FH) is a hereditary disease caused mainly by mutations in the gene encoding the low‐density lipoprotein receptor (LDLR). This study aimed to confirm the pathogenicity of the LDLR c.97C>T (p.Gln33Ter) mutation through in vitro functional validation and determine whether this nonsense mutation induces nonsense‐mediated mRNA decay (NMD).

Methods

The proband and his family were included in accordance with Chinese Expert Consensus on FH screening. The disease‐causing mutations were fund using whole‐exome sequencing and were confirmed using bidirectional Sanger sequencing. The pathogenicity of the mutation was predicted using in silico analysis. The LDLR c.97C>T (p.Gln33Ter) mutation was generated using site‐directed mutagenesis and expressed in HEK293T cells lacking endogenous LDLR expression. The effects of this alteration on LDLR expression and LDL uptake were assessed using flow cytometry, quantitative polymerase chain analysis, western blotting, and confocal laser scanning microscopy.

Results

The mutation that causes FH in this family was LDLR c.97C>T (p.Gln33Ter), and family members with this mutation exhibited elevated levels of low‐density lipoprotein cholesterol (LDL‐C). The cell experiment results showed that this mutation prevented the synthesis of LDLR protein and caused the cells to lose their LDL uptake ability.

Conclusion

LDLR c.97C>T (p.Gln33Ter) is a pathogenic FH mutation. However, this nonsense mutation did not induce NMD.

This study confirmed the pathogenicity of the LDLR c.97C>T mutation through in vitro functional validation, which blocked the synthesis of the LDLR protein, thereby preventing LDLR from removing LDL‐C from the plasma.

1. Introduction

Familial hypercholesterolemia (FH) is one of the most prevalent, heritable diseases that disrupts lipid metabolism. The main clinical manifestations of FH include noticeably high level of low‐density lipoprotein cholesterol (LDL‐C), excessive cholesterol deposition in tissues, and premature atherosclerotic cardiovascular disease (ASCVD) (Defesche et al. 2017). The prevalence of heterozygous FH ranges from one in 200 to one in 250 cases, whereas that of homozygous FH ranges from one in 160,000 to one in 320,000 cases (Joint Committee on the Chinese Guidelines for Lipid 2023). The pathogenesis of FH can be summarized as mutations in several genes that impact the liver's capacity to remove LDL‐C from circulation. Autosomal dominant mutations in low‐density lipoprotein receptor (LDLR, OMIM:606945), apolipoprotein B100 (APOB, OMIM:107730), and proprotein convertase subtilisin/kexin type 9 (PCSK9, OMIM:607786) genes account for most cases of FH. Of these, mutations in LDLR are responsible for more than 90% of FH cases (Brandts and Ray 2021).

LDLR is a cell surface protein with 836 amino acids, which belongs to the endocytic receptor family. The protein is synthesized in the endoplasmic reticulum (ER) and processed in the Golgi complex before being sent to the cell membrane (Luo, Yang, and Song 2020). A fully developed LDLR consists of five structurally and functionally distinct modules and plays a role in regulating endocytosis of LDL. A large number of mutations located on the LDLR gene have been reported, including large‐scale DNA copy number variations, nonsense mutations in the coding region, small insertions or deletions in or near the coding sequences, splicing mutations, and missense mutations (Iacocca et al. 2018). Different LDLR mutations can impact different phases of LDLR‐mediated LDL particle endocytosis, which can be classified into five categories: Class 1 mutants prevent the synthesis of proteins; Class 2 mutants cause partial or total retention in ER; Class 3 mutants impair apoB apolipoprotein interaction; Class 4 mutants cause impaired endocytosis; and Class 5 mutants prevent LDLR recycling to the membrane (Berberich and Hegele 2019).

Individuals with FH who have had increased LDL‐C concentrations since birth are at a greater risk of developing cardiovascular disease (Vallejo‐Vaz et al. 2021). In particular, those with homozygous FH frequently experience early onset coronary heart disease and, if not addressed, may pass away by the age of 20 (Nordestgaard et al. 2013). Therefore, it is necessary to identify pathogenic mutations in the FH family and investigate their pathogenic mechanisms in more detail.

