Abstract
The aim of this study was to investigate the alleviating effects and mechanisms of bile acids (BA) on corticosterone-induced fatty liver in broiler chickens. Male Arbor Acres chickens were randomly divided into 3 groups: control group (CON), stress model group (CORT), and BA-treated group (CORT-BA). The CORT-BA group received a diet with 250 mg/kg BA from 21 d of age. From days 36 to 43, both the CORT and CORT-BA groups received subcutaneous injections of corticosterone to simulate chronic stress. The results indicated that BA significantly mitigated the body weight loss, liver enlargement, and hepatic lipid deposition caused by corticosterone (P < 0.05). Liver RNA-seq analysis showed that BA alleviated corticosterone-induced fatty liver by inhibiting lipid metabolism pathways, including fatty acid biosynthesis, triglyceride biosynthesis, and fatty acid transport. Additionally, BA improved corticosterone-induced downregulation of glucocorticoid receptor (GR) expression (P < 0.05). Molecular docking and cellular thermal shift assays revealed that hyodeoxycholic acid (HDCA), a major component of compound BA, could bind to GR and enhance its stability. In conclusion, BA alleviated corticosterone-induced fatty liver in broilers by inhibiting lipid synthesis pathways and mitigating the suppression of hepatic GR expression.
Keywords: bile acid, broiler, fatty liver, glucocorticoid receptor, stress
Dietary supplementation of bile acids (BA) alleviated weight loss and fatty liver caused by chronic corticosterone treatment. BA bind to the glucocorticoid receptor to mitigate the suppression of its expression induced by chronic corticosterone treatment.
Introduction
Fatty liver syndrome in chickens poses a significant challenge to poultry health and industry productivity, characterized primarily by excessive fat accumulation in the liver. Various stressors are present in broiler production, and hepatic lipid metabolism disorders in chickens are closely related to stress responses (Lu et al., 2007, 2019). As the main stress hormone in poultry, corticosterone plays a crucial role in this process. Chronic stress leads to increased corticosterone secretion, and excessive corticosterone can cause lipid deposition in the chicken liver, primarily through its action on glucocorticoid receptor (GR; Hu et al., 2017, 2018; Zaytsoff et al., 2019).
GR is an essential component in the regulation of metabolism and stress responses (Kadmiel and Cidlowski, 2013). GR significantly influences hepatic lipid metabolism pathways, including fatty acid synthesis, triglyceride synthesis, and lipid transport, thereby maintaining liver lipid balance (Quagliarini et al., 2023). However, chronic stress or elevated glucocorticoid levels can lead to a suppression of GR expression and function, resulting in glucocorticoid resistance. In this state, the impaired function of GR disrupts lipid metabolism, leading to excessive lipid accumulation and worsening fatty liver (Mueller et al., 2011; Lu et al., 2022). In mammals, GR has been extensively studied as a therapeutic target for fatty liver disease (Koorneef et al., 2018). GR as a therapeutic target may also be an effective strategy for preventing and treating chicken fatty liver syndrome, although current research lacks focus on GR.
Bile acids (BA) not only possess traditional functions in the digestion and absorption of fats but also play a significant role in the regulation of lipid metabolism (Chiang and Ferrell, 2018). In both mammalian and chicken fatty liver disease, significant changes in bile acid concentrations and compositions are observed (Puri et al., 2018; Gillard et al., 2022; Wu et al., 2023), thereby increasingly focusing research on the role of BA as regulators of lipid metabolism (Jiao et al., 2022). For instance, clinical trials have demonstrated that norursodeoxycholic acid (norUDCA), a derivative of BA, significantly reduces serum alanine transaminase (ALT) levels in patients with nonalcoholic fatty liver disease (NAFLD), indicating its positive effect on liver health (Traussnigg et al., 2019). Similarly, animal studies have shown that hyodeoxycholic acid (HDCA) can alleviate fatty liver by modulating key metabolic pathways, including the regulation of lipid metabolism via hepatic cytochrome P450 family 7 subfamily b member 1 (CYP7B1) and the activation of peroxisome proliferator-activated receptor α (PPARα) through interaction with RAN proteins (Kuang et al., 2023; Zhong et al., 2023). Feeding complex BA has also been shown to prevent and mitigate fatty liver induced by a high-fat diet in broilers (Yin et al., 2021a). There has also been research exploring the interaction between BA and GR, such as the activation of GR by ursodeoxycholic acid (Tanaka and Makino, 1992; Weitzel et al., 2005). However, the effects of BA on corticosterone-induced fatty liver in broilers and their potential relationship with GR remain unclear.
The aim of this study was to investigate the effects of BA on corticosterone-induced fatty liver in broilers and whether these changes are related to disturbances of hepatic lipid metabolism and GR suppression. This study reveals the potential mechanism by which BA alleviates stress-induced fatty liver in broilers and provides a more effective strategy for poultry production.
Materials and Methods
Ethical statement
The experimental protocol was approved by the Animal Ethics Committee of Nanjing Agricultural University. The sampling procedures complied with the “Guidelines on Ethical Treatment of Experimental Animals” (2006) no. 398 set by the Ministry of Science and Technology, China.
BA preparation
BA used in animal experiments were provided by Shandong Longchang Animal Health Care Co., Ltd. (Dezhou, China). The purity of the BA is 96.9%, comprising 73.2% HDCA, 19.8% chenodeoxycholic acid, and 3.9% hyocholic acid. HDCA used for cell experiments was 98% pure (H3878, Sigma-Aldrich, MO, USA).
