Abstract
Lysine-specific histone demethylase 1A (KDM1A) has emerged as an attractive therapeutic target for treating various cancers, owing to its observed overexpression. However, its function in epithelial ovarian cancer (EOC) remains uncertain. The current study sought to investigate the function of KDM1A on malignant phenotypes of EOC cells as well as the underlying mechanism. Colony formation assay, cell counting kit-8, wound healing, Transwell assays, and TUNEL assays were performed to investigate the effects of KDM1A, Zinc finger protein 64 (ZFP64), and centromere protein L (CENPL) in vitro, while subcutaneous tumor formation models were established in nude mice to evaluate their roles in vivo. KDM1A, ZFP64, and CENPL were overexpressed in EOC tissues and cells. Knockdown of KDM1A, ZFP64, or CENPL inhibited the biological behavior of EOC cells. In addition, chromatin immunoprecipitation showed that KDM1A stimulated ZFP64 expression by removing the H3K9me2 mark from its promoter. Restoration of ZFP64 promoted EOC cell malignant phenotype in the presence of KDM1A knockdown. ZFP64 activated CENPL transcription. Reactivation of CENPL promoted the growth of EOC cells in vivo inhibited by knockdown of ZFP64. Collectively, KDM1A promoted EOC cell proliferation, migration, and invasion, and reduced apoptosis by activating the ZFP64/CENPL axis, which triggered EOC progression.
Supplementary Information
The online version contains supplementary material available at 10.1007/s10616-024-00671-w.
Keywords: Epithelial ovarian cancer, KDM1A, ZFP64, CENPL, H3K9me2
Introduction
Ovarian cancer (OC) is one of the most common causes of gynecologic cancer death in the female population around the world, and the outcomes are complicated because this malignancy is often diagnosed late and composed of several subtypes with distinct biological and molecular properties (Lheureux et al. 2019). Although systemic therapies have prolonged survival, there remains a need to further optimize treatments for advanced OC to improve long‐term survival and cure rates (Lumish et al. 2024). The vast majority of OC are of epithelial origin (90%) and accordingly referred to as epithelial OC (EOC) (Schoutrop et al. 2022). Studying the mechanism that regulates the progression of EOC will provide further insights into the prognosis and treatment of EOC.
Lysine-specific histone demethylase 1A (LSD1, also termed KDM1A) and Zinc finger protein 64 (ZFP64) are identified as two transcription (co)factors that are both differentially expressed and possess outstanding prognostic value in EOC in this study. Even though higher KDM1A expression has long been identified as a significant independent predictor of poor survival of EOC patients (p = 0.016) (Chen et al. 2015), its downstream targets in EOC have not been well described. KDM1A was first identified in 2004 as an epigenetic enzyme to removes the methyl groups from mono- and dimethyl lysine 4 or lysine 9 of histone 3 (H3K4me1/2 and H3K9me1/2) (Noce et al. 2023). Histone H3 modifications generally involve H3K4, H3K36, and H3K79 for transcriptionally active and H3K9 and H3K27 for repressed chromatin states (Piro et al. 2023). For instance, LINC00478 recruited KDM1A and downregulated the expression of matrix metalloprotein 9 by decreasing the H3K4me1 modification at its promoter in bladder cancer (Yang et al. 2022). Considering the co-existence of KDM1A and ZFP64 in our targets of interest and the association between ZFP64 overexpression and aggressive phenotypes in gastric cancer (Zhu et al. 2022), we wondered whether the overexpression of ZFP64 in EOC was related to KDM1A-removed H3K9me1/2 methylation. Moreover, ZFP64 increased the expression of programmed death-1 and cytotoxic T-lymphocyte-associated protein 4 by binding to their promoters and facilitated esophageal cancer tumorigenesis (Qiu and Deng 2022). By predicting the downstream targets that are differentially expressed in EOC, we identified centromere protein L (CENPL). Likewise, CENPL has been recently revealed as a transcriptional target by E2F8, and CENPL overexpression recovered at least in part the effect of E2F8 knockdown on DNA damage repair and chemotherapy sensitivity in breast cancer cells (Wang et al. 2024). Nevertheless, its function in EOC is scarcely understood, which highlights the novelty of this study. Based on bioinformatics analysis, we hypothesized that KDM1A-removed H3K9me2 methylation led to ZFP64 overexpression and the subsequent CENPL transcription activation in EOC.
Materials and methods
Tissue specimens
Tissue samples were obtained after patients’ written informed consent under the protocol approved by the Research Ethics Committee of Gaochun People’s Hospital Affiliated to Jiangsu Health Vocational College (Approval number: 2021-115-01; date: 5th, July 2021). Normal ovarian samples and EOC samples were collected from patients hospitalized in Gaochun People’s Hospital Affiliated to Jiangsu Health Vocational College from July 2021 to December 2023, and the samples were harvested within 30 min after surgical resection. Eight normal ovarian samples were obtained from patients who underwent adnexectomy for uterine fibroids or adenomyosis; 12 EOC samples were obtained from 6 patients with plasma ovarian carcinomas, 3 with mucinous carcinomas, and 3 with squamous cell carcinomas. None of the patients received radiotherapy before surgery. All diagnoses were confirmed by an expert examination of ovarian histopathology.
Microarray analysis
Other three pairs of EOC and normal ovary samples were collected for microarray analysis. Briefly, genomic DNA was first extracted from these tissues using the DNeasy Blood and Tissue Kit (69,581, Qiagen, Valencia, CA, USA), followed by hybridization of raw sequencing data with reference human genome (UCSC hg19) via Affymetrix Human Genome U133 Plus 2.0 Array. Scanning and processing of the arrays were then conducted using GeneChip Scanner 3000. The generated data were further analyzed and processed using GeneChip Operating Software 1.4 (Affymetrix, Santa Clara, CA, USA). GeneSifter v.4.0 software was used for the analysis of normalized microarray data.
