Mycobacterium tuberculosis Rv1048c affects the biological characteristics of recombinant Mycobacterium smegmatis

Abstract

Tuberculosis is a serious, infectious, zoonotic disease caused by Mycobacterium tuberculosis. Infections are transmitted in humans and livestock via aerosols. Rv1048c is a hypothetical unknown protein in the standard strain of Mycobacterium tuberculosis H37Rv. Rv1048c exists only in pathogenic Mycobacterium tuberculosis and is highly conserved; however its function is still unclear. The recombinant Mycobacterium smegmatis strain Ms_Rv1048c, with heterologous expression of the Rv1048c gene, was constructed by using the pMV261 expression plasmid. The biological characteristics of the recombinant bacteria were studied, such as their growth pattern, drug resistance, and virulence. Expression of Rv1048c significantly reduced the growth rate of the strain, enhanced its ability to form a biofilm, and reduced its tolerance to sodium dodecyl sulfate, H₂O₂, and various anti-tuberculosis drugs, and reduced the viability of infected RAW264.7 macrophages. Rv1048c also significantly reduced the level of early pro-inflammatory factors in infected RAW264.7 cells. Rv1048c protein is considered to be a virulence protein that might regulate the growth of M. tuberculosis strains. The results of the present study indicate that Rv1048c plays an important role in Mycobacterial infection.

Introduction

Tuberculosis (TB) is one of the major infectious diseases caused by Mycobacterium tuberculosis (MTB), which seriously endangers human health¹. According to the Global tuberculosis Report 2022 issued by the World Health Organization (WHO), about 10.6 million people worldwide suffered from tuberculosis in 2021². With the further development and use of anti-tuberculosis drugs, the incidence of tuberculosis tends to be stable year by year. However, since the early 1990s, the number of drug-resistant tuberculosis cases has increased year by year³. The WHO estimates that without proper monitoring and diagnosis, about 750,000 people will suffer from drug-resistant tuberculosis in the next 35 years⁴. This worldwide increase in the number of rifampicin-resistant and multidrug-resistant tuberculosis has made the prevention and treatment of tuberculosis increasingly complex. Tuberculosis engenders great challenges to human survival, and the prevention and treatment of this disease has become a global problem requiring an urgent solution^5,6. Thus, it is necessary to determine the pathogenic mechanism of tuberculosis, find new drug targets for tuberculosis, and create new vaccines to reduce the harm caused by this disease to the human population⁷.

Tuberculosis is a zoonotic infectious disease caused by MTB. Innate and adaptive immune cells play a crucial role in defending against MTB when the body is infected. Among them, macrophages, as the main target cells for MTB infection, are not only the first responders to infection, playing a key role in the inherent anti-tuberculosis immune response, but also serve as antigen presenting cells to initiate anti-tuberculosis specific immune responses. Thus. macrophages, as an important reservoir for MTB to inhabit and proliferate in the host, play a central role in the process of MTB infection^8,9. However, MTB has evolved multiple strategies to escape host immune killing and establish persistent infection within host cells through its unique immune mechanism^10–12. A better understanding of how MTB interacts with macrophages is essential to develop new therapeutic targets for tuberculosis.

According to the Uniprot website, Rv1048c is a hypothetical unknown protein in the standard strain of Mycobacterium tuberculosis H37Rv. Bioinformatic analysis revealed that the protein is conserved in pathogenic Mycobacteria and might be related to pathogenicity¹³. To investigate the effect of Rv1048c on the growth characteristics, drug resistance, and virulence of Mycobacterium smegmatis (Ms), this study constructed the recombinant strain Ms-Rv1048c. We observed that the expression of Rv1048c reduced the growth rate and biofilm formation ability of Ms, altered its tolerance to sodium dodecyl sulfate (SDS), H₂O₂, and various anti-tuberculosis drugs, and improved the strain’s ability to invade host cells. The research results contribute to our further understanding of the function of Mycobacterium tuberculosis genes.