Animals and experimental design
One-day-old male Arbor Acres chickens (n = 45) were raised in Nanjing Agricultural University under standard conditions and fed with broiler basal diet (purchased from New Hope Liuhe Co., Ltd.). The nutrient composition of the broiler basal diet was as follows: 18% crude protein, 9% crude ash, 5% crude fiber, 0.5% total phosphorus, 1.2% calcium, 0.8% sodium chloride, and 0.9% methionine. At 21 d of age, chickens were randomly divided into 3 treatment group of 5 replicates in each group (15 birds per treatment): control group (CON), chronic stress model group (CORT), and bile acid group (CORT-BA). The CORT-BA group was fed with 250 mg/kg bile acid. At the age of 36 to 43 d, chronic stress model was established by subcutaneous injection of corticosterone (C104537, Aladdin, Shanghai, China) in CORT and CORT-BA groups. Injections were administered twice daily at a dose of 4.0 mg/kg/d (Wu et al., 2024). The chickens were reared in cages under controlled conditions, with each cage measuring 60 cm × 50 cm × 45 cm. All chickens were housed in the same room to ensure consistent environmental conditions. The light regime was 23 L:1D, and the room temperature started at 35 °C for the first 3 d and gradually reduced by 3 °C per week until 23 °C, with the humidity kept at 50% to 60% throughout the experiment. Chickens were allowed free access to food and water, and body weight was recorded weekly. Chickens were slaughtered at 44 d of age. Blood was collected in centrifuge tubes, and the serum was separated and stored at −20 °C. Liver samples from the same region were cut into appropriate sizes and preserved in 4% paraformaldehyde. The remaining liver tissue was cut into small pieces, immediately frozen in liquid nitrogen, and stored at −80 °C for subsequent experiments.
Histological evaluation of liver
Five broilers were selected from each group for liver histological examination. Liver samples were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned (4 μm thickness). The sections were subjected to hematoxylin-eosin staining (HE) and Oil Red O staining. Sections were imaged under a light microscope (Olympus-BX63, Tokyo, Japan).
Measurement of biochemical indicators
Blood was centrifuged to obtain serum for measurement of triglycerides (TG), total bile acids (TBA), total bilirubin (TBIL), total cholesterol (TCH), glucose (GLU), ALT, and aspartate aminotransferase (AST). The aforementioned measurements were conducted using commercially available assay kits procured from Meikang Biotechnology Co., Ltd. (Ningbo, China), and an automated biochemical analyzer (Hitachi 7020, Tokyo, Japan). Serum corticosterone was measured using a commercial ELISA kit purchased from Elabscience Biotechnology Co., Ltd. (E-EL-0160, Wuhan, China). Fifteen samples were analyzed for each group (n = 15).
Seven hundred and fifty microliters of the extract solution (chloroform: methanol = 2:1) was added to 50 mg of liver tissue and homogenized. After centrifugation at 8,000 × g for 10 min, the supernatant was collected for the determination of TG and TCH. The measurements were conducted using commercially available assay kits procured from Meikang Biotechnology Co., Ltd., and an automated biochemical analyzer (Hitachi 7020). Ten samples were analyzed for each group (n = 10).
Transcriptome sequencing of liver
Total RNA extraction and subsequent transcriptome sequencing were outsourced to Novogene Corporation (Beijing, China). Samples were prepared and sequenced using Illumina technology, following the service provider’s standard protocols. Statistical analyses were conducted using R software (version 4.2.3). Differences in gene expression between groups were considered significant at an adjusted P-value < 0.05. Five samples were analyzed for each group (n = 5).
RNA isolation and real-time polymerase chain reaction
Total RNA was extracted from liver tissues using the Trizol reagent (TSP401, Tsingke, Beijing, China) according to the manufacturer’s protocol. Briefly, approximately 30 mg of liver tissue was homogenized in 1 mL of Trizol, and RNA precipitation was dissolved with RNase-free water. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA), and RNA integrity was checked by agarose gel electrophoresis. Finally, 1 µg of total RNA was used for reverse transcription into cDNA (AE341-02, TransGen, Beijing, China). Refer to Genebank and design related primers as shown in Table 1. Gene expression was assessed using a QuantStudio 6 Flex real-time polymerase chain reaction (qPCR) system (Thermo Scientific). The relative gene expression was calculated by 2−ΔΔCt method. Ten samples were analyzed for each group (n = 10).
Table 1.
Nucleotide sequences of primers
| Target gene | Primer sequence (5ʹ–3ʹ) | GenBank access |
|---|---|---|
| ACACA | F: CACCTCCCACCCAAACAGAA | NM_205505.2 |
| R: TACGTGGACCATCCCGTAGT | ||
| FABP4 | F: GACAATGGCACACTGAAGCAG | NM_204290.2 |
| R: CAGGTTCCCATCCACCACTTT | ||
| FASN | F: CAAGCAAACGTGACTGCGAA | NM_205155.4 |
| R: ACACTGAGCGAATCCTGGTG | ||
| GR | F: AACCTGCTCTGGCTGACTTC | NM_001037826.1 |
| R: GCCTGAAGTCCGTTTCTCCA | ||
| PNPLA3 | F: ACACTCACCTGTTGTCATCGG | XM_015291180.4 |
| R: AAATGATGGCGGAATGAGGC | ||
| PPIA | F: TTACGGGGAGAAGTTTGCCG | NM_001166326.2 |
| R: TGGTGATCTGCTTGCTCGTC | ||
| SCD | F: TCAGCGTCAGCCCAATAAT | NM_204890.1 |
| R: CAAGCCCCCTCTGCGATA | ||
| THRSP | F: TTCTGACCGACCTCACCAAAA | NM_213577.3 |
| R: GCTGCTCTGACCTTCACCGA |
Protein extraction and Western blotting
For protein extraction, approximately 50 mg of liver tissue was homogenized in RIPA lysis buffer (BD0032, Bioworld, Nanjing, China) containing protease inhibitors (B14001, Selleck, Shanghai, China) using a mechanical homogenizer. The supernatant containing the protein was then collected by centrifugation. The protein concentration was measured using BCA method (DQ11, TransGen). SDS-PAGE gel electrophoresis was performed with 30 µg protein. Chicken GR antibody (Customized from Wuhan GeneCreate Biological Engineering Co., Ltd., China) and Tubulin α antibody (AC007, Abclonal, Wuhan, China) were diluted according to the instructions. Ten samples were analyzed for each group (n = 10). Data analysis was performed using imageJ software (version: 1.51).
