Skip to main content
Virulence logoLink to Virulence
. 2024 Nov 29;15(1):2435372. doi: 10.1080/21505594.2024.2435372

Blocking virus infection with BacMam virus delivery bovine interferon-α gene

Zhenying Fan a, Yajuan Hou a, Yue Liu a, Jingjing Zhao a, Yixiao Wang a, Chun Fu a, Shuangfeng Wang a, Junwei Wang a, Yongli Guo b,✉, Mingchun Gao a,✉
PMCID: PMC11610550  PMID: 39611624

ABSTRACT

Interferon-αs (IFN-αs) are crucial cytokines for inducing protective antiviral responses. The baculovirus-mediated gene transduction of mammalian cells (BacMam) is an efficient delivery tool for recombinant protein expression in mammalian cells. This study focuses on the delivery of bovine IFN-α (BoIFNα) using the BacMam system. A recombinant pACEMam1-BoIFNα bacmid was constructed, and a recombinant BacMam-BoIFNα virus was obtained. After transducing HEK293T cells with this virus, BoIFNα protein was successfully secreted into the cell supernatant, displaying antiviral activities against VSV, BPIV3, BEV, and BVDV in bovine-derived cells. Additionally, the BacMam-BoIFNα virus inhibited the replication of these viruses in MDBK cells, induced the transcription of ISGs, and the expression of M × 1 in both MDBK and BT cells. These induction effects were significantly reduced following treatment with a JAK1 inhibitor, suggesting that the BacMam-BoIFNα virus exerts antiviral activity in MDBK cells through JAK-STAT signaling pathway. Furthermore, the study found that the BacMam-BoIFNα virus significantly inhibited the replication of BPIV3 in the lung and trachea of mice. Overall, this study demonstrates that the BacMam-BoIFNα virus have antivirus activities both in vitro and in vivo, signaling through JAK-STAT pathway, and provides an efficient interferon gene delivery tool for combating bovine viral infections.

KEYWORDS: Bovine interferon-α, BacMam system, antiviral activity, JAK-STAT signaling pathway, inhibition of virus replication

Introduction

Type I interferons (IFNs) are key components of innate immunity, serving as the first line of defense against viral infections [1]. All type I IFNs (α, β, ω, κ, ε, δ, and τ subtypes) bind to specific cell surface receptors and initiate signaling through the JAK-STAT pathway [1,2]. During this process, IFNs stimulate the expression of hundreds of downstream IFN-stimulated genes (ISGs) and promote the production of antiviral proteins [1,3]. ISGs exhibit a broad spectrum of activities, many of which control viral, bacterial, and parasitic infections by directly targeting pathways and functions required during pathogen life cycles [4,5]. IFN-αs are cytokines with multiple biologic effects, including activities in cells of the immune system, which are crucial for eliciting protective antiviral responses [6]. Human IFN-α has been extensively employed in treating various cancer and viral diseases [7–9]. Porcine IFN-α has been used as an adjuvant for DNA vaccines and as a therapeutic agent against viral infections in animals [10]. Bovine IFN-α has been expressed in yeast (Pichia pastoris) and bacteria, demonstrating antiviral efficiency in MDBK cells [11–13]. Additionally, co-delivery with bovine IFN-α has been shown to enhance the efficiency and immunogenicity of the FMDV DNA vaccine in guinea pigs [14].

The baculovirus expression vector system (BEVS) platform has emerged as a prominent method for producing viral vaccines and gene therapy vectors, offering advantages such as rapid manufacturing, flexible product design, inherent safety, and scalability [15,16]. With the discovery of baculovirus’s efficiency in transducing mammalian cells, the applications of baculovirus have been greatly expanded, nine BEVS-derived products have been approved-four for human use and five for veterinary use [15]. The BacMam system utilizes modified baculoviruses containing mammalian expression cassettes for gene delivery and expression in mammalian cells. This system combines the benefits of viral transient expression with ease of generation and broad cell tropism, making it suitable for large-scale recombinant protein production, high-throughput screening, and the delivery of large genes [17,18]. Functional G-protein-coupled receptors [19], nuclear receptors [20–22], ATP-binding cassette transporter [23], and virus-like particles [24] have all been successfully expressed with the BacMam system. Additionally, enhanced green fluorescent protein (EGFP) was successfully expressed in mammalian cells using silkworm baculovirus with the BacMam system [25]. The advantages of the BacMam system include ease of production, reproducible and titratable expression, simultaneous multiple-gene delivery, and versatility in host cell transduction [18,26]. Moreover, BacMam virus do not elicit harmful immune response nor replicate in mammalian cells, making them a safer alternative for gene transduction compared to other expression system [27].