Recently, a number of methods, such as computer prediction algorithms and experimental data from in vivo and in vitro studies, have been developed to clarify the impact of genetic mutations (Benito‐Vicente et al. 2018a). In this study, we used computer prediction algorithms and in vitro experiments to determine the pathogenicity of LDLR c.97C>T (Gln33Ter) which was identified using whole‐exome sequencing. Although this mutation has been reported previously with a ClinVar number of 3683, it is not clear whether the nonsense mutation results in protein truncation or nonsense‐mediated mRNA decay (NMD). This work created a cell model and used a number of molecular biology techniques to confirm the molecular mechanism of LDLR c.97C>T (Gln33Ter) in FH.

2. Materials and Methods

2.1. Inclusion of Study Population

According to the Chinese Expert Consensus on screening for FH (Atherosclerosis and Coronary Heart Disease Group of the Chinese Society of Cardiology of Chinese Medical and Editorial Board of Chinese Journal of Cardiology 2018), those who met any of the following criteria were included in this study: (1) early onset of ASCVD (male < 55 years old; female < 65 years old); (2) serum LDL‐C ≥ 3.8 mmol/L (146.7 mg/dL) in adults and ≥ 2.9 mmol/L (112.7 mg/dL) in children; (3) skin/tenoxanthoma or fatty corneal arch (< 45 years old); and (4) the three conditions above were also present in first‐degree relatives. All afflicted individuals underwent detailed physical examinations and their complete family histories were gathered.

After outlining the risks and advantages, approximately 5 mL of blood was collected from each patient for subsequent blood lipid analysis and whole‐exome sequencing. The local Ethics Committee approved the research protocol, and all participants signed informed consent forms.

2.2. Whole‐Exome Sequencing

Blood samples were transferred to BIG (Wuhan, China) for whole‐exome sequencing. High‐quality clean reads were obtained after deleting reads of low quality, joint contamination, and large concentrations of N bases. Next, the clean reads from each sample were matched to the human reference genome sequence (hg19) using the Burrows–Wheeler Aligner (Li and Durbin 2010). Finally, single‐nucleotide polymorphisms and insertion–deletions were identified and annotated using a genome analysis toolkit (DePristo et al. 2011; McKenna et al. 2010). All the mutations described in this study are with reference to the coding LDLR sequence represented by GenBank accession number NM_000527.4.

2.3. Sanger Sequencing

Genomic DNA was extracted from blood samples using the E.Z.N.P. Blood DNA Mini Kit (Omega Bio‐Tek, D3392‐02, USA) according to the product manual. The quality and purity of the eluted DNA was measured using a NanoDrop One (Thermo Scientific, USA). Polymerase chain reaction (PCR) was performed using a final volume of 50 μL of 25 μL 2× Es Taq MasterMix (Dye) (CWBIO, CW0690M, China) with 500 ng of gDNA and 2 μL of each primer (F‐5′‐CCTTTCTCCTTTTCCTCTCTCTCAG‐3′; R‐5′‐AAAATAAATGCATATCATGCCCAAA‐3′). For Sanger sequencing, the amplified products were sent to BIG (Wuhan, China). Sequencing results were analyzed using Chromas software.

2.4. In Silico Analysis

MutationTaster (https://www.mutationtaster.org/), a web‐based application, was used to evaluate the likelihood of sequence alterations causing diseases (Schwarz et al. 2010).

2.5. Construction of Plasmids

Plasmids were manufactured by NovoBio (Suzhou, China). The normal LDLR sequence was referred to by GenBank accession number NM_000527.4, and site‐directed mutagenesis was performed. The target gene segment and linearized vector were then cycled in vitro. Direct transformation of the recombinant products was performed, and monoclonal antibodies on the plate were chosen for PCR identification. Positive clones were sequenced, and the outcomes were examined. Expanded, grown, and retrieved high‐purity plasmids were constructed from the successfully cloned bacteria for further investigation.