Molecular docking
The crystal structure of human GR ligand-binding domain (LBD) was obtained from Protein Data Bank (PDB ID: 4UDC). Molecular docking was performed by AutoDockTools (version: 1.5.7). PyMOL software (version: 2.6.0) was applied for analysis of the interaction of residues between GR and HDCA.
Cellular thermal shift assay
The procedure was referred to the previous literature (Jafari et al., 2014). The AML12 cell line was purchased from the National Collection of Authenticated Cell Cultures (SCSP-550). AML12 cells were treated with DMSO or 200 μM HDCA for 6 h. Cells were collected by trypsin digestion and washed with PBS. The cell pellets were resuspended in 1 mL PBS with protease inhibitor. Next, the suspension was divided into 100 μL aliquots and subjected to gradient heating ranging from 40 °C to 58 °C for 3 min. After freeze-thawing twice with liquid nitrogen, the supernatant was acquired by centrifugation at 20,000 × g for 20 min at 4 °C, followed by Western blotting.
Statistical analysis
Data were analyzed by one-way ANOVA with SPSS (version: 21) software, and the residuals were tested for normality. All the test results were expressed as “mean ± SE”, and P < 0.05 was considered as the criterion of significance.
Results
BA alleviates corticosterone-induced fatty liver in broilers
Previous research has demonstrated that corticosterone leads to weight loss and fatty liver in broiler chickens (Hu et al., 2018; Wu et al., 2023). Dietary supplementation of BA significantly alleviated the corticosterone-induced reduction in body weight in broilers (P < 0.05, Figure 1A and B). Corticosterone treatment resulted in liver enlargement in broilers, which was significantly alleviated by BA (P < 0.05, Figure 1C). Morphological observation showed that BA significantly alleviated corticosterone-induced liver lipid deposition (Figure 1D and E). Hepatic TG levels increased in the CORT group, while were significantly reduced in the CORT-BA group compared to the CORT group (P < 0.05, Figure 1F). TCH levels remained unchanged in both the CORT and CORT-BA groups (Figure 1G).
Figure 1.
Bile acids alleviated corticosterone-induced growth inhibition and hepatic lipid deposition. (A) Body weight at 43 d of age (n = 15). (B) Body weight gain from 36 to 43 d of age (n = 15). (C) Liver index (n = 15). (D) Representative images of liver general appearance. (E) Oil Red O staining and HE staining of liver. (F) Liver TG content (n = 10). (G) Liver TCH content (n = 10). Data shown are the means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001.
Changes in serum biochemical indicators
The serum biochemical results are shown in Table 2. Results indicate that corticosterone treatment significantly increased the concentrations of TG, TBA, TCH, AST, corticosterone, and the AST/ALT ratio (P < 0.05), while significantly decreased TBIL concentration (P < 0.05). In the CORT-BA group, serum concentrations of TG and TCH were markedly lower compared to the CORT group (P < 0.05). However, there were no significant improvements observed in TBA, AST, TBIL, corticosterone, or AST/ALT levels.
Table 2.
Serum biochemical parameters
| Parameter | CON1 | CORT2 | CORT-BA3 |
|---|---|---|---|
| TG, mmol/L | 0.70 ± 0.08a | 1.56 ± 0.52b | 0.79 ± 0.13c |
| TBA, µmol/L | 6.94 ± 4.87a | 11.89 ± 3.45b | 11.08 ± 4.66b |
| TBIL, µmol/L | 2.25 ± 0.70a | 1.28 ± 0.34b | 1.54 ± 0.26b |
| TCH, mmol/L | 3.22 ± 0.43a | 4.29 ± 0.67b | 3.73 ± 0.49c |
| GLU, mmol/L | 11.81 ± 1.32 | 14.71 ± 4.46 | 13.29 ± 2.69 |
| ALT, U/L | 250.15 ± 41.45a | 424.53 ± 181.85b | 410.15 ± 141.18b |
| AST, U/L | 21.84 ± 2.23a | 27.36 ± 4.39b | 30.43 ± 7.25b |
| AST/ALT | 7.28 ± 2.00 | 7.83 ± 4.00 | 6.31 ± 1.76 |
| Corticosterone, ng/mL | 28.23 ± 4.44a | 41.14 ± 9.07b | 39.20 ± 6.27b |
Fifteen samples were analyzed for each group (n = 15). Data shown are the means ± SD. In the same row, different letters mean significant difference (P < 0.05).
1CON, control received only the basal diet.
2CORT, basal diet + corticosterone treatment.
3CORT-BA, basal diet supplemental with 250 mg/kg bile acid + corticosterone treatment.
Transcriptome analysis of the liver
To reveal hepatic transcriptional changes, RNA-seq was used to identify differentially expressed gene (DEG). Principal component analysis demonstrated a notable dissimilarity between the CORT group and the other 2 groups (Figure 2A). As shown in Figure 2B, there were 635 DEGs between CON group and CORT group, including 308 upregulated genes and 327 downregulated genes. There were 392 DEGs between CORT group and CORT-BA group, including 261 upregulated genes and 131 downregulated genes.
