Skip to main content
NCBI home page
Springer logoLink to Springer
. 2024 Nov 27;409(1):362. doi: 10.1007/s00423-024-03527-1

Montelukast inhibits abdominal aortic aneurysm formation in mice via activating the AMPK/mTOR signalling pathway

Jian Huang 1, Jiawei Zhuang 1, Jiamao Wang 1, Zhonggui Shan 1,✉
PMCID: PMC11602865  PMID: 39601880

Abstract

Objective

To investigate the mechanism by which Montelukast inhibits abdominal aortic aneurysm (AAA) formation through the AMPK/mTOR signaling pathway in mice.

Methods

Mice were randomly assigned to the Normal group, Model group, Montelukast group, and Montelukast + compound C (C.C) group. The Model, Montelukast, and Montelukast + C.C groups were induced with AAA by continuous infusion of 1000 ng/kg/min of Ang II. The Montelukast group received daily oral administration of 10 mg/kg Montelukast, while the Montelukast + C.C group received 10 mg/kg Montelukast and 10 mg/kg C.C orally for 28 days. Abdominal aortas were isolated, and their diameters and AAA occurrence were measured using a micrometer. Histological analysis was performed using Hematoxylin-Eosin (HE) staining to assess the morphological changes. TUNEL staining was conducted to measure cell apoptosis levels in the abdominal aortas. Western Blot was employed to evaluate protein expressions of Bax, Bcl-2, MMP-2, MMP-9, α1-AT, p-AMPK, AMPK, p-mTOR, mTOR in the abdominal aortic tissues. qRT-PCR was used to assess the expression of IL-6, TNF-α, IFN-γ in the mouse abdominal aortas.

Results

Compared to the Normal group, the Model group showed significantly increased abdominal aortic diameter, AAA occurrence, TUNEL positivity, Bax/Bcl-2 ratio, IL-6, TNF-α, IFN-γ, MMP-2, MMP-9, p-mTOR/mTOR, and decreased α1-AT, p-AMPK/AMPK (P < 0.05). The Montelukast group exhibited significant decreases in abdominal aortic diameter, AAA occurrence, TUNEL positivity, Bax/Bcl-2 ratio, IL-6, TNF-α, IFN-γ, MMP-2, MMP-9, p-mTOR/mTOR, and increases in α1-AT, p-AMPK/AMPK compared to the Model group (P < 0.05). The Montelukast + C.C group showed opposite trends compared to the Montelukast group (P < 0.05). The Normal group exhibited intact abdominal aortic wall structure with orderly arranged cells. The Model group showed thickened aortic walls, plaque formation, and inflammatory cell infiltration. The Montelukast group demonstrated reduced aortic wall thickening, approaching a morphology closer to the Normal group. The Montelukast + C.C group exhibited a morphology between the Model and Montelukast groups.

Conclusion

Montelukast can inhibit AAA formation in mice, possibly through the downregulation of cell apoptosis, inflammatory response, and matrix metalloproteinase levels via the AMPK/mTOR signaling pathway.

Keywords: Montelukast, AMPK/mTOR, Abdominal aortic aneurysm, Apoptosis, Inflammation, Matrix metalloproteinases

Introduction

Abdominal aortic aneurysm (AAA) is a degenerative disease characterized by a localized dilation of the abdominal aorta and primarily affects individuals over 60 years old, with its incidence progressively falling [1]. Common symptoms include pain, rupture, abdominal bleeding, and severe cases may pose life-threatening risks [2, 3]. The commonly employed treatments for AAA are open surgical repair or endovascular repair to prevent aortic rupture. However, these treatments have limited efficacy and are not suitable for patients with small AAAs or those at high risk. Therefore, there is an urgent need to explore non-surgical treatments such as appropriate medications. Montelukast is a selective leukotriene receptor antagonist used for treating inflammatory diseases such as asthma, allergic rhinitis, and atherosclerosis [4, 5]. Studies have found Montelukast to effectively treat AAA [6, 7], yet there is a lack of research into the mechanism of Montelukast’s action in treating AAA. The AMP-activated protein kinase (AMPK)/mechanistic target of rapamycin (mTOR) signaling pathway plays a crucial role in regulating cellular metabolism and growth and serves as a significant target for treating many diseases. Activation of the AMPK/mTOR signaling pathway can inhibit AAA formation and is involved in the inhibitory effect of metformin on AAA [8]. Therefore, this study aims to evaluate the effects of Montelukast on mice with AAA induced by angiotensin II (Ang II) and investigate the role of the AMPK/mTOR signaling pathway in this context.