Cell culture and transduction
The human EOC cell line OVCAR3 (CL-0178, Procell, Wuhan, Hubei, China) was cultured in Roswell Park Memorial Institute (RPMI)-1640 (PM150110, Procell) medium containing 20% FBS, 10 μg/mL Insulin (I2643, Merck KGaA, Darmstadt, Germany), and 1% penicillin/streptomycin. SKOV3 (CL-0215, Procell) was then cultured in McCoy's 5A (PM150710, Procell) medium containing 10% FBS and 1% penicillin/streptomycin. Immortalized normal ovarian epithelium (IOSE)-80 (iCell-h112, Cellverse Bioscience Technology Co., Ltd., Shanghai, China) were grown in RPMI-1640 medium containing 10% FBS and 1% penicillin/streptomycin. All the cells were cultured at 37 °C with 5% CO2.
The knockdown lentiviruses for KDM1A, ZFP64, and CENPL as well as the ZFP64 and CENPL overexpression lentiviral vectors were designed by Origene (Beijing, China). On the day of infection, lentiviruses diluted in 100 μL of Lentivirus Infection Enhancement Reagent Envirus-LV (30001-2-0.5, Engreen Biosystem Co., Ltd., Beijing, China) were used to infect the OVCAR3 and SKOV3 cells at MOI = 20 (Li et al. 2015). After 72 h, the cells were screened with puromycin for 4 days.
RNA isolation and quantification
Total RNA was extracted from EOC samples, normal ovarian samples, IOSE-80, and EOC cell lines with different treatments using TRIzol Reagent Total RNA Extraction Reagent (MF0403, Shanghai Maokang Biotechnology Co., Ltd., Shanghai, China) and reverse-transcribed into cDNA using the Surescript First-Strand cDNA Synthesis Kit (QP056, Guangzhou iGene Biotechnology Co., Ltd., Guangzhou, Guangdong, China). RT-qPCR was carried out using a SYBR Green Pro Taq HS Premixed qPCR Kit (AG11733, Accurate Biology, Changsha, Hunan, China) with the CFX96 Touch Deep Well Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was adopted as an internal control. Fold changes were calculated using the 2−ΔΔCt method (Livak and Schmittgen 2001). Table 1 shows the primer sequences used.
Table 1.
Primers for real-time PCR
| Gene (species) | Forward sequence (5ʹ–3ʹ) | Reverse sequence (5ʹ–3ʹ) |
|---|---|---|
| KDM1A (human) | TCAGGAGTTGGAAGCGAATCCC | GTTGAGAGAGGTGTGGCATTAGC |
|
ZFP64 (human) |
AGCTCACTGTCCACCTGCGATC | CTCGCACTTGAAAGGCTTCTCC |
| CENPL (human) | GGCTCAAGTGATCCTTCCACCT | AACCAGCCAGTCCACAGCACTT |
| GAPDH (human) | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
KDM1A lysine-specific histone demethylase 1A; ZFP64 zinc finger protein 64; CENPL centromere protein L; GAPDH glyceraldehyde-3-phosphate dehydrogenase
Immunohistochemistry (IHC)
EOC samples, normal ovarian samples, and xenograft tumor tissues were soaked in formalin, embedded in paraffin, and sectioned. After xylene dewaxing and hydration in a gradient ethanol solution, the above paraffin-embedded sections were boiled in sodium citrate buffer for 5 min for antigen retrieval. Subsequently, 3% hydrogen peroxide was used to inactivate peroxidase within the sections. The sections were sealed with 5% goat serum and incubated with anti-KDM1A (1:250, NBP3-18684, Novus Biological Inc., Littleton, CO, USA), anti-ZFP64 (1:50, ab204610, Abcam, Cambridge, UK), and anti-CENPL (1:100, LS-C804015, LifeSpan Biosciences, Seattle, WA, USA) at 4 °C overnight. Following incubation with goat anti-rabbit IgG (HRP) (1:1000, ab6721, Abcam) for 1 h, the sections were stained with a DAB Kit and counterstained with hematoxylin. Finally, the rate of positive staining of the sections was evaluated under the microscope (Farahzadi et al. 2023b).
Western blot analysis
IOSE-80 and differently treated EOC cell lines (OVCAR3 and SKOV3) were lysed and boiled for 10 min using an SDS lysis solution (P0013G, Beyotime Biotechnology Co., Ltd., Shanghai, China). The lysed protein sample was separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Following blocking with PBS containing 5% skim milk for 1 h, the membrane was incubated with the primary rabbit antibodies: KDM1A (1:4000, NBP3-18684, Novus Biological), ZFP64 (1:5000, NBP1-78187, Novus Biological), CENPL (1:1000, 246601, United States Biological, Salem, MA, USA), and GAPDH (1:1000, NB100-56875, Novus Biological) at 4 °C overnight and with the secondary antibodies goat anti-rabbit IgG (1:10,000, ab6721, Abcam) and goat anti-mouse IgG (1:2000, ab205719, Abcam) at room temperature for 1 h. The protein expression was measured with Clarity Western ECL Substrate (1705060S, Bio-Rad) (Farahzadi et al. 2023a).
Luciferase reporter assay
The promoter primer sequence for CENPL obtained from UCSC (https://genome.ucsc.edu/index.html) was inserted into the pCMV-Red Firefly Luc Vector (16156, Thermo Fisher Scientific Inc., Waltham, MA, USA). The constructed plasmids were co-transfected into OVCAR3 and SKOV3 cells with ZFP64-KD by Lipo6000 Transfection Reagent (C0526, Beyotime). The luciferase activity was measured after 48 h using a dual-luciferase reporter gene assay kit (RG027, Beyotime) (Hu et al. 2024).
Chromatin immunoprecipitation (ChIP) assays
Pierce Agar ChIP Kit (26156, Thermo Scientific) was used. OVCAR3 and SKOV3 cells treated with KDM1A-KD or ZFP64-KD were first fixed using formaldehyde and sonicated to break the chromatin into fragments for immunoprecipitation using anti-KDM1A (1:50, NBP3-18684, Novus Biological), anti-ZFP64 (1:10, NBP1-78187, Novus Biological), anti-H3K9me2 antibody (1:10, 39239, Active Motif., Carlsbad, CA, USA), or IgG (1:20, ab171870, Abcam). Immunoprecipitates and total chromatin were reverse cross-linked and recovered using column purification. The enrichment of ZFP64 or CENPL promoter was analyzed using and analyzed using qPCR (Liao et al. 2019).