Figure 2.
Enrichment analysis of DEGs in the liver. (A) Principal component analysis. (B) Differential gene volcano plots. (C) KEGG pathway enrichment.
The Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis was performed on all DEGs (Figure 2C). The results showed that DEGs between the CON group and the CORT group were significantly enriched in lipid metabolism and amino acid metabolism pathways. DEGs between the CORT group and the CORT-BA group were mainly enriched in lipid metabolism-related pathways, such as fatty acid metabolism, glycerolipid metabolism, and PPAR signaling pathway.
The gene set enrichment analysis (GSEA) results showed that the DEGs between the CORT group and the CORT-BA group were significantly enriched in fatty acid biosynthesis process (NES = 1.87, pFDR = 0.029), triglyceride biosynthesis process (NES = 1.58, pFDR = 0.170) and fatty acid transporters (NES = 1.49, pFDR = 0.229; Figure 3A). Genes that were significantly downregulated in the CORT-BA group are shown with heat maps (Figure 3B–D).
Figure 3.
GSEA enrichment analysis of DEGs in the liver. (A) GSEA pathway enrichment. (B) Heatmap for fatty acid biosynthesis process related genes. (C) Heatmap for triglyceride biosynthesis process related genes. (D) Heatmap for fatty acid transporters related genes. Five samples per group (n = 5).
Analysis of hepatic lipid metabolism genes and GR expression
The mRNA expression of differential genes in GSEA results was verified by qPCR. The results showed that that the expression of stearoyl-CoA desaturase (SCD), acetyl-CoA carboxylase alpha (ACACA), fatty acid synthase (FASN), thyroid hormone responsive (THRSP), patatin like phospholipase domain containing 3 (PNPLA3), and fatty acid binding protein 4 (FABP4) was consistent with the transcriptome results. The expression of these genes was significantly higher in the CORT group than in the CON group, and was significantly alleviated in the CORT-BA group (P < 0.05, Figure 4A–F). GR mRNA and protein expression in the liver were examined, and the results showed that GR mRNA expression did not change in the CORT and CORT-BA groups (Figure 4G). Compared with the CON group, the expression of GR protein in the CORT group was significantly downregulated, while that in the CORT-BA group was significantly alleviated (P < 0.05, Figure 4H).
Figure 4.
Effect of bile acids on the expression of lipid metabolism genes and GR in the liver. (A) SCD mRNA expression. (B) FASN mRNA expression. (C) ACACA mRNA expression. (D) THRSP mRNA expression. (E) PNPLA3 mRNA expression. (F) FABP4 mRNA expression. (G) GR mRNA expression. (H) GR protein expression. Data shown are the means ± SD. Ten samples per group (n = 10). ***P < 0.001.
Biophysical binding of HDCA with GR
The molecular structure of HDCA is shown in Figure 5A. The crystal structure of chicken GR-LBD has not been reported, while chicken and human GR-LBD share a high homology of 89.9% (Figure 5B). Therefore, the human GR-LBD (PDB ID:4UDC) was used for molecular docking with HDCA. The results showed that the LBD interface interacts with HDCA with a free energy of −9.0 kcal/mol, while the estimated free energy for the binding between the interface and dexamethasone is −12.2 kcal/mol. Our modeling analysis predicted that HDCA forms hydrogen bonds with Arg611, Tyr735, and Thr739 in the GR-LBD, which are close to the binding sites of dexamethasone and GR (Figure 5C). To verify the molecular recognition of GR with HDCA, cellular thermal shift assay (CETSA) was carried out that the presence of HDCA increased the thermal stability of GR compared with DMSO (P < 0.05, Figure 5D).
Figure 5.
Biophysical binding of HDCA with GR. (A) Chemical structure of HDCA. (B) Alignment of the LBD protein sequences of human and chicken GR. (C) Molecular docking analysis of GR-LBD and HDCA or dexamethasone. (D) The stabilizing effect of HDCA for GR in AML12 cells. Data shown are the means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001.
Discussion
BA are not only involved in the digestion and absorption of fats but also influence animal production performance through the regulation of metabolism, immune functions, and intestinal health. Stress can disrupt bile acid metabolism within animals, hence exogenous supplementation of BA can alleviate some of the physiological damages caused by stress (Zhang et al., 2023). In this study, BA were found to mitigate the reduction in body weight of broilers induced by corticosterone consistent with previous research findings. Existing studies have shown that BA enhance the absorption of fats and fat-soluble vitamins, promote growth and development, and improve the nutritional utilization of feed in chickens (Lai et al., 2018; Ge et al., 2019; Geng et al., 2022). BA can also improve the stress resistance of broilers, and it has been found that feeding BA alleviates heat stress-induced weight loss in broilers (Yin et al., 2021b; Li et al., 2023).
Under stress conditions, excessive GC impact fat metabolism, hepatic lipid accumulation, and insulin sensitivity, thereby increasing the risk of fatty liver development. This study found that BA can alleviate the elevation of serum TG and TCH as well as hepatic lipid deposition induced by corticosterone. BA mitigate fatty liver through various mechanisms including promoting bile acid cycling, regulating lipid metabolism, modulating the gut microbiome, and exerting antioxidative effects. However, current research on BA in chickens farming mainly focuses on their ability to improve feed digestion and absorption, promote growth and development, and enhance immune functions (Dai et al., 2020; Bansal et al., 2021; Yang et al., 2022). Some studies have found that BA can alleviate fatty liver caused by high-fat diets in mice and chickens (Kuang et al., 2023; Zhong et al., 2023; Hu et al., 2024). HDCA targets hepatic CYP7B1 and binds to RAN proteins to promote nuclear localization of PPARα, thereby regulating lipid metabolism and alleviating fatty liver in mice (Kuang et al., 2023; Zhong et al., 2023). Feeding a complex of BA prevents and reduces fatty liver in broilers induced by a high-fat diet, an effect that is associated with the gut microbiota (Hu et al., 2024). In a study on chronic heat stress in broilers, dietary BA reduced hepatic triglyceride content (Yin et al., 2021a). Although different from the model used in this study, BA have shown efficacy in alleviating fatty liver.