Araújo AC, Tang X, Haeggström JZ. Targeting cysteinyl-leukotrienes in abdominal aortic aneurysm. Prostaglandins Other Lipid Mediat. 2018 Nov;139:24–28. doi: 10.1016/j.prostaglandins.2018.09.007. Epub 2018 Sep 21. PMID: 30,248,405.

Materials and methods

Animals, reagents, and instruments

  1. Male SPF-grade C57BL/6J mice aged 8–10 weeks were obtained from Fujian Haiwang Fuyao Pharmaceutical Co., Ltd. (production license number SCXK (Min) 2020-0001) and were housed in a barrier-level animal room under controlled conditions (25 °C, 40–70% relative humidity, and a 12-hour light-dark cycle). All animal experiments were approved by the institutional ethics committee. Angiotensin II (purity ≥ 98%), Hematoxylin-Eosin (HE) staining kit, TUNEL staining solution, and DAPI staining solution were sourced from Beijing Soleibao Biotechnology Co., Ltd. Montelukast was purchased from Lunan Betta Pharmaceutical Co., Ltd., and the AMPK inhibitor compound C (C.C) was obtained from Sigma Corporation, USA. Antibodies for B-cell lymphoma-2-associated X protein (Bax, Clone No. ab32503), B-cell lymphoma-2 (Bcl-2, Clone No. ab196495), Matrix Metalloproteinase-2 (MMP-2, Clone No. ab37150), Matrix Metalloproteinase-9 (MMP-9, Clone No. ab38898), α-1 antitrypsin (α1-AT, Clone No. ab115073), p-AMPK (Clone No. ab133448), AMPK (Clone No. ab32047), p-mTOR (Clone No. ab109268), and mTOR (Clone No. ab2732) were procured from Abcam, USA. The RNA reverse transcription kit used was the Invitrogen SuperScript IV Reverse Transcriptase, while the SYBR Green qPCR kit was obtained from Dalian Takara (SYBR Green Premix Ex Taq II). A fluorescence microscope (model XSP-GX63) was purchased from Shanghai Optical Instrument Factory.

Methods

Animal grouping and treatment

After a one-week adaptation period of feeding, mice were randomly divided into four groups: Normal group, Model group, Montelukast group, and Montelukast + C.C group, each comprising 10 mice. The Model, Montelukast, and Montelukast + C.C groups were used to establish the AAA model [9]: Mice were anesthetized intraperitoneally with 1% pentobarbital sodium. The abdominal skin was incised, and an Ang II osmotic pump was subcutaneously implanted, infusing Ang II at a rate of 1000 ng/kg/min for 28 days, followed by skin closure. The Normal group underwent a laparotomy with skin closure without osmotic pump implantation. The Montelukast group received a daily intragastric administration of 2 ml of 10 mg/kg Montelukast, while the Montelukast + C.C group received 2 ml of 10 mg/kg Montelukast and 10 mg/kg compound C daily via intragastric administration. The Normal and Model groups were given an equal volume of normal saline via intragastric gavage. After 28 days of continuous treatment, mice from each group were euthanized under anesthesia. Mice were immobilized on the operating table, and the abdominal aorta from the renal artery to the iliac artery was dissected, separating the entire aorta from its root. The aortic aneurysm was defined as an aortic diameter equal to or greater than 1.5 times the mean diameter of the normal aorta. A vernier caliper was used to measure the maximum outer diameter of the abdominal aorta. The dissected tissues were fixed with paraformaldehyde for preservation.

HE staining for pathological morphology of mouse abdominal aortic tissue

To assess the pathological morphology of mouse abdominal aortic tissue, the tissue was embedded in paraffin and sectioned into 3 μm thick slices using a microtome. The sections were then deparaffinized by placing them in xylene for 10–15 min to remove the paraffin, followed by rehydration through a series of graded ethanol solutions (100%, 95%, 70%, and 50%) for 5 min each. After rinsing in distilled water, the sections were stained with hematoxylin for 5–10 min, depending on the desired intensity, and thoroughly rinsed in running tap water for 5–10 min to eliminate excess stain. Differentiation of the hematoxylin stain was achieved by immersing the sections in 1% acid alcohol for a few seconds, followed by another rinse in running tap water. The sections were then counterstained with eosin for 2–5 min to provide contrast and rinsed in distilled water to remove any excess eosin. Subsequent dehydration was carried out through a graded series of ethanol (50%, 70%, 95%, and 100%) for 5 min each, followed by clearing the sections in xylene for 10–15 min. Finally, the sections were mounted with a suitable mounting medium, covered with a coverslip, and allowed to dry completely before microscopic examination.