Colony formation assay
Different treated OVCAR3 and SKOV3 cells were plated into 6-well plates at 500 cells/well. After 14 days, the cells were fixed using 4% methanol and stained with crystal violet. Colonies (more than 50 cells) were counted under a light microscope (Liu et al. 2018).
Wound healing assay
OVCAR3 and SKOV3 cells with different treatments were seeded into 6-well plates and pre-cultured until the cells had grown to over 90% confluence. The cells were incubated until confluence reached 80%, and the wound was scratched with a 10 µL pipette, followed by photographing (set to the 0 h moment). Serum-free medium was supplemented, and incubation was continued for 24 h. The wound healing rate was calculated as R = (W0 -W24) / W0 × 100%. W0 indicates the wound width at 0 h and W24 indicates the wound width at 24 h (Zhao et al. 2020).
Transwell assays
About 5 × 105 OVCAR3 and SKOV3 cells treated differently were resuspended in a medium without FBS. A complete medium plus 10% FBS was added to the basolateral chamber of the Transwell plate, and resuspended cells were added to the apical chamber precoated with Matrigel (356234, Corning, Corning, NY, USA) and incubated for 48 h. The invaded cells were fixed in methanol for 30 min, stained with 0.5% crystal violet for 30 min, observed, and counted (Ren et al. 2023).
Cell counting kit-8 (CCK-8)
OVCAR3 and SKOV3 cell lines stably infected with different lentiviruses were detached using trypsin and seeded into 96-well plates for culture at 3 × 103 cells/well. After 24 h of cell culture (set to 0 h), cell proliferation analysis was started using CCK-8 (C0005, TargetMol, Boston, MA, USA) according to the manufacturer’s instructions, with dropwise addition of CCK-8 assay at 0, 24, 48, 72, and 96 h. The growth curves were plotted based on the optical density value at 450 nm using the microplate reader after 1 h (Shen et al. 2022).
TUNEL assay
One-Step TUNEL Apoptosis Detection Kit (Red Fluorescent) (C1090, Beyotime) was used. The differently treated OVCAR3 and SKOV3 cell lines were grown for 24 h, followed by fixation of the cells using 4% paraformaldehyde and permeabilization using 0.1% sodium citrate and 0.1% Triton X. Paraffin-embedded sections of tumor tissues were dewaxed using xylene, hydrated using gradient ethanol, and incubated with 20 μg/mL of DNase-free proteinase K (ST533, Beyotime) for 30 min at 37 °C. After the incubation with 50 µL TUNEL assay solution at room temperature for 60 min, the nuclei were stained using DAPI (C1005, Beyotime). Fluorescence was observed by fluorescence microscope (Li et al. 2022).
Xenografted tumor growth
The experiment was performed according to the Guide for the Protection and Use of Laboratory Animals (Ministry of Science and Technology, China, 2006). The experimental protocol was approved by the Animal Ethics Protection Committee of Gaochun People’s Hospital Affiliated to Jiangsu Health Vocational College (Approval number: 2021-115-01). Twenty-four 4-week-old female BALB/c nude mice (401, Charles River Laboratories, Wilmington, MA, USA) were divided into four groups of six each: Scramble, ZFP64-KD, ZFP64-KD + OE-NC, and ZFP64-KD + CENPL-OE. Approximately 1 × 107 OVCAR3 cells were administrated subcutaneously into the left upper abdomen of 4-week-old female mice. The volume of the subcutaneous tumors was measured every week during the experiment using vernier calipers, and the volume was calculated as V = 0.5 × width2 × length. Three weeks later (the end point of the experiment), the mice were euthanized by intraperitoneal injection of 150 mg/kg sodium pentobarbital (Du et al. 2020). The removed tumors were fixed in 4% formalin solution for 8 h at 4 °C and immersed in 70% ethanol solution for 5 min, followed by ethanol dehydration with concentration gradients (80%, 90%, 95%, and anhydrous ethanol) for 4 h. The tissues were immersed in xylene for 30 min, embedded in paraffin, and cut into sections.
Statistical analysis
Experimental data were presented as mean ± SEM. Statistical significance was determined using Prism 8.0.2 (GraphPad Software, San Diego, CA, USA). Pairs of data groups were analyzed using an unpaired t-test. Statistical analysis was performed by Tukey-corrected one-way or two-way analysis of variance (ANOVA). A p-value < 0.05 was set as the threshold for statistical significance.
Results
KDM1A and ZFP64 expression is abnormally elevated in EOC
To reveal the molecular mechanisms underlying the development of EOC, we performed microarray sequencing analysis of the OC tumor and control tissues using Affymetrix Human Genome U133 Plus 2.0 Array (Supplementary Fig. 1A). From the public GEO database, the transcriptome differences between serous OC and surface epithelium scrapings from normal ovaries in the GSE36668 dataset (n = 4) (Supplementary Fig. 1B) and the transcriptome differences between primary ovarian tumors and matched normal fallopian tubes (n = 8) in the GSE137238 dataset were analyzed (Supplementary Fig. 1C). We downloaded human TF and human TF cofactors from Human TFDB (http://bioinfo.life.hust.edu.cn/HumanTFDB#!/). Subsequently, Hiplot Pro (https://hiplot.com.cn/home/index.html) was used to acquire the intersection among the microarray sequencing results, human TF and human TF cofactors, and differentially expressed genes (p. Value < 0.05) in the GSE36668 and GSE137238 datasets. Four candidates: ZFP64, HMGA2, KDM1A, and LDB2 were identified (Supplementary Fig. 1D). The progression-free survival (PFS) analysis using the Kaplan–Meier Plotter (https://kmplot.com/analysis/) found no significant difference in the survival of patients with high or low HMGA2 expression (Supplementary Fig. 1E), which was therefore excluded. LDB2 low-expressing OC patients had superior PFS, while its expression was downregulated in the microarray sequencing results (LogFC = − 0.6902822), GSE36668 (LogFC = − 0.6401481) and GSE137238 (LogFC = − 0.6401481) datasets (Supplementary Fig. 1F). As for the remaining two targets, significantly high expression of KDM1A [Microarray (LogFC = 0.5954454), GSE36668 (LogFC = 0.4281308), GSE137238 (LogFC = 0.594329)] and ZFP64 [Microarray (LogFC = 0.7537766), GSE36668 (LogFC = 1.2138859), GSE137238 (LogFC = 0.4803362)] predicted a poor prognosis for OC patients (Supplementary Fig. 1G, H). Therefore, KDM1A and ZFP64 were further analyzed.