In this study, the BacMam system was employed for the delivery and expression of bovine IFN-α. A recombinant pACEMam1-BoIFNα bacmid was constructed, leading to the generation of the BacMam-BoIFNα virus. After transducing HEK293T cells with BacMam-BoIFNα virus, BoIFNα was secreted into the cells culture supernatant, exhibiting antiviral activities against VSV, BPIV3, BEV, and BVDV in bovine-derived cells. Furthermore, the protective effects of BacMam-BoIFNα virus transduction in MDBK cells against these viruses were medicated through the JAK-STAT pathway by inducing ISGs expression. Additionally, this study demonstrated that the recombinant BacMam-BoIFNα virus could inhibit the replication of BPIV3 in the lung and trachea tissues of mice, suggesting that BacMam virus-mediated delivery of the bovine interferon-α gene offers effective antiviral effects in vivo.

Materials and methods

Animals and ethical statement

Wild type C57BL/6 mice used in this experiment were purchased from Yisi Experimental Animal Co., Ltd. (Changchun, China). For the duration of the study, all mice were housed in a specific pathogen-free (SPF) facility under controlled conditions, including a 12-hour light/dark cycle, ambient temperature of 22 ± 2°C, and humidity levels of 50–60%. Mice had ad libitum access to food and water and were acclimatized for 7 days prior to the experiment. The study followed strict randomization and blinding protocols.

All animal experiments were conducted in accordance with the guidelines of the Animal Management and Ethics Committee of Northeast Agricultural University (Approval Number: NEAUEC20230468) and strictly followed the National Guiding Principles for the Welfare of Laboratory Animals. This study was conducted in compliance with the ARRIVE guidelines to ensure transparent and complete reporting of research involving animals. A completed ARRIVE checklist can be found in the attached document.

Cells, viruses, and antibodies

HEK293T (human embryonic kidney) cells, MDBK (Madin-Darby bovine kidney) cells, and BT (bovine testicular) cells were preserved in our laboratory. These cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS) and incubated at 37◦C with 5% CO2. The Sf9 insect cell line was cultured in Serum-Free Medium Complete (Thermo, MA, USA) at 27◦C without additives. VSV (vesicular stomatitis virus) was purchased from the China Institute of Veterinary Drug Control, while BPIV3 (bovine parainfluenza virus type 3) and BEV (bovine enterovirus) were isolated and stored in our laboratory.

The pcDNA3.1-BoIFNα plasmid was constructed and preserved in our laboratory. Polyclonal antibodies (PAb) against BoIFNαA (LZ-KC0129) were purchased from Lianzu Biotechnology (Shanghai, China). PAb against M×1 (GTX110256) and GAPDH (GTX100118) were purchased from GeneTex (CA, USA).

Construction of the recombinant vector pACEMam1-BoIFNα

The BoIFNα gene was excised from pcDNA3.1-BoIFNα using BamH I and Xho I restriction enzymes, and subsequently cloned into the pACEMam1 vector between the BamH I and Sal I sites. Following confirmation through identification and sequencing, the positive plasmids were designated as pACEMam1-BoIFNα.

Preparation of DH10EMBacVSV-BoIFNα bacmid

The recombinant vector pACEMam1-BoIFNα was introduced into DH10EMBacVSVTM cells (Geneva Biotech, USA). The recombinant bacmid DH10EMBacVSV-BoIFNα was obtained using blue-white selection, and further verified by PCR using M13 universal primers. Both DH10EMBacVSV and recombinant DH10EMBacVSV-BoIFNα bacmids were purified according to the MultiBacMamTM manual. At least three clones were selected after two rounds of streaking for further verification.

Packaging of BacMam-BoIFNα virus

To package the BacMam-BoIFNα virus, Sf9 cells were first plated in six-well plates and transfected with DH10EMBacVSV and DH10EMBacVSV-BoIFNα bacmids using Lipofectamine™ 2000 (Invitrogen, CA, USA) following the manufacturer’s guidelines. The initial virus stock (P0) was harvested from the supernatant of these cells after 6 ~ 7 days. Then, the P0 stock was used to infect fresh Sf9 cells, and the supernatant was collected after 3–4 days to obtain the P1 stock. This process was repeated to generate the P2 stock by infecting Sf9 cells with the P1 stock and harvesting the supernatant after another 3–4 days.

The presence and identity of the virus at each stage were confirmed using PCR with M13 universal primer. Finally, the titers of both BacMam and BacMam-BoIFNα virus were determined using a standard virus plaque formation assay on Sf9 cells, as described in reference [28].