Materials and methods

Bacterial strains and growth conditions

RAW264.7 (mouse monocyte macrophage leukemia cells) was purchased from Pronosai Life Sciences Co. (Wuhan, China). Mycobacterium smegmatis mc²-155 was grown in 7H9 medium (Difco, BD Biosciences, San Jose, CA, USA) supplemented with 10% Albumin Dextrose Catalase (ADC) (Difco, BD Biosciences) and 0.05% Tween 80 or in 7H10 medium supplemented with 10% Oleic Albumin Dextrose Catalase (OADC) (Difco, BD Biosciences) and 0.5% glycerol. Escherichia coli DH5α was grown in Luria–Bertani medium. Antibiotic addition concentrations were: kanamycin, 100 μg/mL; and thaumatin, 100 μg/mL. All cultures were incubated at 37 °C in an incubator. All strains, plasmids, and cells are preserved in the Economic Animal Disease Laboratory of Jilin Agricultural University (Table 1).

Table 1.

The strains, plasmids and cells used in this study.

Material	Source
Mycobacterium smegmatis mc2-155	Preserved in our laboratory
E. coli DH5α	Takara (Dalian, China)
pMV261 shuttle plasmid	Preserved in our laboratory
Recombinant Ms Ms-Rv1048c	Author’s construction
Recombinant Ms Ms-Vec	Constructed by the author
RAW264.7 (mouse monocyte macrophage leukemia cells)	Pronosai Life Sciences Co. (Wuhan, China)

Comparison of amino acid sequences

Through the Mycobrowser database (https://mycobrowser.epfl.ch/) obtain the amino acid sequence of Rv1048c. Obtain the amino acid homologous sequence of Rv1048c online through Blast in NCBI, perform sequence alignment using DNAMAN software, and use ESPrip 3.0 (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi) plot the protein comparison results.

Construction of the Ms_Rv1048c recombinant strain

According to the National Center for Biotechnology Information website, using the DNA of the MTB H37Rv standard strain, kindly provided by Professor Yu Lu from Jilin University, as a template, the target Rv1048c gene was amplified using upstream and downstream primers Rv1048c-FP and Rv1048c-RP, designed using Primer Premier 5 software (PREMIER Biosoft International, San Francisco, CA, USA; Table 2). We introduced EcoR I and Cla I enzyme cleavage sites at the 5ʹ end of the primers, and added a Myc tag at the C-terminus of the protein, with corresponding protective bases set. The pMV261 plasmid was double digested using EcoR I and Cla I endonucleases, and the Rv1048c gene (with the Myc tag encoding sequence) was ligated to the double digested pMV261 plasmid using T4 DNA ligase to construct the pMV261-Rv1048c recombinant shuttle expression plasmid. Electro transformation of pMV261-Rv1048c and pMV261 plasmids into mc²-155 receptor strains was used to construct recombinant Mycobacterium smegmatis Ms_Rv1048c and control strain Ms_ Vec.

Table 2.

List of primers used in this study.

Primer name	Sequence (5ʹ→3ʹ )
Rv1048c-FP	CCATCGATTGCAGAATTCATGCAAGCGTCGGATCGCACGT
Rv1048c-RP	GGAATTCCGAAGGGCCCTTTGGTCATCGCCTCGCGTAGAT
GAPDH-F	AGGTCGGTGTGAACGGATTTG
GAPDH-R	TGTAGACCATGTAGTTGAGGTCA
IL-1β-F	CCCAACTGGTACATCAGCACCTC
IL-1β-R	GACACGGATTCCATGGTGAAGTC
IL-6-F	CAAAGCCAGAGTCCTTCAGAG
IL-6-R	GCCACTCCTTCTGTGACTCC
TNF-α-F	TGGCCTCCCTCTCATCAG
TNF-α-R	ACTTGGTGGTTTGCTACGAC

Underlines indicate EcoR I and Cla I digestion sites, respectively; bolded and slanted parts are Myc tag sequences.

For Ms_Rv1048c and Ms_Vec, protein was induced by high temperature, extracted, and subjected to western blotting to evaluate whether Rv1048c could be heterologously expressed in Mycobacterium smegmatis.

Determination of the growth curve of recombinant strain Ms_Rv1048c

The OD₆₀₀ value of Vec was used to adjust that of the recombinant strain Ms_Rv1048c and Ms_Vec for consistency. Then, the bacterial solution was added to 50 mL of 7H9 liquid culture medium with a 1% inoculation, mixed, and cultivated at 37 ℃. The OD₆₀₀ value was determined every 4 h using a spectrophotometer. Each group was set as three replicates. A growth curve was drawn using the data of each group until there was no significant change in OD₆₀₀.