2.6. Cell Culture and Transfection

Human embryonic kidney cells (HEK293) were cultivated in Dulbecco's modified Eagle's medium (Gibco, C11995500BT, China) containing 10% fetal bovine serum (pan, ST30‐3302, China). Subsequently, the cells were incubated 37°C with 5% CO₂. When the cells reached a density of approximately 80%, they were seeded in a six‐well plate and transiently transfected. Briefly, 2500 ng of the plasmid was incubated with Lipofectamine 2000 (Invitrogen, 11,668,027, USA) and added to the cells, in accordance with the manufacturer's instructions.

2.7. Quantitative Real‐Time Polymerase Chain Reaction

Total RNA was extracted from HEK293 cells using RNA‐Solv Reagent (Omega Bio‐Tek, R6830‐01, USA), and reverse transcription was carried out using a HiFiScript cDNA Synthesis Kit (CWBIO, CW2569M, China). FastStart Essential DNA Master Mix (Roche Diagnostics, 64,697,500, Germany) and Mastercycler Nexus X2 (Eppendorf, Germany) were used to conduct the PCR. The following primers were used: GAPDH F‐5′‐TCAAGAAGGTGGTGAAGCAG‐3′, R‐5′‐AAGGTGGAGGAGTGGGTGT‐3′, LDLR F‐5′‐CAGTGCCAAGACGGGAAATG‐3′, and R‐5′‐CCGGATTTGCAGGTGACAGA‐3′. The findings from the housekeeping gene were used to standardize the cycle threshold.

2.8. Western Blot Analysis

Forty‐eight hours after transfection, the cells were lysed with RIPA buffer (Solarbio, R0010, China) mixed with protease and phosphatase inhibitors at 4°C. The total protein concentration was determined using a BCA Protein Assay Kit (CWBIO, CW0014S, China). For western blotting, proteins were mixed with 5× loading buffer (Beyotime, P0015L) and boiled for 10 min. Following resolution on an 8% sodium dodecyl sulphate–polyacrylamide gel electrophoresis gel, the samples were blotted onto 0.45 μm polyvinylidene difluoride membranes (Merck, Germany). After blocking with 5% defatted milk powder for 1 h, the membranes were probed with the primary [monoclonal mouse anti‐LDLR (1:2000, Abcam, ab204941, USA)] and secondary [monoclonal rabbit anti β‐Actin (1:5000, Abclonal, AC026, China)] antibodies. Enhanced chemiluminescence (Pierce) was used for detection, and a ChemiDOCTM MP Imaging System (Bio‐Rad, China) was used for visualization.

2.9. Quantification of Cell Surface LDLR Using Flow Cytometry

Following transfection, HEK293 cells were gathered in 1.5 mL EP tubes and exposed to rabbit anti‐human LDLR monoclonal antibody conjugated with allophycocyanin (1:200, Abcam, ab275614, USA) for 1 h at room temperature. Fluorescence intensity was recorded using an FL3 filter (excitation: 645 nm, emission: 660 nm) on a Beckman CytoFlex S flow cytometer (Beckman Coulter, USA).

2.10. Assessment of LDLR Activity Using Confocal Laser Scanning Microscopy

After transfection for 24 h, the cells growing on coverslips were starved for 24 h in a medium containing 0.3% fetal bovine serum. Following this, 20 μg/mL Dil‐LDL (YEASEN, 20614ES76, China) diluted with Dulbecco's modified Eagle's medium was added. The cells were incubated for 4 h at 37°C. Finally, the cells were labeled with DAPI, fixed with 4% paraformaldehyde, and observed using a confocal microscope (LEICA, LEICA TCS SP8, Germany).

2.11. Statistical Analysis

All statistical analyses were conducted using SPSS software (version 24.0; SPSS Inc., Chicago, IL, USA), and all experimental data were plotted with the aid of GraphPad Prism 9 (GraphPad Software LLC). Statistical significance was set at p < 0.05.