TUNEL staining to assess apoptosis levels in mouse abdominal aorta

To assess apoptosis levels in mouse abdominal aortic tissue, the tissue was embedded in paraffin and sectioned continuously at 3 μm. The sections were deparaffinized by placing them in xylene for 10–15 min, followed by rehydration through graded ethanol solutions (100%, 95%, 70%, and 50%) for 5 min each, and rinsing in PBS. Antigen retrieval was performed by incubating the sections in citrate buffer (pH 6.0) and heating in a microwave or pressure cooker for 10–20 min, after which the sections were cooled and rinsed in PBS. To reduce non-specific binding, the sections were incubated in a blocking buffer containing BSA or serum for 30 min at room temperature. The TUNEL reaction mixture, containing terminal deoxynucleotidyl transferase (TdT) and a nucleotide mix (including biotinylated dUTP or fluorescein-dUTP), was applied to the sections, which were then incubated in a humidified chamber at 37 °C for 1 h. The reaction was stopped by rinsing the sections in PBS for 5–10 min. For detection, sections using biotinylated dUTP were incubated with a streptavidin-conjugated fluorophore or enzyme, while those with fluorescein-dUTP were prepared for microscopy. Counterstaining with DAPI was performed for 5 min to visualize the nuclei, followed by rinsing with PBS to remove excess DAPI. Finally, the sections were mounted with a suitable mounting medium, covered with a coverslip, and examined under a fluorescence or light microscope, where apoptotic cells appeared as green or brown spots depending on the detection method.

Western blot analysis of protein expression levels in mouse abdominal aortic tissue

For the analysis of protein expression levels of Bax, Bcl-2, MMP-2, MMP-9, α1-AT, p-AMPK, AMPK, p-mTOR, and mTOR in mouse abdominal aortic tissue, the tissue was first ground in liquid nitrogen, and total protein was extracted using RIPA lysis buffer. The concentration of the extracted protein was determined via the BCA assay. Proteins were then separated by SDS-PAGE and transferred onto a PVDF membrane, which was blocked with 5% skim milk and incubated overnight at 4 °C with primary antibodies diluted to 1:1000. Following this, secondary antibodies conjugated with horseradish peroxidase, diluted to 1:5000, were applied for 1 h at 37 °C. Detection was performed using ECL, and the membrane was exposed in a darkroom. GAPDH served as the internal control, and protein band grayscale values were quantified using Quantity One software to calculate protein expression levels. A total of 30 µg of protein was loaded per lane, and the ECL solution used was SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Scientific), with detection conducted using the Bio-Rad ChemiDoc MP Imaging System.

qRT-PCR for determining expression of IL-6, TNF-α, IFN-γ in mouse abdominal aortic tissue

Abdominal aortic tissue was extracted using Trizol reagent to obtain total RNA, which was reverse transcribed into cDNA. Amplification was performed using the SYBR-Green PCR kit according to the manufacturer’s instructions on a fluorescence quantitative PCR instrument.

mRNA was transcribed into cDNA using Trizol reagent for extraction, followed by a reverse transcription kit that included reverse transcriptase, reaction buffer, dNTPs, and primers. The procedure involved mixing the RNA sample with the reverse transcription reagents and incubating at 42 °C for 30–60 min to synthesize cDNA, followed by heating at 70 °C for 5–10 min to inactivate the reverse transcriptase. For quantitative PCR (qPCR), a SYBR Green qPCR kit was used, combining cDNA, SYBR Green mix, and specific primers in the reaction mixture. The amplification protocol included an initial denaturation at 95 °C for 2–5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 55–60 °C for 30 s, and extension at 72 °C for 30 s, concluding with a final extension at 72 °C for 5 min. Data were collected using a fluorescence quantitative PCR instrument, and the expression levels of IL-6, TNF-α, and IFN-γ mRNA were quantified using the ΔΔCt method, with GAPDH serving as the internal reference. Primer sequences are listed in Table 1.

Table 1.

Primer sequence

Primer name Forward primer (5’-3’) Reverse primer (5’-3’)
IL-6 AGGAGTGGCTAAGGACCAAGACC TGCCGAGTAGACCTCATAGTGACC
TNF-α CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
IFN-γ TATAGGTGGGTATAATGGGTTT ATCAAAACAATATACTACACCТCCT
GAPDH ACACCCACTCCTCCACCTTT TTACTCCTTGGAGGCCATGT
Open in a new tab

Statistical analysis

Statistical analysis was performed using GraphPad Prism software (version 9.0). The results were expressed as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) was used to compare differences among groups, followed by Tukey’s post hoc test for multiple comparisons. A p-value of less than 0.05 was considered statistically significant.