Determination of the colony morphology of the recombinant strain Ms_Rv1048c

Bacterial solutions of Ms_Rv1048c, Ms_Vec, and Ms strains (Mycobacterium smegmatis without plasmid) with consistent OD₆₀₀ values were diluted to 10^–10 using normal saline. Then, 10 μL of various dilutions were evenly coated on 7H10 solid plates and incubated in a 37 ℃ constant temperature incubator for 3–5 days until a single colony of significant size and shape appeared. The colonies were then photographed.

Determination of the biofilm formation ability of the recombinant strain Ms_Rv1048c

Bacterial solutions of Ms_Rv1048c, Ms_Vec and Ms strains with consistent OD₆₀₀ values were cultured in 24-well plates at 37 °C. After an obvious membrane was formed at the bottom of the well, the bacterial solution was removed, the well was washed with phosphate-buffered saline (PBS) three times, and the membrane was fixed in methanol for 15 min. The membrane was dried at room temperature, stained with 1% crystal violet for 5 min, and then washed with PBS three times. After drying in a constant temperature incubator at 37 °C, 33% glacial acetic acid was added. After incubation at 37 °C for 30 min, a microplate reader to detect the OD value of each well at 560 nm.

The inhibition zone of Ms_Rv1048c under SDS and H₂O₂ pressure

To evaluate the inhibition zone of SDS and H₂O₂, 20 μL of Ms_Rv1048c, Ms_Vec, and Ms strains were adjusted to a consistent OD₆₀₀ value and spread on a non-resistant 7H10 solid plate. Then, sterilized drug paper (Hangzhou Microbial Reagent Company, Hangzhou, China) was placed in the center of the plate, and 10 μL of different concentrations of SDS (1.25%, 2.5%, 5%) and H₂O₂ (1%, 2%) were dropped on the drug paper, and the plates were cultured at 37 °C for 2–3 days, after which the area of the inhibition zone was calculated.

Detection of the MIC values of anti-tuberculosis drugs against Ms_Rv1048c

Classical first-line anti-tuberculosis drugs and second-line anti-tuberculosis drugs were selected, and the minimum inhibitory concentration (MIC) values of Ms_Rv1048c, Ms_Vec, and Ms strains were determined using the MIC detection method of Mycobacterium smegmatis provided on the EUCAST website (broth microdilution method)¹⁴. The MIC results were further verified using the Kirby–Bauer method: The bacterial broths of Ms_Rv108c, Ms_Vec, and Ms strains were adjusted to a consistent OD₆₀₀ value and diluted to 10^–5. Then, 10 μL of each gradient was evenly inoculated on a 7H10 plate containing the specified drug concentration: isoniazid (INH), 5 μg/mL; pyrazinamide (PZA), 5 μg/mL; rifampicin (RFP), 1.22 μg/mL; ethambutol (EMB), 2.5 μg/mL; curreomycin (CPM), 1.22 μg/mL; and moxifloxacin (MFX) 0.15 μg/mL. The plates were incubated at 37 °C for 2–4 days to observe and photograph the ring of clearance.

Infection of macrophages by the recombinant strains

Ms_Rv1048c, Ms_Vec, and Ms strains were cultured to the logarithmic growth phase, and then adjusted to 2 × 10⁷ colony forming units (CFU)/mL. The bacterial suspensions were centrifuged and the precipitate was resuspended using cell culture medium (Dulbecco’s Modified Eagle’s Medium (DMEM)). Then, 2 mL of RAW264.7 macrophages diluted to 2 × 10⁵ cell/mL were coated on a six-well plate, the recombinant strains and Ms strain were added according to an MOI (Multiplicity of infection) = 10, and the cells were infected for 4 h. Each well was washed with PBS and added with DMEM medium (containing 10% fetal bovine serum (FBS) and 100 μg/mL hygromycin B). The specified time of incubation was used for subsequent experiments.

Invasion rate and intracellular survival rate of recombinant strains

The infected macrophages were incubated in a 5% CO₂ incubator for a specified time, washed with PBS 2–3 times, and then lysed using 0.025% SDS for 5–8 min. The lysate (100 μL) was removed and diluted to 10^–3 in a 96-well plate. Then, 30 μL was taken and coated on a 7H10 plate containing OADC, and cultured at 37 °C for 2–4 days. Using the number of infected bacteria as the standard value, the invasion rate was calculated and an intracellular survival curve was drawn.