3. Results

3.1. Clinical Characteristics of the Proband and His Family

The proband, a 38‐year‐old male, was included in the FH screening because of early onset of atherosclerosis. Due to persistent chest pressure, the patient was admitted to the First Affiliated Hospital of Ningbo University. Electrocardiography revealed ischemic abnormalities. Coronary angiography revealed 90% narrowing of the anterior descending artery and 45%–50% narrowing of the right coronary artery. The clinical and biochemical characteristics of the proband and his family are displayed in Table 1, and their DLCN scores are presented in Table 2. The diagnosis of FH was confirmed if each individual scored at least eight. Pedigree analysis of the index case revealed a family history of dyslipidemia, which is consistent with an autosomal dominant mode of inheritance (Figure 1).

TABLE 1.

The FH family's clinical and biochemical characteristics.

Characteristics	I.1	I.2	II.1	II.2	II.3	II.4	III.1	III.2
Age	68	68	43	38	36	36	14	10
Gender	Male	Female	Male	Female	Male	Female	Female	Male
TG (mmol/L)	/	0.64	0.76	2.28	0.8	0.53	0.62	0.47
Reference range	0.00–1.70 (mmol/L)
TC (mmol/L)	/	8.84	8.72	6.25	6.29	3.9	7.18	5.25
Reference range	3.00–5.70 (mmol/L)
LDL‐C (mmol/L)	/	7.86	7.51	3.52	4.72	2.3	4.62	3.52
Reference range	1.89–3.37 (mmol/L)
HDL‐C (mmol/L)	/	1.01	1.1	1.95	0.82	1.54	2.14	1.45
Reference range	1.03–1.55 (mmol/L)
Corneal arch	No	No	No	No	No	No	No	No
Xanthoma	No	No	No	No	No	No	No	No
History of atherosclerosis myocardial infarctions	No	Yes	Yes	No	Yes	No	No	No

Note: / means unknown.

TABLE 2.

Diagnostic criteria of the Dutch Lipid Clinic Network.

Diagnostic criteria of the Dutch Lipid Clinic Network	Score	Participants scores
		I.1	I.2	II.1	II.2	II.3	II.4	III.1	III.2
Family history
First‐degree relative with known premature (< 55 years of age in men, < 60 years of age in women) coronary heart disease or first‐degree relative with known low‐density lipoprotein (LDL) cholesterol > 95th percentile by age and sex for country	1	0	1	1	1	2	2	2	2
First‐degree relative with tendon xanthoma and/or arcus cornealis or children < 18 years of age with LDL cholesterol > 95th percentile by age and sex for country	2
Clinical history
Patient with premature coronary artery disease (age as above)	2	0	2	2	2	2	0	0	0
Patient with premature cerebral or peripheral vascular disease (age as above)	1
Physical examination
Tendon xanthomas	6	0	0	0	0	0	0	0	0
Arcus cornelis at age ≤ 45 years	4
LDL Cholesterol (mmol/L) (mg/dL)
LDL‐C ≥ 8.5 (330)	8	0	5	5	0	1	0	1	0
LDL‐C 6.5–8.4 (250–329)	5
LDL‐C 5.0–6.4 (190–249)	3
LDL‐C 4.0–4.9 (155–189)	1
DNA analysis
DNA Analysis—functional mutation LDLR, APOB, and PCSK9	8	/	/	/	/	8	/	8	8
Total score		0	8	8	3	11	2	11	11

Note: / means unknown, only the highest applicable score can be chosen for each category, the diagnosis of familial hypercholesterolemia is certain if the individual scores ≥ 8 point.

FIGURE 1.

The family trees. Arrow indicates the index case who was first seen in our clinic. Dark color circles or boxes in the pedigree indicates subjects with FH.