Hepatic lipid metabolism is regulated by fatty acid uptake and export, de novo lipogenesis, and β-oxidation. An imbalance between these pathways can lead to lipid accumulation in the liver, resulting in fatty liver disease (Badmus et al., 2022). Studies have shown that fatty acid transporters, such as FABPs, are also significantly elevated in fatty liver (Westerbacka et al., 2007; Higuchi et al., 2011). In this study, RNA-seq results indicate that BA alleviate corticosterone-induced fatty liver in broilers through pathways involved in fatty acid synthesis, triglyceride synthesis, and fatty acid transport, suggesting that BA alleviate corticosterone-induced fatty liver in broiler chickens mainly by reducing lipid synthesis. Previous studies have shown that dietary BA reduce the expression of sterol regulatory element-binding protein 1 and FASN in liver of broiler chickens (Yin et al., 2021a). Moreover, dietary supplementation with HDCA improves diet-induced NAFLD in mice by activating fatty acid oxidation (Zhong et al., 2023). These results indicate that while BA consistently exhibit a beneficial effect on lipid metabolism and fatty liver across different species, the underlying mechanisms may vary. Specifically, the pathways modulated by BA could differ based on the species and the particular metabolic conditions involved, which suggests that the therapeutic potential of BA may need to be tailored according to these factors.
GR is a major regulator of metabolism and controls energy utilization during stress (Bose et al., 2016). Dysfunctional GR has been shown to disrupt the balance between lipid uptake and release, leading to increased hepatic lipid accumulation (Rahimi et al., 2020). In one study, the fatty livers of obese rats exhibit reduced GR expression compared to lean rats (Jenson et al., 1996). Similarly, liver-specific GR knockout mice developed fatty liver even when maintained on a normal diet (Mueller et al., 2011). These findings suggest that decreased GR expression and activity are key contributors to the development of fatty liver disease. In our study, we also observed downregulation of hepatic GR expression in corticosterone-induced fatty liver in broiler chickens, and BA were able to restore GR expression. GR downregulation is often associated with increased chronic inflammation, with inflammatory factors such as TNF-α and IL-6 further inhibiting GR function and exacerbating liver damage (Van Bogaert et al., 2011; Robert et al., 2016). As bioactive substances, BA are structured around a steroidal nucleus similar to glucocorticoids, hence they exhibit similar physiological effects. Some BA, such as ursodeoxycholic acid and taurochenodeoxycholic acid, can modulate GR to exert anti-inflammatory and anti-apoptotic effects (Sola et al., 2005; Li et al., 2019). Therefore, the recovery of GR expression by BA may help prevent the further progression of fatty liver disease.
To further investigate how BA enhance GR expression, we selected HDCA, the main component of the complex BA used in this study, for molecular docking analysis. Due to the lack of reported crystal structures for chicken GR, we conducted a homology comparison between chicken and human GR protein sequences, which revealed high similarity in the LBD. This allowed us to use the human GR-LBD crystal structure as a reference for our study. Molecular docking results showed that HDCA had similar binding free energy and binding sites on GR as dexamethasone, suggesting HDCA’s potential to bind with GR. This interaction was further validated through the CETSA, which demonstrated that the presence of HDCA enhanced GR’s thermal stability. Therefore, the restoration of hepatic GR expression by dietary BA supplementation may be due to the direct interaction between HDCA and GR.
Conclusion
Overall, dietary supplementation of BA can alleviate corticosterone-induced hepatic lipid deposition by reducing lipid synthesis in the liver. Moreover, BA alleviated the corticosterone-induced reduction in hepatic GR. BA can bind to GR, enhancing its stability and promoting the restoration of GR expression. These findings suggest that BA can regulate stress-related disruptions in hepatic lipid metabolism, offering a promising strategy to mitigate stress-induced liver damage in poultry.
Acknowledgments
This work was supported by the National Key Research and Development Program of China (2022YFD1300401) and the National Natural Science Foundation of China (32272962 and 31972638).
Glossary
Abbreviations
- ACACA
acetyl-CoA carboxylase alpha
- ALT
alanine transaminase
- AST
aspartate aminotransferase
- BA
bile acid
- CETSA
cellular thermal shift assay
- CYP7B1
cytochrome P450 family 7 subfamily B member 1
- DEG
differentially expressed gene
- FABP4
fatty acid binding protein 4
- FASN
fatty acid synthase
- GLU
glucose
- GR
glucocorticoid receptor
- GSEA
gene set enrichment analysis
- HDCA
hyodeoxycholic acid
- HE
hematoxylin-eosin staining
- KEGG
kyoto encyclopedia of genes and genomes
- LBD
ligand-binding domain
- NAFLD
nonalcoholic fatty liver disease
- PNPLA3
patatin like phospholipase domain containing 3
- PPARα
peroxisome proliferator-activated receptor α
- SCD
stearoyl-CoA desaturase
- TBA
total bile acids
- TBIL
total bilirubin
- TCH
total cholesterol
- TG
triglycerides
- THRSP
thyroid hormone responsive
Contributor Information
Jie Liu, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Ke Zhang, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Mindie Zhao, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Liang Chen, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Huimin Chen, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Yulan Zhao, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China.