Determination of the viability of cells infected with the recombinant strains

RAW264.7 cells (2 × 10⁵ cells/ml in 100 μL per well) were added to a 96-well plate, followed by infection with Ms_Rv1048c, Ms _Vec, and Ms strains. At specified time points, 10 μL of CCK-8 reagent was added to each well. After incubation in a CO₂ incubator for 1 h, the absorbance of each well at 450 nm was measured using a spectrophotometer.

Determination of total cholesterol content in cells infected with the recombinant strains

The infected macrophages were incubated in a CO₂ incubator and collected by centrifugation at 4 h, 8 h, and 12 h, respectively. The intracellular cholesterol content was measured according to the instructions of the tissue cell total cholesterol assay kit (Beyotime, Jiangsu, China).

Quantitative real-time reverse transcription PCR (RT-qPCR) to determine the expression of early pro-inflammatory factors

RNA was extracted from RAW264.7 cells infected with different strains using an RNA extraction kit (TIANGEN, Beijing, China) and reverse transcribed into cDNA using a reverse transcription kit (Takara, Dalian, China). The cDNA was used as a template for RT-qPCR in a real-time quantitative PCR instrument (Analytik Jena, Jena, Germany). The reaction included 35 cycles of denaturation at 95 °C for 5 s and annealing at 58 °C for 30 s. GAPDH (encoding glyceraldehyde-3-phosphate dehydrogenase) was used as an internal reference gene. The relative expression of cytokine genes was analyzed and calculated using the 2^-△△CT method¹⁵. All primers used for RT-qPCR are listed in Table 2.

Data collation and analysis

GraphPad Prism 7 (GraphPad Inc., La Jolla, CA, USA) was used to organize, plot, and statistically analyze the experimental data. Two-way analysis of variance (ANOVA) was used to test the significance of the data, with P < 0.05 being considered a significant difference. All of the data are presented as mean ± SEM. All tests were repeated three times (n = 3). In the figures: *P < 0.05, **P < 0.01, and ***P < 0.001.

Results

Comparison of amino acid sequences of Rv1048c

According to the Mycobrowser database, the full-length Rv1048c of Mycobacterium tuberculosis is 1116 bp, and the protein consists of 371 amino acids. The molecular formula is C₁₇₇₈H₂₈₂₁N₅₂₁O₅₂₅S₁₀, and the molecular weight unit (Mr) is 40,216.73. Gene multiple sequence alignment (Fig. 1) showed that the gene only exists in pathogenic mycobacteria and not in non pathogenic mycobacteria (such as Mycobacterium smegmatis).

Fig. 1.

Comparison of amino acid sequences of Rv1048c.

Rv1048c reduced the growth rate of Mycobacterium smegmatis, and enhanced its biofilm formation ability

To explore the biological properties of Rv1048c, recombinant Mycobacterium smegmatis Ms_Rv1048c and Ms_Vec were successfully constructed (Fig. 2). The growth curves of the strains showed that there was a significant growth difference between Ms_Rv1048c and Ms_Vec (Fig. 3A). Ms_Rv1048c grew more slowly than Ms_Vec, and took longer to reach the growth plateau. However, by observing the single colonies on the plate, it was found that there was no significant difference in the colony morphology among Ms_Rv1048c, Ms_Vec, and the negative control strain, and their sizes were roughly the same (Fig. 3B). The biofilm of Ms_Rv1048c was significantly more round, complete, and firm than that of Ms_Vec and the negative control strain (Fig. 3C). Compared with that of Ms_Vec, the content of crystal violet in Ms_Rv1048c was significantly increased; thus, the ability of Ms_Rv1048c to form biofilm was enhanced (Fig. 3D).

Fig. 2.

Heterologous expression of Mycobacterium tuberculosis Rv1048c protein in Mycobacterium smegmatis. (A) The Rv1048c gene (approximately 1116 bp) was amplified by PCR using specific primers. (B) Western blotting showing that the Myc-labeled Rv1048c protein in Ms_Rv1048c could be expressed. The original image can be found in the Supplementary Figures.

Fig. 3.