To verify the expression of KDM1A and ZFP64 in EOC, the expression of the two was assessed in 12 EOC samples and 8 normal ovarian samples. RT-qPCR and western blot analysis showed that the expression of KDM1A and ZFP64 was higher in EOC samples than in normal ovarian samples (Fig. 1A, B). Consistent observations were found using IHC (Fig. 1C). These findings were reproduced in vitro in EOC cells relative to IOSE-80 cells, as revealed by RT-qPCR (Fig. 1D) and western blot analysis (Fig. 1E).
Fig. 1.
KDM1A and ZFP64 are significantly overexpressed in EOC tissues and cells. A The mRNA expression of KDM1A and ZFP64 in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using RT-qPCR analysis. B The protein expression of KDM1A and ZFP64 in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using western blot analysis. C The positivity of KDM1A and ZFP64 in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using IHC. D The mRNA expression of KDM1A and ZFP64 in human normal ovarian epithelial cells IOSE-80 and human EOC cell lines (OVCAR3 and SKOV3) was examined using RT-qPCR analysis. E The protein expression of KDM1A and ZFP64 in normal ovarian epithelial cells IOSE-80 and human EOC cell lines (OVCAR3 and SKOV3) was examined using western blot analysis. All in vitro experiments were performed in at least three biological replicates. The error bars indicate the SEM of the mean. Statistical significance was assessed using an unpaired t-test (ABC) or one-way ANOVA (DE). *p < 0.05 versus normal ovarian samples or IOSE-80 cells
Demethylase KDM1A mediates transcriptional activation of ZFP64
We found a strong positive correlation between KDM1A and ZFP64 in OC tumors by GEPIA (http://gepia.cancer-pku.cn/index.html) analysis (Fig. 2A). Later analysis in the UCSC ChIP-seq database revealed that KDM1A has a strong binding peak on the ZFP64 promoter fragment (Fig. 2B). In addition, we also observed a binding peak for H3K9me2 in the promoter region of ZFP64 (Fig. 2B). We, therefore, posited that KDM1A promoted the malignant progression of EOC by mediating the H3K9me2 demethylation modification of ZFP64.
Fig. 2.
KDM1A activates ZFP64 expression by removing H3K9me2 modification from its promoter. A Correlation between KDM1A and ZFP64 in OC tumor analyzed by GEPIA. B Analysis of the presence of KDM1A and H3K9me2 binding peaks in the ZFP64 promoter region by ChIP-seq in UCSC. C mRNA expression of KDM1A and ZFP64 in KDM1A-KD or ZFP64-KD-treated EOC cell lines were examined using RT-qPCR analysis. D KDM1A and ZFP64 protein expression in KDM1A-KD or ZFP64-KD-treated EOC cell lines were examined using western blot analysis. E The enrichment level of the ZFP64 promoter region by anti-H3K9me2 and anti-KDM1A in the EOC cell lines with KDM1A-KD was analyzed using ChIP-qPCR. All in vitro experiments were performed in at least three biological replicates. The error bars indicate the SEM of the mean. Statistical significance was assessed using two-way ANOVA analyses. *p < 0.05 versus the Scramble group
To investigate the potential interaction between KDM1A and ZFP64, we next infected EOC cell lines with KDM1A-KD or ZFP64-KD lentivirus and verified the infection effect by RT-qPCR. The transcript levels of KDM1A or ZFP64 were significantly downregulated in EOC cells under KDM1A-KD or ZFP64-KD lentiviral treatment (Fig. 2C). Western blot assay further revealed that silencing of KDM1A or ZFP64 significantly downregulated ZFP64 protein levels, whereas when ZFP64 expression was knocked down, it had no significant effect on KDM1A protein levels (Fig. 2D). In addition, ChIP-qPCR results showed that the H3K9me2 occupancy levels on the ZFP64 promoter were significantly upregulated when KDM1A was knocked down (Fig. 2E).
Overexpression of ZFP64 restores the malignant phenotype cells in the presence of KDM1A silencing
To analyze the oncogenic function of the KDM1A/ZFP64 axis in EOC cells, we first treated the OVCAR3 and SKOV3 cells with KDM1A-KD alone or in combination with ZFP64-OE lentivirus (OE-NC as control). Similarly, RT-qPCR showed that under ZFP64-OE lentivirus, only the mRNA expression of ZFP64 was reversed, while there was no significant effect on KDM1A expression (Fig. 3A). Downregulation of KDM1A significantly inhibited the colony-forming capacity of EOC cell lines, whereas upregulation of ZFP64 restored the cell proliferative capacity (Fig. 3B). Thereafter, wound healing and Transwell assays revealed impaired migration and invasion of EOC cell lines in the presence of KDM1A silencing, which was reversed by the upregulation of ZFP64 (Fig. 3C, D). TUNEL analysis showed that the knockdown of KDM1A increased the apoptosis rate of EOC cell lines, and as expected, restoration of ZFP64 reversed this trend, resulting in significant apoptosis resistance in EOC cells (Fig. 3E).
Fig. 3.