Results

Measurement of abdominal aortic diameter and AAA incidence in mice

During the Ang II infusion protocol designed to induce AAA, a total of 40 mice were subjected to the treatment. Of these, 10% (4 mice) did not survive beyond the first 2–3 days. The primary cause of mortality was identified as aortic rupture, which is a common complication associated with the rapid increase in aortic pressure induced by the high dose of Ang II (1000 ng/kg/min). The surviving mice were closely monitored for any signs of distress, such as lethargy, abnormal grooming, or changes in feeding behavior. Daily observations were recorded, and any mouse exhibiting severe symptoms was evaluated for euthanasia to prevent unnecessary suffering. At the end of the 28-day treatment period, the surviving mice were euthanized, and careful dissection of the abdominal aorta was performed. Measurements of aortic diameter were taken, and histopathological analyses were conducted to assess the extent of aneurysm formation and any associated tissue damage.

Compared to the Normal group, the Model group exhibited significantly increased abdominal aortic diameter and AAA incidence (P < 0.05). In contrast, the Montelukast group showed significantly decreased abdominal aortic diameter and AAA incidence compared to the Model group (P < 0.05). However, when compared to the Montelukast group, the Montelukast + compound C group displayed a significant increase in abdominal aortic diameter and AAA incidence (P > 0.05). Refer to Fig. 1.

Fig. 1.

Fig. 1

Open in a new tab

Measurement of Abdominal Aortic Diameter and AAA Incidence in Mice. A: Abdominal aortic diameter in different groups of mice; B: Incidence of AAA in different groups of mice. The data are presented as mean ± standard deviation (SD). One-way ANOVA followed by Tukey’s post hoc test was performed. AAA incidence was analyzed using the Chi-square test. *P < 0.05 compared to the Normal group; #P < 0.05 compared to the Model group; &P < 0.05 compared to the Montelukast group. Group sizes: Normal (n = 10), Model (n = 8), Montelukast (n = 9), Montelukast + C.C (n = 9)

Histopathological changes in abdominal aortic tissue of mice

HE staining revealed that the Normal group exhibited an intact structure of the abdominal aortic wall with orderly arranged cells. In contrast, the Model group displayed increased thickness in the abdominal aortic wall, plaque formation in the intima, and inflammatory cell infiltration. The Montelukast group showed a reduced thickening of the abdominal aortic wall, with morphology approaching that of the Normal group. The Montelukast + compound C group’s abdominal aortic wall morphology was between that of the Model and Montelukast groups. See Fig. 2.

Fig. 2.

Fig. 2

Open in a new tab

HE staining illustrating histopathological changes in abdominal aortic tissue of mice (×400 magnification). Representative histological micrographs of abdominal aortic tissue from the following groups: Normal (n = 10), Model (n = 8), Montelukast (n = 9), and Montelukast + C.C (n = 9)

Apoptosis levels in abdominal aortic cells of mice

Compared to the Normal group, the Model group exhibited significantly increased TUNEL positivity and Bax/Bcl-2 ratio (P < 0.05). Conversely, the Montelukast group showed significantly reduced TUNEL positivity and Bax/Bcl-2 ratio compared to the Model group (P < 0.05). However, when compared to the Montelukast group, the Montelukast + compound C group displayed a significant increase in TUNEL positivity and Bax/Bcl-2 ratio (P > 0.05). Refer to Fig. 3.

Fig. 3.

Fig. 3

Open in a new tab

Apoptosis Levels in Abdominal Aortic Cells of Mice. A: TUNEL staining showing TUNEL-positive cells in the abdominal aorta of different groups of mice (×400 magnification); B: Quantitative analysis of TUNEL-positive cells based on the TUNEL staining images in (A); C: Western blot analysis showing the expression levels of Bax and Bcl-2 proteins in the abdominal aorta of different groups of mice; D: Quantification of the Bax/Bcl-2 ratio based on the Western blot results in (C) using densitometric analysis. The data are presented as mean ± SD (standard deviation) from three independent experiments. One-way ANOVA followed by Tukey’s post hoc test was used for statistical analysis. *P < 0.05 compared to the Normal group; #P < 0.05 compared to the Model group; &P < 0.05 compared to the Montelukast group. Sample sizes: Normal (n = 10), Model (n = 8), Montelukast (n = 9), Montelukast + C.C (n = 9)

mRNA expression levels of IL-6, TNF-α, IFN-γ in abdominal aortic tissue of mice

Compared to the Normal group, the Model group exhibited significantly increased mRNA expression levels of IL-6, TNF-α, and IFN-γ (P < 0.05). In contrast, the Montelukast group showed significantly decreased mRNA expression levels of IL-6, TNF-α, and IFN-γ compared to the Model group (P < 0.05). However, when compared to the Montelukast group, the Montelukast + compound C group displayed a significant increase in the mRNA expression levels of IL-6, TNF-α, and IFN-γ (P > 0.05). Refer to Fig. 4.