Growth characteristics of recombinant strain Ms_Rv1048c with Ms_Vec. (A) Growth curves of Ms_Rv1048c and Ms_Vec strains in Middlebrook 7H9 Broth supplemented with 0.05% Tween 80. (B) Colony morphology of Ms_Rv1048c, Ms_Vec, and Ms strains grown in Middlebrook 7H10 Agar medium supplemented with 0.5% glycerol. (C) Size and biofilm morphology of Ms_Rv1048c, Ms_Vec, and Ms strains cultured in 24-well plates. (D) Biofilm content of Ms_Rv1048c, Ms_Vec, and Ms strains up to 560 nm using crystalline violet staining.

Rv1048c changed the tolerance of recombinant strains to oxidants and various antimicrobial agents

We tested whether Rv1048c changed the sensitivity of the strain to SDS, H₂O₂, and antibiotics. The disk diffusion test showed that the inhibition zone of the recombinant strain Ms_Rv1048c was larger than that of the Ms_Vec strain (Fig. 4A) in the presence of 5% SDS, and the survival rate of Ms_Rv1048c was higher than that of the Ms_Vec and Ms strains (Fig. 4B) at 2.5% SDS and 5% SDS. Under the pressure of 1% or 2% H₂O₂, the inhibition zone of the recombinant strain Ms_Rv1048c was larger than that of the Ms_Vec strain, and the difference was significant (Fig. 4C). The results (Table 3) showed that compared with Ms_Vec and Ms, Ms_Rv1048c was more resistant to CPM and more sensitive to EMB and MFX, but had similar resistance to INH, RFP, and PZA. The MIC values were further verified using the Spot test (Fig. 4D), and similar results were observed.

Fig. 4.

Comparison of the drug resistance of recombinant strains Ms_Rv1048c and Ms_Vec with Ms strains. (A) After plate coating, 10 μL of 5% SDS was added dropwise to sterile paper. (B) Area of the inhibition circle formed in the plates, *P < 0.05, error line indicates the standard deviation. (C) After plate coating, 10 μL of H₂O₂ was added dropwise to sterile paper, area of the inhibition circle formed in the plates, *P < 0.05, error line indicates the standard deviation. (D) Dot seeding of 10 μL serial gradient dilutions of Ms_Rv1048c and Ms_Vec with Ms strain bacteriophage in plates containing the indicated concentrations of drugs to form circles of different concentrations. INH, Isoniazid; RFP, Rifampicin; PZA, Pyrazinamide; EMB, Ethambutol; CPM, Capreomycin; MFX., Moxifloxacin.

Table 3.

Determination of MIC value of recombinant strains.

Strain	MIC (μg/mL)
	INH	RFP	PZA	EMB	CPM	MFX
Ms_Rv1048c	10	5	5	2.5	5	0.5
Ms_Vec	10	5	10	20	1.22	5
Ms	5	10	5	40	1.22	2.5

MIC, minimum inhibitory concentration; INH, Isoniazid; RFP, Rifampicin; PZA, Pyrazinamide; EMB, Ethambutol; CPM, Capreomycin; MFX., Moxifloxacin.

Rv1048c reduced cell activity under the infection of the recombinant strains

To study whether Rv1048c has an effect on the ability of recombinant strains to infect RAW264.7 cells, the invasion rates of the different strains were determined. The results showed that the invasion rate of recombinant strain Ms_Rv1048c was lower than that of Ms_Vec and Ms strains at 6 h after infection (Fig. 5A), and the intracellular survival ability of the recombinant strain Ms_Rv1048c was lower than that of Ms_Vec (Fig. 5B). At 12 and 16 h of cell infection, the cell viability of the Ms_Rv1048c group was lower than that of the Ms_Vec group (Fig. 5C). The cholesterol content of Ms_Rv1048c was higher than that of Ms_Vec and Ms strains at 8 h (Fig. 5D). The mRNA expression levels of early pro-inflammatory secretory cytokines interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in macrophages infected with recombinant strain Ms_Rv1048c were lower than those in macrophages infected with Ms_Vec and Ms strains (Fig. 5E).

Fig. 5.