Overexpression of ZFP64 abates the anti-tumor effects of KDM1A-KD in vitro. A Transcript levels of KDM1A and ZFP64 in EOC cell lines treated with KDM1A-KD combined with OE-NC or ZFP64-OE were examined using RT-qPCR. B The proliferative capacity of EOC cell lines was examined using colony formation assays. C The migratory capacity of EOC cell lines was examined using a wound healing assay. D The invasive capacity of EOC cell lines was examined using Transwell assay. E The detection of apoptosis in EOC cell lines was examined using the TUNEL assay. All in vitro experiments were performed in at least three biological replicates. The error bars indicate the SEM of the mean. Statistical significance was assessed using a one-way (BCDE) or two-way ANOVA (A). *p < 0.05 versus the Scramble group, #p < 0.05 versus the KDM1A-KD + OE-NC group
CENPL, highly expressed in EOC, acts as a target of ZFP64
To investigate the downstream targets of ZFP64 in EOC, we downloaded the top 200 target genes of ZFP64 from hTFtarget (http://bioinfo.life.hust.edu.cn/hTFtarget/#!/) and obtained only 1 intersection with the differentially expressed genes (p. value < 0.05) in the microarray sequencing results, GSE36668 and GSE137238 datasets: CENPL (Microarray (LogFC = 1.0189401), GSE36668 (LogFC = 0.4633564), GSE137238 (LogFC = 1.0448122) (Supplementary Fig. 2A). A significant positive correlation between ZFP64 and CENPL in OC tumors was found by GEPIA correlation analysis (Supplementary Fig. 2B). ChIP-seq analysis at UCSC showed that ZFP64 had a significantly enhanced binding peak at the CENPL promoter (Supplementary Fig. 2C). Kaplan–Meier Plotter analysis revealed that patients with high CENPL expression had significantly poorer PFS (Supplementary Fig. 2D).
RT-qPCR, western blot, and IHC analyses demonstrated that the expression of CENPL was higher in EOC samples than in normal ovarian samples (Fig. 4A–C). Next, we infected EOC cell lines using an overexpression lentiviral vector for ZFP64, and RT-qPCR validation revealed that the mRNA expression of ZFP64 and CENPL was upregulated in the OE-ZFP64 group (Fig. 4D). Dual-luciferase assay revealed that luciferase activity was elevated in the OE-ZFP64 group compared with the OE-NC group, indicating that overexpression of ZFP64 activated the transcriptional activity of CENPL (Fig. 4E). ChIP assay showed that ZFP64 was enriched in the promoter region of CENPL (Fig. 4F).
Fig. 4.
CENPL transcription is manipulated by ZFP64 in EOC cells. A The mRNA expression of CENPL in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using RT-qPCR analysis. B The protein expression of CENPL in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using western blot analysis. C The positivity of CENPL in EOC samples (n = 12) and normal ovarian samples (n = 8) was examined using IHC analysis. D mRNA expression of ZFP64 and CENPL in OVCAR3 and SKOV3 cells infected with OE-NC or OE-ZFP64 was examined using RT-qPCR analysis. E Transcriptional regulation between ZFP64 and CENPL in OVCAR3 and SKOV3 cells was verified by dual-luciferase assay detection. F Enrichment of the CENPL promoter by anti-ZFP64 in OVCAR3 and SKOV3 cells was verified by ChIP. All in vitro experiments were performed in at least three biological replicates. The error bars indicate the SEM of the mean. Statistical significance was assessed using an unpaired t-test (ABCEF) or two-way ANOVA (D). *p < 0.05 versus normal ovarian samples or the OE-NC group
CENPL knockdown represses the malignant behavior of EOC cells
We next infected EOC cell lines with CENPL-KD or CENPL-OE lentiviruses (Scramble and NC-OE served as the negative controls, respectively). CENPL-KD treatment significantly downregulated the CENPL transcript levels in EOC cells, and conversely, CENPL-OE significantly upregulated the CENPL transcript levels (Fig. 5A). CCK-8 analysis showed that silencing of CEPNL significantly slowed down the proliferation of EOC cell lines, while overexpression of CENPL significantly promoted cell proliferation (Fig. 5B). Analysis of wound healing assays revealed that overexpression of CEPNL in OVCAR3 and SKOV3 cells increased the wound healing rate (Fig. 5C), invaded cell number (Fig. 5D), and apoptosis resistance (Fig. 5E). In contrast, CENPL knockdown significantly reduced the migration (Fig. 5C) and invasion (Fig. 5D) of OVCAR3 and SKOV3 cells, while inducing apoptosis (Fig. 5E).
Fig. 5.
CENPL plays as an oncogene in EOC cells. A The efficiency of CENPL-KD or CENPL-OE infection in OVCAR3 and SKOV3 cells was examined using RT-qPCR. B The proliferative capacity of EOC cell lines treated with CENPL-KD or CENPL-OE was examined using CCK-8. C The migratory ability of the EOC cell lines was examined using wound healing assays. D The invasive capacity of EOC cell lines was examined using Transwell assays. E The apoptosis rate of the EOC cell lines was examined using a TUNEL assay. All in vitro experiments were performed in at least three biological replicates. The error bars indicate the SEM of the mean. Statistical significance was assessed using a one-way (ACDE) or two-way ANOVA (B). *p < 0.05 versus the Scramble group, #p < 0.05 versus the NC-OE group
CENPL overexpression in EOC cells expedites tumor growth in the presence of ZFP64 knockdown
We administrated OVCAR3 cells infected with ZFP64-KD alone or combined with CENPL-OE into immunodeficient nude mice. During the 3 weeks, silencing of ZFP64 curbed the growth of OVCAR3 cells in nude mice, whereas increasing CENPL expression on this basis significantly promoted the growth of xenografts (Fig. 6A). After the euthanasia of nude mice, we found that tumor size and weight were significantly reduced in the ZFP64-KD group compared with nude mice in the Scramble group; and the restoration of CENPL reversed this trend (Fig. 6B). Histologically, we found that knockdown of ZFP64 significantly downregulated ZFP64 and CENPL expression in tumor tissues. In addition, reactivation of CENPL expression only reversed CENPL expression but had an insignificant effect on ZFP64 expression (Fig. 6C). Finally, TUNEL analysis showed that the knockdown of ZFP64 increased apoptosis in the tumor tissues, which was subsequently repressed by overexpression of CENPL (Fig. 6D).