Fig. 4.

Fig. 4

Open in a new tab

mRNA Expression Levels of IL-6, TNF-α, IFN-γ in Abdominal Aortic Tissue of Mice. A: qRT-PCR analysis showing IL-6 mRNA levels in the abdominal aorta of different groups of mice; B: qRT-PCR analysis showing TNF-α mRNA levels in the abdominal aorta of different groups of mice; C: qRT-PCR analysis showing IFN-γ mRNA levels in the abdominal aorta of different groups of mice. The data are presented as mean ± SD (standard deviation) and are based on three independent experiments. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05 compared to the Normal group; #P < 0.05 compared to the Model group; &P < 0.05 compared to the Montelukast group. Sample sizes: Normal (n = 10), Model (n = 8), Montelukast (n = 9), Montelukast + C.C (n = 9)

Protein expression levels of MMP-2, MMP-9, and α1-AT in abdominal aortic tissue of mice

Compared to the Normal group, the Model group exhibited significantly increased protein expression levels of MMP-2 and MMP-9 and a notable decrease in α1-AT protein expression (P < 0.05). Conversely, when compared to the Model group, the Montelukast group showed significantly decreased protein expression levels of MMP-2 and MMP-9 and a significant increase in α1-AT protein expression (P < 0.05). However, when compared to the Montelukast group, the Montelukast + compound C group displayed significantly elevated protein expression levels of MMP-2 and MMP-9 and a notable decrease in α1-AT protein expression (P < 0.05). Refer to Fig. 5.

Fig. 5.

Fig. 5

Open in a new tab

Protein Expression Levels of MMP-2, MMP-9, and α1-AT in Abdominal Aortic Tissue of Mice. A: Western blot analysis showing the protein expression levels of MMP-2, MMP-9, and α1-AT in the abdominal aorta of different groups of mice; B: Quantification of MMP-2, MMP-9, and α1-AT protein levels based on the densitometric analysis of the Western blot images in (A); The data are presented as mean ± SD (standard deviation) and are based on three independent experiments. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05 compared to the Normal group; #P < 0.05 compared to the Model group; &P < 0.05 compared to the Montelukast group. Sample sizes: Normal (n = 10), Model (n = 8), Montelukast (n = 9), Montelukast + C.C (n = 9)

Expression levels of AMPK/mTOR signaling pathway-related proteins in abdominal aortic tissue of mice

Compared to the Normal group, the Model group showed a significant decrease in p-AMPK/AMPK levels and a marked increase in p-mTOR/mTOR levels (P < 0.05). Conversely, when compared to the Model group, the Montelukast group exhibited a significant increase in p-AMPK/AMPK levels and a notable decrease in p-mTOR/mTOR levels (P < 0.05). However, when compared to the Montelukast group, the Montelukast + compound C group displayed a significant decrease in p-AMPK/AMPK levels and a considerable increase in p-mTOR/mTOR levels (P < 0.05). See Fig. 6.

Fig. 6.

Fig. 6

Open in a new tab

Expression Levels of AMPK/mTOR Signaling Pathway-Related Proteins in Abdominal Aortic Tissue of Mice. A: Western blot analysis showing the protein expression levels of p-AMPK, AMPK, p-mTOR, and mTOR in the abdominal aorta of different groups of mice; B: Quantification of the ratios of p-AMPK/AMPK and p-mTOR/mTOR based on the densitometric analysis of the Western blot images in (A). The data are presented as mean ± SD (standard deviation) and are based on three independent experiments. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05 compared to the Normal group; #P < 0.05 compared to the Model group; &P < 0.05 compared to the Montelukast group. Sample sizes: Normal (n = 10), Model (n = 8), Montelukast (n = 9), Montelukast + C.C (n = 9)

Discussion

Abdominal aortic aneurysm (AAA) represents a pathological state of progressive dilation of the abdominal aorta, predisposing it to rupture. Emergency surgical intervention stands as the primary treatment for this condition, yet its efficacy remains limited and is not suitable for patients with smaller aneurysm diameters [10]. Hence, pharmacological treatment is a focus of AAA research. This study found that Montelukast significantly reduced both the abdominal aortic diameter and the occurrence of AAA in mice, mitigating the pathological conditions of abdominal aortic tissue, consistent with related research outcomes [11]. This demonstrates that Montelukast can inhibit the development of abdominal aortic aneurysms.