Activity of RAW264.7 cells infected with the recombinant strains Ms_Rv1048c, Ms_Vec, and Ms. (A) After infecting the cells for 0 h, 4 h, and 6 h, apply the lysed cell solution onto a 7H10 plate. The rate of intracellular invasion was calculated by the bacterial colony forming units (CFU) on the plates, using the value at 0 h as a control. (B) The cells were lysed at the specified time points and the survival curves were plotted using the 6 h data as 1. The intracellular survival of Ms_Rv1048c was compared with that of Ms_Vec and Ms. (C) Macrophages were infiltrated with Ms_Rv1048c, Ms_Vec, and Ms, respectively, and the cellular activity of the cells at specific time points was detected using a Cell Counting Kit-8 (CCK-8). (D) The cholesterol content of Ms_Rv1048c, Ms_Vec, and Ms. (E) Expression of IL-6, IL-1β, and TNF-α mRNA levels by fluorescence quantification.

Discussion

Mycobacterium tuberculosis is the main pathogen causing human tuberculosis. Its natural history can be traced back for 700,000 years and TB remains a serious health threat^16,17. There is a complex interaction between Mycobacterium tuberculosis and its host cells, during which it secretes multiple effector proteins into host cells, thereby interfering with cell signaling pathways, and promoting the survival of the pathogens in host cells¹⁸. The current view is that the power of Mycobacterium tuberculosis as an infectious factor lies in its ability to persist in the host. Therefore, to develop treatments for tuberculosis infection, it is essential to determine how Mycobacterium tuberculosis affects the physiology and metabolism between the bacteria and host cells^19–21. Therefore, we considered that it was necessary to further study the underlying molecular mechanism of Mycobacterium tuberculosis pathogenesis.

The standard strain of Mycobacterium tuberculosis H37Rv contains the Rv1048c gene, which is a functionally unidentified gene. Through the Mycobrowser database (https://mycobrowser.epfl.ch/genes/Rv1048c), it can be seen that only pathogenic mycobacteria contain the Rv1048c protein, indicating that the protein might be a virulence factor. Mycobacterium smegmatis is a non-pathogenic strain that is widely used as an expression host for the production of proteins from various mycobacterial species²². The structure and function of proteins from other pathogenic mycobacterial species can be studied by heterologously expressing them in Ms²³. The present research aimed to investigate the influence of Rv1048 on the biological characteristics of the Ms strain; therefore, a recombinant Mycobacterium smegmatis strain, Ms_Rv1048c, was constructed, which expresses the Rv1048c gene. Analysis of bacterial growth parameters showed that the expression of Rv1048c inhibited the growth of the recombinant strain and enhanced its ability to form a biofilm. This indicated that Rv1048c has a growth inhibitory effect on Mycobacterium smegmatis.

In the process of phagocytosis of invasive Mycobacterium tuberculosis by macrophages, the cells will exert various environmental pressures that are not conducive to the survival and reproduction of the bacteria, such as surface pressure and oxidative pressure, to resist MTB infection^24,25. Therefore, in vitro, we investigated whether the expressed target protein had an effect on the bacteria when they encountered a harsh environment during the infection process. The oxidation pressure caused by the imbalance of oxidants during the redox process will cause damage to biological systems²⁶. The oxidant H₂O₂ was used to simulate the oxidative stress produced by hydroxyl radicals in the Fenton reaction in vitro²⁷. The results showed that expression of the Rv1048c gene reduced the tolerance of the strain to H₂O₂ oxidative stress. The anionic detergent SDS mainly acts on the cell wall of bacteria and is often used to simulate surface active substances when Mycobacterium tuberculosis infects cells²⁸. By detecting the inhibition zone area of the strain under different concentrations of SDS pressure, it was found that the Rv1048c gene reduced the tolerance of the strain to the surfactant SDS.

To treat MTB, EMB and MFX are widely used as first-line and second-line anti-tuberculosis drugs. The integrity of the Mycobacterium tuberculosis cell wall is disrupted by EMV by inhibiting its biosynthesis, leading to bacterial death^29,30. Mycobacterium tuberculosis in macrophages suffer redox stress in response to MFX, thereby enhancing the anti-Mycobacterium tuberculosis effect³¹. The recombinant strain expressing Rv1048c showed significant sensitivity to both drugs. Therefore, we speculated that the protein might be involved in cell wall synthesis, and could be related to redox stress.