Ruqian Zhao, Key Laboratory of Animal Physiology and Biochemistry, Nanjing Agricultural University, Nanjing, 210095, China; National Key Laboratory of Meat Quality Control and Cultured Meat Development, Nanjing, 210095, China.
Author contributions
Jie Liu (Conceptualization, Formal analysis, Investigation, Methodology, Software, Writing—original draft), Ke Zhang (Data curation, Formal analysis), Mindie Zhao (Software, Visualization), Liang Chen (Supervision, Validation), Huimin Chen (Investigation, Validation), Yulan Zhao (Investigation), and R. Q. Zhao (Conceptualization, Funding acquisition, Resources, Supervision, Writing—review & editing)
Data Availability
All data generated or analyzed during this study are available from the corresponding author upon reasonable request.
Conflict of interest statement
The authors declare no real or perceived conflicts of interest.
Literature Cited
- Badmus, O. O., Hillhouse S. A., Anderson C. D., Hinds T. D., and Stec D. E... 2022. Molecular mechanisms of metabolic associated fatty liver disease (MAFLD): functional analysis of lipid metabolism pathways. Clin. Sci. (Lond.). 136:1347–1366. doi: https://doi.org/ 10.1042/CS20220572 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bansal, M., Alenezi T., Fu Y., Almansour A., Wang H., Gupta A., Liyanage R., Graham D. B., Hargis B. M., and Sun X... 2021. Specific secondary bile acids control chicken necrotic enteritis. Pathogens. 10:1041. doi: https://doi.org/ 10.3390/pathogens10081041 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bose, S. K., Hutson I., and Harris C. A... 2016. Hepatic glucocorticoid receptor plays a greater role than adipose gr in metabolic syndrome despite renal compensation. Endocrinology 157:4943–4960. doi: https://doi.org/ 10.1210/en.2016-1615 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiang, J. Y. L., and Ferrell J. M... 2018. Bile acid metabolism in liver pathobiology. Gene Expr. 18:71–87. doi: https://doi.org/ 10.3727/105221618X15156018385515 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dai, D., Pan Y., Zeng C., Liu S., Yan Y., Wu X., Xu Z., and Zhang L... 2020. Activated FXR promotes xenobiotic metabolism of T-2 toxin and attenuates oxidative stress in broiler chicken liver. Chem. Biol. Interact. 316:108912. doi: https://doi.org/ 10.1016/j.cbi.2019.108912 [DOI] [PubMed] [Google Scholar]
- Ge, X. K., Wang A. A., Ying Z. X., Zhang L. G., Su W. P., Cheng K., Feng C. C., Zhou Y. M., Zhang L. L., and Wang T... 2019. Effects of diets with different energy and bile acids levels on growth performance and lipid metabolism in broilers. Poult. Sci. 98:887–895. doi: https://doi.org/ 10.3382/ps/pey434 [DOI] [PubMed] [Google Scholar]
- Geng, S., Zhang Y., Cao A., Liu Y., Di Y., Li J., Lou Q., and Zhang L... 2022. Effects of fat type and exogenous bile acids on growth performance, nutrient digestibility, lipid metabolism and breast muscle fatty acid composition in broiler chickens. Animals (Basel). 12:1258. doi: https://doi.org/ 10.3390/ani12101258 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gillard, J., Clerbaux L. A., Nachit M., Sempoux C., Staels B., Bindels L. B., Tailleux A., and Leclercq I. A... 2022. Bile acids contribute to the development of non-alcoholic steatohepatitis in mice. JHEP. Rep. 4:100387. doi: https://doi.org/ 10.1016/j.jhepr.2021.100387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Higuchi, N., Kato M., Tanaka M., Miyazaki M., Takao S., Kohjima M., Kotoh K., Enjoji M., Nakamuta M., and Takayanagi R... 2011. Effects of insulin resistance and hepatic lipid accumulation on hepatic mRNA expression levels of apoB, MTP and L-FABP in non-alcoholic fatty liver disease. Exp. Ther. Med. 2:1077–1081. doi: https://doi.org/ 10.3892/etm.2011.328 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu, Y., Sun Q., Liu J., Jia Y., Cai D., Idriss A. A., Omer N. A., and Zhao R... 2017. In ovo injection of betaine alleviates corticosterone-induced fatty liver in chickens through epigenetic modifications. Sci. Rep. 7:40251. doi: https://doi.org/ 10.1038/srep40251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu, Y., Sun Q., Hu Y., Hou Z., Zong Y., Omer N. A., Abobaker H., and Zhao R... 2018. Corticosterone-induced lipogenesis activation and lipophagy inhibition in chicken liver are alleviated by maternal betaine supplementation. J. Nutr. 148:316–325. doi: https://doi.org/ 10.1093/jn/nxx073 [DOI] [PubMed] [Google Scholar]
- Hu, D., Hou M., Song P., Chen Q., Feng Y., Wu X., and Ni Y... 2024. Dietary bile acids supplementation improves the growth performance and alleviates fatty liver in broilers fed a high-fat diet via improving the gut microbiota. Poult. Sci. 103:103270. doi: https://doi.org/ 10.1016/j.psj.2023.103270 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jafari, R., Almqvist H., Axelsson H., Ignatushchenko M., Lundback T., Nordlund P., and Martinez Molina D... 2014. The cellular thermal shift assay for evaluating drug target interactions in cells. Nat. Protoc. 9:2100–2122. doi: https://doi.org/ 10.1038/nprot.2014.138 [DOI] [PubMed] [Google Scholar]