Apoptosis, a crucial programmed cell death process in maintaining homeostasis and immunity, can lead to tissue damage when dysregulated. The mitochondrial pathway is a common signaling pathway regulating cell apoptosis, where Bax and Bcl-2 are two critical proteins. An increased Bax/Bcl-2 ratio augments mitochondrial outer membrane permeability, releasing cytochrome c (Cyt-c) into the cytoplasm, further activating downstream Caspase cascades, triggering cell apoptosis [12, 13]. This study found that Montelukast significantly decreased the TUNEL-positive rate and the Bax/Bcl-2 ratio in AAA mouse abdominal aortic tissue. This indicates that Montelukast may reduce apoptosis levels by inhibiting the mitochondrial pathway, thereby alleviating abdominal aortic injury and suppressing AAA occurrence.

Inflammation, a common inducer of apoptosis, plays a pivotal role in various tissue injuries. Aortic injury and rupture are associated with increased inflammatory cell infiltration, IL-6, TNF-α, IFN-γ, and other inflammatory factors [14]. Montelukast is applicable in treating various inflammatory diseases. It can inhibit human neutrophil activation and reduce LPS-induced acute pulmonary inflammation [15]. Montelukast can alleviate experimental autoimmune encephalomyelitis-induced inflammatory injury by altering Th17 differentiation [16]. Furthermore, it can prevent liver fibrosis induced by carbon tetrachloride and choline-deficient diet in mice by reducing hepatic stellate cell activation and inflammatory responses [17, 18]. This study found that Montelukast significantly reduced the levels of IL-6, TNF-α, and IFN-γ in AAA mouse abdominal aortic tissue. This suggests that Montelukast may alleviate aortic injury and inhibit AAA occurrence through its anti-inflammatory effects.

One reason for aortic injury due to inflammation is the regulation of matrix metalloproteinases (MMPs) by inflammation. Inflammatory reactions can decrease the expression of proteinase inhibitors like α1-AT, inducing the secretion of MMP-2, MMP-9, and other MMPs. These MMPs can degrade the extracellular matrix, thinning the aortic wall, thereby inducing aortic injury [19, 20]. This study found that Montelukast significantly reduced the levels of IL-6, TNF-α, and IFN-γ in AAA mouse abdominal aortic tissue, indicating its potential to reduce MMPs in aortic tissue, thereby alleviating inflammatory damage.

AMPK/mTOR signaling pathway is a crucial signal transduction pathway involved in cell metabolism, growth, and survival. Activation of AMPK triggers a series of reactions to restore cellular energy balance. mTOR senses the nutrient and energy levels within cells, regulating cellular metabolism and growth accordingly [21, 22]. The AMPK/mTOR signaling pathway has been found to play a critical regulatory role in the mechanism of abdominal aortic aneurysm (AAA) development and drug treatment, being involved in the regulation of pathological processes such as apoptosis and inflammation. Rosuvastatin activates autophagy via the AMPK/mTOR signaling pathway, inhibiting aortic dilation, alleviating pathological damage and cell apoptosis, inhibiting vascular smooth muscle cell phenotype conversion, and improving rat AAA [23]. The N-terminal fragment of chromogranin A vasoinhibin-1 nanocarrier inhibits AAA formation by activating the AMPK/mTOR signaling pathway [24]. This study found that Montelukast significantly increased p-AMPK/AMPK levels and decreased p-mTOR/mTOR levels in an Ang II infusion model, used in this study. Moreover, using an AMPK inhibitor, C.C, reversed the effects of Montelukast on AAA formation, aortic apoptosis, inflammation, and matrix metalloproteinase secretion in AAA mouse models, indicating that the protective effect of Montelukast on AAA mice is associated with the activation of the AMPK/mTOR signaling pathway. These findings are consistent with studies by Araújo AC et al., Di Gennaro A., and Kawai Y., which also demonstrated the role of the AMPK/mTOR pathway in regulating apoptosis, inflammation, and tissue degradation in AAA models [25–28].

Conclusion

In summary, Montelukast can alleviate aortic injury and inhibit the occurrence of AAA. Its mechanism may be related to Montelukast’s activation of the AMPK/mTOR signaling pathway, thereby reducing cellular apoptosis, inflammatory responses, and matrix metalloproteinase levels. This study provides initial insights into the mechanism by which Montelukast acts through the activation of the AMPK/mTOR signaling pathway in the treatment of AAA, offering new perspectives for AAA therapy.