Mycobacterium tuberculosis is an intracellular parasitic bacterium that provides nutrients by converting intracellular cholesterol, lipids, and triglycerides into liposomes necessary for growth to achieve its survival in cells^32,33. Macrophages are the main target cells after infection, which can resist MTB infection through auto-immune regulation, such as autophagy^34–36. The results of the CCK-8 cell proliferation test after infection of the strain into mouse macrophages showed that the strain was in a proliferative state at 0–8 h and was accompanied by a series of cell reactions, reaching a peak at 8 h, at which time the cell activity was the strongest. After that, the difference remained obvious, and the cell activity of the recombinant strain group was lower than that of the control group at 12 h. Thereafter, the cell viability decreased, and the cell viability of the recombinant strain group remained different from that of the control strain group at 16 h. The results showed that the Rv1048c protein weakened the cell activity of RAW264.7 cells infected by the recombinant strain, and its cell invasion ability was stronger than that of the control. During cell infection with MTB, the cholesterol of the cell will be used as one of the main sources of energy to continuously resist and adapt to the host 's immune regulation and maintain its intracellular survival^37,38. Detecting the invasive ability of recombinant strains was achieved by measuring the cell cholesterol content. We observed that the cholesterol content of the recombinant strain group was higher than that of the control group, which further confirmed that the cells passively secreted a large amount of cholesterol to meet the needs of the strain for growth when resisting the invasion of the strain. These data showed that the Rv1048c gene of Mycobacterium tuberculosis enhanced the ability of the strain to infect cells, causing a large number of cells to die to achieve strain survival.

According to previous studies, macrophages secrete a variety of pro-inflammatory cytokines to clear pathogens³⁹, and MTB can affect the secretion of inflammatory molecules to increase its survival rate in cells^40,41. IL-6, TNF-α, and IL-1β are involved in the early pro-inflammatory response⁴². After RAW264.7 macrophages were infected with recombinant strain Ms_Rv1048c, the expression levels of IL-1β, IL-6 and TNF-α mRNA decreased obviously. This indicated that Rv1048c could inhibit the expression of cell factors in macrophages, thereby avoiding the host 's immune attack and improving the survival ability of the pathogens in cells, which is consistent with the function of pathogenic mycobacterial virulence genes.

Conclusion

By changing the biological characteristics of the recombinant strain, the Rv1048c protein improved its adaptability to an unfavorable growth environment, enhanced the ability of the strain to infect cells, and promoted its survival in the host cells. We speculated that Rv1048c is a virulence factor that might regulate bacterial growth. This study preliminarily explored the biological function of Mycobacterium tuberculosis Rv1048c and its relationship with macrophages; however, its mechanism of action is still unclear. Further in vitro and in vivo studies are needed to reveal pathways that inhibit cytokine expression, which would provide a basis for further study of Mycobacterium tuberculosis Rv1048c and its pathogenic mechanism (Supplementary Figures).

Abbreviations

TB

Tuberculosis;

MTB

Mycobacterium tuberculosis

Ms

Mycobacterium smegmatis

ADC

Albumin dextrose catalase

OADC

Oleic albumin dextrose catalase

PBS

Phosphate buffered saline

DMEM

Dulbecco’s Modified Eagle Medium

MIC

Minimum inhibitory concentration

RFP

Rifampicin

EMB

Ethambutol

CPM

Capreomycin

PZA

Pyrazinamide

MFX

Moxifloxacin

RT-qPCR

Real-time quantitative PCR

Author contributions

Danni Li: investigation, writing—original draft. Xinyue Liu: formal analysis, writing—original draft. Jinbiao Xu: conceptualization, methodology, software. Kun Shi: visualization, investigation. Jianming Li: data curation, writing—review and editing. Naichao Diao: resources, supervision. Ying Zong: software, validation. Fanli Zeng, Rui Du: funding acquisition, resources, writing—review and editing. All authors have reviewed and approved the final version of the manuscript, as well as the included data.

Funding

This research was financially supported by grants from the Key R&D Project of Science and Technology Development Plan of Jilin Provincial Department of Science and Technology (grant number 20230204010YY), the Funding Program for Innovative and Entrepreneurial Talents of Jilin Provincial Department of Human Resources and Social Security (grant number 2023DJ07), the Demonstration and Popularization of Key Agricultural Core Technologies of Jilin Provincial Department of Agriculture and Rural Affairs (grant number 202300801), and the Key R&D Project of Science and Technology Development Plan of Jilin Provincial Department of Science and Technology (grant number 20210204038YY).

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-81405-y.