- Jenson, M., Kilroy G., York D. A., and Braymer D... 1996. Abnormal regulation of hepatic glucocorticoid receptor mRNA and receptor protein distribution in the obese Zucker rat. Obes. Res. 4:133–143. doi: https://doi.org/ 10.1002/j.1550-8528.1996.tb00525.x [DOI] [PubMed] [Google Scholar]
- Jiao, T. Y., Ma Y. D., Guo X. Z., Ye Y. F., and Xie C... 2022. Bile acid and receptors: biology and drug discovery for nonalcoholic fatty liver disease. Acta Pharmacol. Sin. 43:1103–1119. doi: https://doi.org/ 10.1038/s41401-022-00880-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kadmiel, M., and Cidlowski J. A... 2013. Glucocorticoid receptor signaling in health and disease. Trends Pharmacol. Sci. 34:518–530. doi: https://doi.org/ 10.1016/j.tips.2013.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koorneef, L. L., van den Heuvel J. K., Kroon J., Boon M. R., t Hoen P. A. C., Hettne K. M., van de Velde N. M., Kolenbrander K. B., Streefland T. C. M., Mol I. M.,. et al. 2018. Selective glucocorticoid receptor modulation prevents and reverses nonalcoholic fatty liver disease in male mice. Endocrinology. 159:3925–3936. doi: https://doi.org/ 10.1210/en.2018-00671 [DOI] [PubMed] [Google Scholar]
- Kuang, J., Wang J., Li Y., Li M., Zhao M., Ge K., Zheng D., Cheung K. C. P., Liao B., Wang S.,. et al. 2023. Hyodeoxycholic acid alleviates non-alcoholic fatty liver disease through modulating the gut-liver axis. Cell Metab. 35:1752–1766.e8. doi: https://doi.org/ 10.1016/j.cmet.2023.07.011 [DOI] [PubMed] [Google Scholar]
- Lai, W., Huang W., Dong B., Cao A., Zhang W., Li J., Wu H., and Zhang L... 2018. Effects of dietary supplemental bile acids on performance, carcass characteristics, serum lipid metabolites and intestinal enzyme activities of broiler chickens. Poult. Sci. 97:196–202. doi: https://doi.org/ 10.3382/ps/pex288 [DOI] [PubMed] [Google Scholar]
- Li, L., Liu C., Mao W., Tumen B., and Li P... 2019. Taurochenodeoxycholic acid inhibited AP-1 activation via stimulating glucocorticoid receptor. Molecules. 24:4513. doi: https://doi.org/ 10.3390/molecules24244513 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, N., Liu D., Wang C., Yan G., Zhang S., Jiang Y., Shen M., Jia B., Xu L., Huang B.,. et al. 2023. Comparison study of protective effects of porcine bile acids and sheep bile acids against heat stress in chickens. J. Sci. Food Agric. 103:5687–5696. doi: https://doi.org/ 10.1002/jsfa.12643 [DOI] [PubMed] [Google Scholar]
- Lu, Q., Wen J., and Zhang H... 2007. Effect of chronic heat exposure on fat deposition and meat quality in two genetic types of chicken. Poult. Sci. 86:1059–1064. doi: https://doi.org/ 10.1093/ps/86.6.1059 [DOI] [PubMed] [Google Scholar]
- Lu, Z., He X. F., Ma B. B., Zhang L., Li J. L., Jiang Y., Zhou G. H., and Gao F... 2019. Increased fat synthesis and limited apolipoprotein B cause lipid accumulation in the liver of broiler chickens exposed to chronic heat stress. Poult. Sci. 98:3695–3704. doi: https://doi.org/ 10.3382/ps/pez056 [DOI] [PubMed] [Google Scholar]
- Lu, H., Lei X., Winkler R., John S., Kumar D., Li W., and Alnouti Y... 2022. Crosstalk of hepatocyte nuclear factor 4a and glucocorticoid receptor in the regulation of lipid metabolism in mice fed a high-fat-high-sugar diet. Lipids Health Dis. 21:46. doi: https://doi.org/ 10.1186/s12944-022-01654-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mueller, K. M., Kornfeld J. W., Friedbichler K., Blaas L., Egger G., Esterbauer H., Hasselblatt P., Schlederer M., Haindl S., Wagner K. U.,. et al. 2011. Impairment of hepatic growth hormone and glucocorticoid receptor signaling causes steatosis and hepatocellular carcinoma in mice. Hepatology. 54:1398–1409. doi: https://doi.org/ 10.1002/hep.24509 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Puri, P., Daita K., Joyce A., Mirshahi F., Santhekadur P. K., Cazanave S., Luketic V. A., Siddiqui M. S., Boyett S., Min H. K.,. et al. 2018. The presence and severity of nonalcoholic steatohepatitis is associated with specific changes in circulating bile acids. Hepatology. 67:534–548. doi: https://doi.org/ 10.1002/hep.29359 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Quagliarini, F., Makris K., Friano M. E., and Uhlenhaut N. H... 2023. EJE Prize 2023: genes on steroids-genomic control of hepatic metabolism by the glucocorticoid receptor. Eur. J. Endocrinol. 188:R111–R130. doi: https://doi.org/ 10.1093/ejendo/lvad048 [DOI] [PubMed] [Google Scholar]
- Rahimi, L., Rajpal A., and Ismail-Beigi F... 2020. Glucocorticoid-induced fatty liver disease. Diabetes Metab. Syndr. Obes. 13:1133–1145. doi: https://doi.org/ 10.2147/DMSO.S247379 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robert, O., Boujedidi H., Bigorgne A., Ferrere G., Voican C. S., Vettorazzi S., Tuckermann J. P., Bouchet-Delbos L., Tran T., Hemon P.,. et al. 2016. Decreased expression of the glucocorticoid receptor-GILZ pathway in Kupffer cells promotes liver inflammation in obese mice. J. Hepatol. 64:916–924. doi: https://doi.org/ 10.1016/j.jhep.2015.11.023 [DOI] [PubMed] [Google Scholar]