Author contributions

Jian Huang designed the research study. Jiawei Zhuang performed the research. Jiamao Wang, Zhonggui Shan conducted experiments, analyzed the data. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Funding

Municipal Bureau of Science and Technology(Grant No.3502Z20199122).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

The original online version of this article was revised: The affiliation details for all authors were incorrectly given as ‘Department of Cardiac Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361000, Fujian, China’ but should have been ‘The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, 361000, China’.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

1/23/2025

The original online version of this article was revised: The affiliation details for all authors were incorrectly given as ‘Department of Cardiac Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361000, Fujian, China’ but should have been ‘The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, 361000, China’.

Change history

2/6/2025

A Correction to this paper has been published: 10.1007/s00423-025-03625-8

References

  • 1.Marcaccio CL, Schermerhorn ML (2021) Epidemiology of abdominal aortic aneurysms. Semin Vasc Surg 34(1):29–37 [DOI] [PubMed] [Google Scholar]
  • 2.Baman JR, Eskandari MK (2022) What is an abdominal aortic aneurysm? JAMA. 328(22):2280 [DOI] [PubMed]
  • 3.Kyriacou H, Mostafa AMHAM, Sumal AS, Hellawell HN, Boyle JR (2021) Abdominal aortic aneurysms part two: Surgical management, postoperative complications and surveillance. J Perioper Pract 31(9):319–325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zuberi FF, Haroon MA, Haseeb A, Khuhawar SM (2020 Nov-Dec) Role of Montelukast in Asthma and allergic rhinitis patients. Pak J Med Sci 36(7):1517–1522. 10.12669/pjms.36.7.2657. PMID: 33235567; PMCID: PMC7674876 [DOI] [PMC free article] [PubMed]
  • 5.Sinha SD, Perapogu S, Chary SS, Ramesh S, Bakshi J, Singh A, Ahmed AK, Mohan Reddy B, Panapakam M, Talluri L, Vattipalli R (2023) Efficacy and safety of fixed-dose combination of Bilastine-Montelukast in adult patients with allergic rhinitis: a phase III, randomized, multi-center, double-blind, active controlled clinical study. J Asthma 60(11):2014–2020 Epub 2023 May 31. PMID: 37140964 [DOI] [PubMed] [Google Scholar]
  • 6.Di Gennaro A, Araújo AC, Busch A et al (2018) Cysteinyl leukotriene receptor 1 antagonism prevents experimental abdominal aortic aneurysm, Proceedings of the National Acadamy of Sciences of the United States of America, vol. 115, no. 8, pp. 1907–1912 [DOI] [PMC free article] [PubMed]
  • 7.Kawai Y, Narita Y, Ogata A, Usui A, Komori K (2019) Therapeutic potential of Montelukast, Cysteinyl Leukotriene receptor 1 antagonist, for aortic aneurysm. Eur J Vasc Endovasc Surg 58(6):e419. 10.1016/j.ejvs.2019.06.1064 [Google Scholar]
  • 8.He J, Li N, Fan Y, Zhao X, Liu C, Hu X (2021) Metformin inhibits abdominal aortic aneurysm formation through the activation of the AMPK/mTOR Signaling Pathway. J Vasc Res 58(3):148–158 [DOI] [PubMed] [Google Scholar]
  • 9.Kawai Y, Narita Y, Yamawaki-Ogata A et al (2019) Montelukast, a Cysteinyl Leukotriene Receptor 1 Antagonist, Induces M2 Macrophage Polarization and Inhibits Murine Aortic Aneurysm Formation. Biomed Res Int. 2019:9104680 [DOI] [PMC free article] [PubMed]
  • 10.Haque K, Bhargava P (2022) Abdominal aortic aneurysm. Am Fam Physician 106(2):165–172 [PubMed] [Google Scholar]
  • 11.Yong X, Wang XZ, Zhang FZ et al (2021) To investigate the mechanism of montelukast sodium inhibiting the formation of abdominal aortic aneurysm in rats based on JNK/c-Jun signaling pathway[J]. Chin J Gerontol 41(13):5 [Google Scholar]
  • 12.Sinha I, Sinha-Hikim AP, Hannawa KK, Henke PK, Eagleton MJ, Stanley JC, Upchurch GR Jr (2005) Mitochondrial-dependent apoptosis in experimental rodent abdominal aortic aneurysms. Surgery.;138(4):806– 11. 10.1016/j.surg.2005.07.011. PMID: 16269312 [DOI] [PubMed]