3.2. Genetic Analysis and In Silico Analyses

Blood samples were taken from the proband, his wife, and their children because the rest of the family did not live in the area. Because LDLR, APOB, PCSK9, ARH, APOE, ABCG5, ABCG8, and LIPA are known to be involved in FH, whole‐exome sequencing data were examined for pathogenic mutations in these genes. Out of all the FH candidate genes that were tested, only one unusual pathogenic LDLR mutation was found in this family, namely c.97C>T(p.Gln33Ter) (Figure 2A,B), which is located at exon 2 of the LDLR gene on chromosome 19 p13.2. The outcomes of the T@ster mutation prediction demonstrated that the LDLR c.97C>T (p.Gln33Ter) mutation was pathogenic.

FIGURE 2.

Pathogenic variants. (A) Visualization of gene mutations using IGV software. (B) The result of sanger sequencing.

3.3. LDLR c.97C>T (p.Gln33Ter) Mutation Prevented the Synthesis of LDLR Protein

LDLR expression was investigated in HEK293 cells transfected with the wild‐type, c.97C>T mutant, or empty plasmid. The three groups were named WT, mutant, and NC, respectively. They were all approximately equally effective for transfection (Figure 3A). LDLR protein expression was measured using western blotting; there was almost no expression of the LDLR protein in cells transfected with the mutant or NC plasmids, when compared with those transfected with the WT plasmid (Figure 3B). Flow cytometry was used to detect LDLR protein on the cell surface. Compared to the WT, the mutant and NC groups lacked LDLR on the cell surface (Figure 3C). These results suggest that this mutation prevents LDLR protein expression.

FIGURE 3.

Expression of LDLR at protein level. (A) transfection efficiency. (B) The amount of immunoprecipitated LDLR in each sample. (C) The expression of the LDLR protein on the cell surface.

3.4. LDLR c.97C>T (p.Gln33Ter) Mutation Affects LDL Uptake

Confocal laser scanning microscopy was used to further validate the functionality of LDLR mutant activity. The cells in the mutant and NC groups were almost completely incapable of absorbing LDL compared to those in the WT group (Figure 4). This indicates that this mutation prevents LDLR from exercising its ability to absorb LDL.

FIGURE 4.

LDLR's ability to ingest LDL. The blue fluorescence marks the nucleus; the red fluorescence marks the LDL; the merge shows the amount of LDL uptake by the cell.

3.5. LDLR c.97C>T (p.Gln33Ter) Nonsense Mutation Did Not Induce NMD

The nonsense mutation led to the premature termination of the LDLR protein (UniProtKB‐P01130) at the 32nd amino acid due to an early stop‐gain signal. It is anticipated that this mutation would produce an early‐truncated protein that most likely experiences NMD. However, according to the quantitative real‐time polymerase chain reaction results, there was no difference between the mutant and WT groups at the mRNA level, and there was no transcription of LDLR mRNA in the NC group (Figure 5). This indicates that mRNA with AUG‐proximal nonsense mutations is resistant to nonsense‐mediated decay.

FIGURE 5.

Expression of LDLR at mRNA level. The data represent means ±SEM. ****p < 0.0001 versus WT. ns indicates p > 0.05.

4. Discussion

According to the World Health Organization, FH is a common genetic disease that fits all requirements for a condition that warrants screening. Numerous studies have shown that individuals with FH have an increased risk of developing cardiovascular diseases (Pérez de Isla et al. 2016; Benn et al. 2012; Ference et al. 2017). Genetic testing has the potential to improve diagnosis and provide prognostic data and accurate risk assessments, as found by an international panel of experts upon evaluation of its efficacy (Sturm et al. 2018). Therefore, it is necessary to conduct cascade screening to identify pathogenic genes and study their molecular mechanisms of action.