Fig. 6.
CENPL fuels the tumor growth in vivo in the presence of ZFP64-KD. A Growth curves of the subcutaneous xenografts in each group. B Analysis of the tumor weight of the xenografts in each group. C IHC images of ZFP64 and CENPL from subcutaneous xenografts of nude mice. D The apoptosis rate of subcutaneous xenografts was examined using TUNEL. The error bars indicate the SEM of the mean (n = 6). Statistical significance was assessed using a one-way (BD) or two-way ANOVA (AC). *p < 0.05 versus the Scramble group, #p < 0.05 versus the ZFP64-KD + OE-NC group
Discussion
EOC, the largest subgroup (90%) of OC, is distinguished by histology, of which papillary serous is the most common (75%) (Moufarrij et al. 2019). Epigenetic alterations, including DNA methylation and histone modifications, are being characterized in OC and have been linked to tumor initiation, chemotherapy resistance, cancer stem cell survival, and tumor metastasis (Matei and Nephew 2020). In this study, we identified KDM1A as a histone methylation modifier in EOC that is related to the malignant aggressiveness of EOC cells in vitro. The underlying mechanism is that KDM1A can demethylate the dimethylated H3K9 of the ZFP64 promoter region, which causes the activation of ZFP64, which induces the CENPL transcription.
As summarized by Mamun et al., the dysfunction of KDM1A contributed to dismal prognosis, poor patient survival, drug resistance, and immunosuppression, making it a potential epigenetic target for cancer therapy (Mamun et al. 2023). Antona et al. also presented that KDM1A overexpression was related to a worse prognosis in colorectal cancer, and KDM1A silencing contributed to remarkably decreased self-renewal potential, as well as migration and invasion in colorectal cancer stem cell (Antona et al. 2023). More recently, the silencing of KDM1A also inhibited cell growth and metastasis in breast cancer (Luo et al. 2024). RNA-seq and DIA mass spectrometry analyses conducted by Venkata et al. showed that KDM1A knockout enhanced estrogen receptor beta signaling and that genes altered by KDM1A knockout were related to apoptosis and cell cycle (Venkata et al. 2023). Salinomycin, a monocarboxylic polyether antibiotic isolated from Streptomyces albicans, was found to repress tumor growth formed by bladder cancer cells by inhibiting KDM1A expression and inducing cell apoptosis, while treatment with the KDM1A overexpression plasmid produced the opposite effects (Yuan et al. 2022). More relevantly, inhibition of KDM1A impaired the migration and invasion of OC cells, whereas overexpression of KDM1A enhanced the cell migration and invasion of OC cells (Li et al. 2016). These findings were consistent with our observation that silencing of KDM1A repressed colony formation, migration, and invasion, and enhanced apoptosis of EOC cells.
Mechanistically, KDM1A downregulated the expression of adenomatous polyposis coli protein 2 by demethylating H3K4me1/2 of its promoter region in thyroid cancer (Zhang et al. 2022). As mentioned above, the H3K4 marks are active signals, while H3K9 are repressive. Given the observed binding peaks between KDM1A and H3K9me2 near the ZFP64 promoter, we hypothesized that it was the H3K9me2 marks that were removed by KDM1A, leaving the overexpression of ZFP64 in EOC cells. ZFP64 was upregulated in liver metastasis tissues of human colorectal carcinoma (Li et al. 2010). In addition, ZFP64 expression was higher in lung adenocarcinoma tissue and related to poor prognosis, and lung adenocarcinoma cell viability, migration, and expressions of Vimentin were upregulated yet cell percentage in G0/G1 phase and E-cadherin expression were downregulated by overexpression of ZFP64 (Jiang et al. 2021). ZFP64 was responsible for the migration, invasion, proliferation, anti-apoptosis, and epithelial-mesenchymal transition of gallbladder cancer cells (He et al. 2023). To the best of our knowledge, the role of ZFP64 in EOC remains to be unclear. In this study, we also observed that the proliferative, migratory, and invasive potentials of EOC cells were enhanced by ZFP64 overexpression in the presence of KDM1A knockdown.
ZFP64 has been identified as an essential transcription factor in MLL-rearranged leukemia, and the critical function of ZFP64 in leukemia is to maintain MLL expression via binding to the MLL promoter (Lu et al. 2018). We, therefore, sought to decipher the downstream target of ZFP64 in EOC as well. One and only one target was screened out: CENPL. It is a component of the centromere, a part of the chromosome critical for proper segregation during cell division, and CENPL is involved in the assembly of kinetochore proteins, which are necessary for the correct attachment of chromosomes to the spindle fibers during mitosis and meiosis (Perpelescu and Fukagawa 2011). CENPL had a high expression in hepatocellular carcinoma samples, and increased CENPL may be an independent prognostic factor of worse overall survival, disease-specific survival, disease-free interval, and progression-free interval (Zeng et al. 2021). A similar association was also found in lung adenocarcinoma (Xu et al. 2024). In addition, high expression of CENPL was associated with lymph node metastasis and higher Scarff Bloom & Richardson grade in patients with breast cancer (Yin et al. 2021). CENPL has been associated with cell proliferation and cell cycle under the condition of both lung adenocarcinoma and breast cancer (Feng et al. 2022; Gui et al. 2023). The upregulation of CENPL in hepatocellular carcinoma regulated tumor proliferation and glycolytic processes (He et al. 2024). Nevertheless, its function in EOC has not been established. Here, we further provided evidence that the anti-tumor properties of ZFP64 knockdown in vivo were overturned by CENPL overexpression, substantiating that the effects of ZFP64 on EOC cells were elicited through its target CENPL.