- Sola, S., Amaral J. D., Castro R. E., Ramalho R. M., Borralho P. M., Kren B. T., Tanaka H., Steer C. J., and Rodrigues C. M... 2005. Nuclear translocation of UDCA by the glucocorticoid receptor is required to reduce TGF-beta1-induced apoptosis in rat hepatocytes. Hepatology. 42:925–934. doi: https://doi.org/ 10.1002/hep.20870 [DOI] [PubMed] [Google Scholar]
- Tanaka, H., and Makino I... 1992. Ursodeoxycholic acid-dependent activation of the glucocorticoid receptor. Biochem. Biophys. Res. Commun. 188:942–948. doi: https://doi.org/ 10.1016/0006-291x(92)91146-h [DOI] [PubMed] [Google Scholar]
- Traussnigg, S., Schattenberg J. M., Demir M., Wiegand J., Geier A., Teuber G., Hofmann W. P., Kremer A. E., Spreda F., Kluwe J.,. et al. ; Austrian/German NAFLD-norUDCA Study Group. 2019. Norursodeoxycholic acid versus placebo in the treatment of non-alcoholic fatty liver disease: a double-blind, randomised, placebo-controlled, phase 2 dose-finding trial. Lancet Gastroenterol. Hepatol. 4:781–793. doi: https://doi.org/ 10.1016/S2468-1253(19)30184-0 [DOI] [PubMed] [Google Scholar]
- Van Bogaert, T., Vandevyver S., Dejager L., Van Hauwermeiren F., Pinheiro I., Petta I., Engblom D., Kleyman A., Schutz G., Tuckermann J.,. et al. 2011. Tumor necrosis factor inhibits glucocorticoid receptor function in mice: a strong signal toward lethal shock. J. Biol. Chem. 286:26555–26567. doi: https://doi.org/ 10.1074/jbc.M110.212365 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weitzel, C., Stark D., Kullmann F., Scholmerich J., Holstege A., and Falk W... 2005. Ursodeoxycholic acid induced activation of the glucocorticoid receptor in primary rat hepatocytes. Eur. J. Gastroenterol. Hepatol. 17:169–177. doi: https://doi.org/ 10.1097/00042737-200502000-00007 [DOI] [PubMed] [Google Scholar]
- Westerbacka, J., Kolak M., Kiviluoto T., Arkkila P., Siren J., Hamsten A., Fisher R. M., and Yki-Jarvinen H... 2007. Genes involved in fatty acid partitioning and binding, lipolysis, monocyte/macrophage recruitment, and inflammation are overexpressed in the human fatty liver of insulin-resistant subjects. Diabetes. 56:2759–2765. doi: https://doi.org/ 10.2337/db07-0156 [DOI] [PubMed] [Google Scholar]
- Wu, L., Liu X., Zhang A., Chen H., Zhao R., and Jia Y... 2023. Chronic corticosterone exposure disrupts hepatic and intestinal bile acid metabolism in chicken. Front. Vet. Sci. 10:1147024. doi: https://doi.org/ 10.3389/fvets.2023.1147024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu, Y., Zhang M., Meng F., Ren K., Li D., Luo X., and Hu Y... 2024. Betaine supplementation alleviates corticosterone-induced hepatic cholesterol accumulation through epigenetic modulation of HMGCR and CYP7A1 genes in laying hens. Poult. Sci. 103:103435. doi: https://doi.org/ 10.1016/j.psj.2024.103435 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, B., Huang S., Yang N., Cao A., Zhao L., Zhang J., Zhao G., and Ma Q... 2022. Porcine bile acids promote the utilization of fat and vitamin A under low-fat diets. Front. Nutr. 9:1005195. doi: https://doi.org/ 10.3389/fnut.2022.1005195 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin, C., Tang S., Liu L., Cao A., Xie J., and Zhang H... 2021a. Effects of bile acids on growth performance and lipid metabolism during chronic heat stress in broiler chickens. Animals (Basel). 11:630. doi: https://doi.org/ 10.3390/ani11030630 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin, C., Xia B., Tang S., Cao A., Liu L., Zhong R., Chen L., and Zhang H... 2021b. The effect of exogenous bile acids on antioxidant status and gut microbiota in heat-stressed broiler chickens. Front. Nutr. 8:747136. doi: https://doi.org/ 10.3389/fnut.2021.747136 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zaytsoff, S. J. M., Brown C. L. J., Montina T., Metz G. A. S., Abbott D. W., Uwiera R. R. E., and Inglis G. D... 2019. Corticosterone-mediated physiological stress modulates hepatic lipid metabolism, metabolite profiles, and systemic responses in chickens. Sci. Rep. 9:19225. doi: https://doi.org/ 10.1038/s41598-019-52267-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, Y., Chen H., Cong W., Zhang K., Jia Y., and Wu L... 2023. Chronic heat stress affects bile acid profile and gut microbiota in broilers. Int. J. Mol. Sci. 24:10238. doi: https://doi.org/ 10.3390/ijms241210238 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhong, J., He X., Gao X., Liu Q., Zhao Y., Hong Y., Zhu W., Yan J., Li Y., Li Y.,. et al. 2023. Hyodeoxycholic acid ameliorates nonalcoholic fatty liver disease by inhibiting RAN-mediated PPARalpha nucleus-cytoplasm shuttling. Nat. Commun. 14:5451. doi: https://doi.org/ 10.1038/s41467-023-41061-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are available from the corresponding author upon reasonable request.