According to previous studies on the mechanism of FH caused by LDLR gene mutations, The p. Cys155Tyr is appropriately produced in cellular membranes but exhibits poor ligand‐binding activity (Etxebarria et al. 2015); the p. Asp482His, p. Cys667Phe, p. Glu207Lys, and Cys646Tyr mutations are retained in the ER because of protein misfolding and can be degraded by the proteasome pathway (Li et al. 2004; Kizhakkedath et al. 2019). In the current study, LDLR c.97C>T (p.Gln33Ter) was considered to be a pathogenic mutation present in the family. It is a nonsense variant which has been confirmed to results in loss of protein function (Bertolini et al. 1999; Zakharova et al. 2005). The development of in vitro functional experiments further confirmed that this mutation inhibited the expression of the LDLR protein, resulting in a complete loss of LDL uptake ability. The severely impaired receptor function may explain why the proband exhibited severe coronary artery stenosis at the age of 35. As high cholesterol levels do not directly manifest as symptoms, it is easy to ignore them before they develop into atherosclerotic heart disease (Benito‐Vicente et al. 2018b). The implementation of genetic testing is beneficial for early detection of other FH patients in the family, timely initiation of lipid‐lowering treatment, and maximum avoidance of malignant outcomes (Cohen et al. 2021).

The LDLR c.97C>T nonsense mutation identified in this study is a Class 1 mutation that introduces a protein termination codon (PTC) at the 33rd codon upstream and truncates the LDLR protein at the Gln33rd residue in the ligand‐binding domain. The truncated protein is 807 amino acids shorter than the native LDLR and lacked 260 amino acid residues from the ligand‐binding, EGF‐like, O‐linked sugar, transmembrane, and cytoplasmic domains. It is understood that the mRNAs with PTCs may potentially activate NMD (Holla et al. 2009). NMD is a quality control pathway that is widely present in eukaryotic cells and plays an important role in the post‐transcriptional regulation of genes (Lykke‐Andersen 2015). However, not all mRNAs with PTCs are degraded via the NMD pathway (Supek, Lehner, and Lindeboom 2021). To investigate this possibility, the expression of LDLR mRNA in 293 T cells transfected with plasmids was quantified using real‐time PCR. The results showed that mRNA expression was not affected, supporting the start–proximal rule of NMD evasion (Pereira et al. 2015). Therefore, we suspect that shortened versions of the LDLR protein may have been synthesized. As a result, different truncation effects on the biochemical properties of a protein may result in various phenotypes, such as varying disease severity. For instance, shortened versions of the globin protein can be harmful in thalassemia; however, mRNA degradation via NMD ameliorates this condition. In contrast, there are genetic disorders in which truncated peptides retain their function, such as Duchenne muscular dystrophy, and NMD worsens the disease phenotype (Lykke‐Andersen 2015). According to the experimental findings of LDLR activity assessment, the shortened protein was unable to absorb LDL. However, whether it interacts with other proteins to affect the FH phenotype has not yet been verified. Future research should examine how NMD affects the FH phenotype.

Our study had two limitations. First, we did not perform ex vivo functional validation to determine the pathogenicity of the LDLR mutations. Secondly, we focused on gene exon sequences.

In conclusion, this study reports a pathogenic LDLR nonsense mutation, namely c.97C>T. This nonsense mutation blocks the synthesis of the LDLR protein, thereby preventing LDLR from removing LDL‐C from the plasma, which causes an abnormal increase in plasma cholesterol levels. However, this transcript, which contains premature termination codons, did not induce NMD.

Author Contributions

Conceptualization: Kaihan Wang. Methodology, Kaihan Wang and Tingting Hu. Software: Kaihan Wang and Yan Shen. Validation: Kaihan Wang. Formal analysis: Kaihan Wang. Investigation: Kaihan Wang. Resources: Shaoyi Lin and Yan Shen. Data curation: Kaihan Wang and Mengmeng Tai. Writing – original draft preparation: Kaihan Wang. Writing – review and editing: Tingting Hu and Mengmeng Tai. Visualization: Kaihan Wang and Mengmeng Tai. Supervision: Yongjuan Guo and Xiaomin Chen. Project administration: Xiaomin Chen and Shaoyi Lin. Funding acquisition: Xiaomin Chen and Yongjuan Guo. All authors have read and agreed to the published version of the manuscript.

Ethics Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the First Affiliated Hospital of Ningbo University (2019‐R020).

Consent

Informed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patient(s) to publish this paper.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.