Conclusion
In summary, the findings of our study reveal that KDM1A, which may serve as a prognostic factor for EOC patients, can regulate the malignant phenotype of EOC cells. Demethylase KDM1A induces the level of ZFP64 expression by removing the H3K9me2 marks from its promoter, thereby transcriptionally activating CENPL. As a consequence, our evidence here might provide a novel perspective for the prognosis and treatment of EOC.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We thank to Nanjing Health Commission (Grant/Award Number: YKK21220) and Jiangsu Health Vocational College university-level scientific research project (Number: YJXT-G202406) for the funding support.
Author contributions
All authors contributed to the study conception and design. JW performed review and revision of the paper. XJF performed development of methodology and writing. YJX provided acquisition, analysis and interpretation of data. MQD provided interpretation of statistical analysis. LXZ and MYW supervised the study. All authors read and approved the final paper.
Funding
This work was supported by the Nanjing Health Commission (Grant/Award Number: YKK21220) and Jiangsu Health Vocational College university-level scientific research project (Number: YJXT-G202406).
Data availability
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Declarations
Conflict of interest
The authors declare no competing interests.
Ethical approval
Tissue samples were obtained after patients’ written informed consent under the protocol approved by the Research Ethics Committee of Gaochun People’s Hospital Affiliated to Jiangsu Health Vocational College and were performed according to the principles of the Declaration of Helsinki. The experiment was performed according to the Guide for the Protection and Use of Laboratory Animals (Ministry of Science and Technology, China, 2006). The experimental protocol was approved by the Animal Ethics Protection Committee of Gaochun People’s Hospital Affiliated to Jiangsu Health Vocational College.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- Antona A, Leo G, Favero F et al (2023) Targeting lysine-specific demethylase 1 (KDM1A/LSD1) impairs colorectal cancer tumorigenesis by affecting cancer cells stemness, motility, and differentiation. Cell Death Discov 9:201. 10.1038/s41420-023-01502-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen C, Ge J, Lu Q et al (2015) Expression of Lysine-specific demethylase 1 in human epithelial ovarian cancer. J Ovarian Res 8:28. 10.1186/s13048-015-0155-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du L et al (2020) Downregulation of the ubiquitin ligase KBTBD8 prevented epithelial ovarian cancer progression. Mol Med 26:96. 10.1186/s10020-020-00226-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Farahzadi R, Fathi E, Mesbah-Namin SA, Vietor I (2023a) Granulocyte differentiation of rat bone marrow resident C-kit(+) hematopoietic stem cells induced by mesenchymal stem cells could be considered as new option in cell-based therapy. Regen Ther 23:94–101. 10.1016/j.reth.2023.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Farahzadi R, Valipour B, Anakok OF, Fathi E, Montazersaheb S (2023b) The effects of encapsulation on NK cell differentiation potency of C-kit+ hematopoietic stem cells via identifying cytokine profiles. Transpl Immunol 77:101797. 10.1016/j.trim.2023.101797 [DOI] [PubMed] [Google Scholar]
- Feng Z, Chen Y, Cai C et al (2022) Pan-cancer and single-cell analysis reveals CENPL as a cancer prognosis and immune infiltration-related biomarker. Front Immunol 13:916594. 10.3389/fimmu.2022.916594 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gui Z, Tian Y, Liu S et al (2023) Highly expressed CENPL is correlated with breast cancer cell proliferation and immune infiltration. Front Oncol 13:1046774. 10.3389/fonc.2023.1046774 [DOI] [PMC free article] [PubMed] [Google Scholar]
- He Z, Zhong Y, Hu H, Li F (2023) ZFP64 promotes gallbladder cancer progression through recruiting HDAC1 to activate NOTCH1 signaling pathway. Cancers (Basel). 10.3390/cancers15184508 [DOI] [PMC free article] [PubMed] [Google Scholar]
- He K, Xie M, Hong W et al (2024) CENPL accelerates cell proliferation, cell cycle, apoptosis, and glycolysis via the MEK1/2-ERK1/2 pathway in hepatocellular carcinoma. Int J Biochem Cell Biol 166:106481. 10.1016/j.biocel.2023.106481 [DOI] [PubMed] [Google Scholar]
- Hu C et al (2024) FOXA2-initiated transcriptional activation of INHBA induced by methylmalonic acid promotes pancreatic neuroendocrine neoplasm progression. Cell Mol Life Sci 81:50. 10.1007/s00018-023-05084-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang J, Zhang J, Fu K, Zhang T (2021) Function and mechanism exploration of zinc finger protein 64 in lung adenocarcinoma cell growth and metastasis. J Recept Signal Transduct Res 41:457–465. 10.1080/10799893.2020.1825490 [DOI] [PubMed] [Google Scholar]
- Lheureux S, Braunstein M, Oza AM (2019) Epithelial ovarian cancer: evolution of management in the era of precision medicine. CA Cancer J Clin 69:280–304. 10.3322/caac.21559 [DOI] [PubMed] [Google Scholar]
- Li SY, An P, Cai HY et al (2010) Proteomic analysis of differentially expressed proteins involving in liver metastasis of human colorectal carcinoma. Hepatobiliary Pancreat Dis Int 9:149–153 [PubMed] [Google Scholar]
- Li X et al (2015) VEGF111b, a C-terminal splice variant of VEGF-A and induced by mitomycin C, inhibits ovarian cancer growth. J Transl Med 13:164. 10.1186/s12967-015-0522-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Wan X, Wei Y et al (2016) LSD1-mediated epigenetic modification contributes to ovarian cancer cell migration and invasion. Oncol Rep 35:3586–3592. 10.3892/or.2016.4729 [DOI] [PubMed] [Google Scholar]
- Li HW et al (2022) GALNT14 regulates ferroptosis and apoptosis of ovarian cancer through the EGFR/mTOR pathway. Future Oncol 18:149–161. 10.2217/fon-2021-0883 [DOI] [PubMed] [Google Scholar]