  • 13.Aamazadeh F, Ostadrahimi A, Saadat YR et al (2020) Bitter apricot ethanolic extract induces apoptosis through increasing expression of Bax/Bcl-2 ratio and caspase-3 in PANC-1 pancreatic cancer cells[J]. Mol Biol Rep 47(3):1895–1904 [DOI] [PubMed] [Google Scholar]
  • 14.Tomida S, Aizawa K, Nishida N et al (2019) Indomethacin reduces rates of aortic dissection and rupture of the abdominal aorta by inhibiting monocyte/macrophage accumulation in a murine model[J]. Sci Rep 9(1):10751 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Davino-Chiovatto JE, Oliveira-Junior MC, MacKenzie B et al (2019) Montelukast, leukotriene inhibitor, reduces LPS-Induced Acute Lung inflammation and human neutrophil activation. Arch Bronconeumol (Engl Ed) 55(11):573–580 [DOI] [PubMed] [Google Scholar]
  • 16.Han B, Zhang YY, Ye ZQ et al (2021) Montelukast alleviates inflammation in experimental autoimmune encephalomyelitis by altering Th17 differentiation in a mouse model. Immunology 163(2):185–200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pu S, Zhang J, Ren C, Zhou H, Wang Y, Wu Y, Yang S, Cao F, Zhou H (2023) Montelukast prevents mice against carbon tetrachloride- and methionine-choline deficient diet-induced liver fibrosis: reducing hepatic stellate cell activation and inflammation. Life Sci 325:121772 [DOI] [PubMed] [Google Scholar]
  • 18.Sugiura T, Nawaz S, Ferrell BE, Yoshida T (2024) Induced pluripotent stem cells: a new dawn for the treatment of Ischemic cardiomyopathy. Innov Discov 1(4):31. 10.53964/id.2024031
  • 19.Li JJ, Tian AL, Lv HB et al (2018) Expressions of a-1 antitrypsin in Stanford Type A aortic dissection and their clinical Significance[J]. Lab Immun Clin Med 25(10):1485–1488 [Google Scholar]
  • 20.Zou MS (2017) CircRNA expression profile and possible regulatory mechanism analysis of thoracic aortic dissection[D]. Southern Medical University, Guangdong [Google Scholar]
  • 21.Chun Y, Kim J (2021) AMPK-mTOR Signaling and Cellular adaptations in Hypoxia. Int J Mol Sci 22(18):9765 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Arora G, Singh S, Emadifar H (2024) Mathematical models of wound healing and tissue regeneration: insights with numerical solution. Innov Discov 1(2):13. 10.53964/id.2024013
  • 23.Yu Q, Zeng S, Hu R, Li M, Liu Q, Wang Y, Dai M (2023) Dexmedetomidine alleviates abdominal aortic aneurysm by activating Autophagy Via AMPK/mTOR pathway. Cardiovasc Drugs Ther. Jul 1 [DOI] [PubMed]
  • 24.Wang P, Wang W, Peng X, Ruan F, Yang S (2021) Effect of chromogranin A N-terminal fragment vasostatin-1 nano-carrier transfection on abdominal aortic aneurysm formation. Bioengineered 12(2):11018–11029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Araújo AC, Tang X, Haeggström JZ (2018) Targeting cysteinyl-leukotrienes in abdominal aortic aneurysm. Prostaglandins Other Lipid Mediat 139:24–28. 10.1016/j.prostaglandins.2018.09.007 Epub 2018 Sep 21. PMID: 30248405 [DOI] [PubMed] [Google Scholar]
  • 26.Di Gennaro A, Araújo AC, Busch A, Jin H, Wågsäter D, Vorkapic E, Caidahl K, Eriksson P, Samuelsson B, Maegdefessel L, Haeggström JZ (2018) Cysteinyl leukotriene receptor 1 antagonism prevents experimental abdominal aortic aneurysm. Proc Natl Acad Sci U S A 115(8):1907–1912. 10.1073/pnas.1717906115Epub 2018 Feb 5. PMID: 29432192; PMCID: PMC5828611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kawai Y, Narita Y, Yamawaki-Ogata A, Usui A, Komori K (2019) Montelukast, a Cysteinyl Leukotriene receptor 1 antagonist, induces M2 macrophage polarization and inhibits murine aortic aneurysm formation. Biomed Res Int 2019:9104680. 10.1155/2019/9104680PMID: 31263710; PMCID: PMC6556796 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Di Gennaro A, Wågsäter D, Mäyränpää MI, Gabrielsen A, Swedenborg J, Hamsten A, Samuelsson B, Eriksson P, Haeggström JZ (2010) Increased expression of leukotriene C4 synthase and predominant formation of cysteinyl-leukotrienes in human abdominal aortic aneurysm. Proc Natl Acad Sci U S A 107(49):21093–21097. 10.1073/pnas.1015166107Epub 2010 Nov 15. PMID: 21078989; PMCID: PMC3000261 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Langenbeck's Archives of Surgery are provided here courtesy of Springer

RESOURCES