- Liao L et al (2019) High affinity binding of H3K14ac through collaboration of bromodomains 2, 4 and 5 is critical for the molecular and tumor suppressor functions of PBRM1. Mol Oncol 13:811–828. 10.1002/1878-0261.12434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu W, Zhang J, Gan X et al (2018) LGR5 promotes epithelial ovarian cancer proliferation, metastasis, and epithelial-mesenchymal transition through the Notch1 signaling pathway. Cancer Med 7:3132–3142. 10.1002/cam4.1485 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- Lu B, Klingbeil O, Tarumoto Y et al (2018) A transcription factor addiction in leukemia imposed by the MLL promoter sequence. Cancer Cell 34:970–981. 10.1016/j.ccell.2018.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lumish MA, Kohn EC, Tew WP (2024) Top advances of the year: ovarian cancer. Cancer 130:837–845. 10.1002/cncr.35135 [DOI] [PubMed] [Google Scholar]
- Luo N, Zhang K, Li X, Hu Y, Guo L (2024) Tanshinone IIA destabilizes SLC7A11 by regulating PIAS4-mediated SUMOylation of SLC7A11 through KDM1A, and promotes ferroptosis in breast cancer. J Adv Res. 10.1016/j.jare.2024.04.009 [DOI] [PubMed] [Google Scholar]
- Mamun MAA, Zhang Y, Zhao JY et al (2023) LSD1: an emerging face in altering the tumor microenvironment and enhancing immune checkpoint therapy. J Biomed Sci 30:60. 10.1186/s12929-023-00952-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matei D, Nephew KP (2020) Epigenetic attire in ovarian cancer: the emperor’s new clothes. Cancer Res 80:3775–3785. 10.1158/0008-5472.CAN-19-3837 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moufarrij S, Dandapani M, Arthofer E et al (2019) Epigenetic therapy for ovarian cancer: promise and progress. Clin Epigenetics 11:7. 10.1186/s13148-018-0602-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Noce B, Di Bello E, Fioravanti R, Mai A (2023) LSD1 inhibitors for cancer treatment: focus on multi-target agents and compounds in clinical trials. Front Pharmacol 14:1120911. 10.3389/fphar.2023.1120911 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perpelescu M, Fukagawa T (2011) The ABCs of CENPs. Chromosoma 120:425–446. 10.1007/s00412-011-0330-0 [DOI] [PubMed] [Google Scholar]
- Piro MC, Gasperi V, De Stefano A et al (2023) In vivo identification of H3K9me2/H3K79me3 as an epigenetic barrier to carcinogenesis. Int J Mol Sci 2:4. 10.3390/ijms241512158 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qiu G, Deng Y (2022) ZFP64 transcriptionally activates PD-1 and CTLA-4 and plays an oncogenic role in esophageal cancer. Biochem Biophys Res Commun 622:72–78. 10.1016/j.bbrc.2022.06.011 [DOI] [PubMed] [Google Scholar]
- Ren S, Xiao Y, Yang L, Hu Y (2023) RNA m6A methyltransferase METTL14 promotes the procession of non-small cell lung cancer by targeted CSF1R. Thorac Cancer 14:254–266. 10.1111/1759-7714.14741 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schoutrop E, Moyano-Galceran L, Lheureux S et al (2022) Molecular, cellular and systemic aspects of epithelial ovarian cancer and its tumor microenvironment. Semin Cancer Biol 86:207–223. 10.1016/j.semcancer.2022.03.027 [DOI] [PubMed] [Google Scholar]
- Shen Z et al (2022) PLAA suppresses ovarian cancer metastasis via METTL3-mediated m(6)A modification of TRPC3 mRNA. Oncogene 41:4145–4158. 10.1038/s41388-022-02411-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venkata PP, Jayamohan S, He Y et al (2023) Pharmacological inhibition of KDM1A/LSD1 enhances estrogen receptor beta-mediated tumor suppression in ovarian cancer. Cancer Lett 575:216383. 10.1016/j.canlet.2023.216383 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang S, Xia Y, Sun Y et al (2024) E2F8-CENPL pathway contributes to homologous recombination repair and chemoresistance in breast cancer. Cell Signal 118:111151. 10.1016/j.cellsig.2024.111151 [DOI] [PubMed] [Google Scholar]
- Xu R et al (2024) Role of CENPL, DARS2, and PAICS in determining the prognosis of patients with lung adenocarcinoma. Transl Lung Cancer Res 13:2729–2745 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang HJ, Liu T, Xiong Y (2022) Anti-cancer effect of LINC00478 in bladder cancer correlates with KDM1A-dependent MMP9 demethylation. Cell Death Discov 8:242. 10.1038/s41420-022-00956-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin J, Lin C, Jiang M et al (2021) CENPL, ISG20L2, LSM4, MRPL3 are four novel hub genes and may serve as diagnostic and prognostic markers in breast cancer. Sci Rep 11:15610. 10.1038/s41598-021-95068-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan H, Li Y, Zou Y, Cai C, Shi X, Su Y (2022) Salinomycin suppresses T24 cells by regulating KDM1A and the unfolded protein response pathway. Cytotechnology 74:579–590. 10.1007/s10616-022-00546-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng Z, Jiang X, Pan Z et al (2021) Highly expressed centromere protein L indicates adverse survival and associates with immune infiltration in hepatocellular carcinoma. Aging (Albany NY) 13:22802–22829 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang W, Ruan X, Li Y et al (2022) KDM1A promotes thyroid cancer progression and maintains stemness through the Wnt/beta-catenin signaling pathway. Theranostics 12:1500–1517. 10.7150/thno.66142 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao Y, He M, Cui L et al (2020) Chemotherapy exacerbates ovarian cancer cell migration and cancer stem cell-like characteristics through GLI1. Br J Cancer 122:1638–1648. 10.1038/s41416-020-0825-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu M, Zhang P, Yu S et al (2022) Targeting ZFP64/GAL-1 axis promotes therapeutic effect of nab-paclitaxel and reverses immunosuppressive microenvironment in gastric cancer. J Exp Clin Cancer Res 41:14. 10.1186/s13046-021-02224-x [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.