Identification of protein expression of BoIFNα

MDBK and HEK293T cells were seeded in six-well plates, and 10 MOI of BacMam and BacMam-BoIFNα virus were separately diluted into 500 μL of complete DMEM media supplemented with 3 mm sodium butyrate. The mixtures were then added to plates containing MDBK and HEK293T cells for 48 h post-infection. The cells were collected, and the cell culture supernatants were separately treated with Trichloroacetic acid (TCA). The samples were then subjected to Western blot analysis using PAb against BoIFNαA as the primary antibodies. The membranes were developed with ECL substrate (Beyotime, Beijing, China).

Antiviral activity of BoIFNα in vitro

The supernatant of HEK293T cells infected with BacMam-BoIFNα virus was collected, and the concentration of BoIFNα secreted was measured using an enzyme-linked immunosorbent assay (ELISA) according to previous studies [29,30]. Specifically, the PAb against BoIFNαA was coated on 96-well plates, and the BoIFNα produced in yeast Pichia pastoris [12] with serial dilutions was used as the standard protein for establishing the standard curve for BoIFNα measurement. The optical density at 450 nm (OD450 nm) of each well was measured, and the concentration of BoIFNα secreted in the supernatant was determined based on the standard curve. Subsequently, the antiviral activities of BoIFNα expressed in HEK293T cells using the BacMam system against viruses including VSV, BPIV3, BEV, and BVDV were determined by inhibiting the cytopathic effect in MDBK, BT and BL cells as previously described [31].

Plaque reduction assays were performed according to the standard procedure [32]. MDBK or BT cells were seeded in six-well plates, and the monolayers cells were infected with varying MOI of BacMam-BoIFNα virus (0.1, 1, 2, 5, 10, 50 MOI) for 4.5 h before being challenge with 100 TCID50 VSV. After post-infection with VSV for another 1.5 h, the culture medium was replaced with DMEM containing 2% low-melting agarose. The plates were incubated at 37 °C for another 96 h to allow plaques formation. Plaques were then fixed with 0.1 g/L neutral red, and their numbers were counted.

Signaling pathway analysis of BoIFNα expressed with the BacMam system

MDBK or BT cells were seeded in six-well plates and treated with BacMam-BoIFNα virus at 10 MOI, 50 MOI, and 100 MOI for 12 h. Subsequently, cellular RNA was extracted using an RNA Extraction Kit (Tiangen, Beijing, China) and reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Japan). Real-time PCR was conducted to analyze the expressions of ISGs (including Mx1, ISG15, ISG56, and OAS) with the specific primers (Table 1), GAPDH was used as an internal reference gene. The PCR conditions included 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 45 s. The results were analyzed using the 2−ΔΔCt method and expressed as fold-change.

Table 1.

Primer sequences for real-time PCR.

Primer Sequence (5’-3’)
BoISG15-qPCRF
BoISG15-qPCRR
GCAGCCAACCAGTGTCTG
CCTAGCATCTTCACCGTCAG
BoISG56-qPCRF
BoISG56-qPCRR
TGGACTGTGAGGAAGGATGG
AGGCGATAGACAACGATTGC
BoMx1-qPCRF
BoMx1-qPCRR
TCAACCTCCACCGAACTG
TCTTCTTCTGCCTCCTTCTC
BoOAS-qPCRF
BoOAS-qPCRR
TTCGGTCATCTTGCTCTCAG
GTCTATCTCAACAGTCACAATCC
Bo-GAPDH-qPCRF
Bo-GAPDH-qPCRR
BoIFNα-qPCRF
BoIFNα-qPCRR
BPIV3-qPCRF
BPIV3-qPCRR
Mu-βactin-qPCRF
Mu-βactin-qPCRR
TTCAACGGCACAGTCAAGG
ACATACTCAGCACCAGCATCAC
GTGAGGAAATACTTCCACAGACTCA
TGARGAAGAGAAGGCTCTCATGA
AGGTGGAAACGGTGATGATGG
GGTGTTGATTGGTGTCTTCTTGG
CAGCCTTCCTTCTTGGGT
GTTGGCATAGAGGTCTTTACGG

Furthermore, MDBK cells were treated with 100 MOI of BacMam-BoIFNα virus for 0, 3, 6, 12, 18 and 24 h. The cells were then lysed using M-PER® Mammalian Protein Extraction Reagent (Thermo) and subjected to Western blot analysis. PAb against M×1 and GAPDH were used as the primary antibodies, with HRP-conjugated goat anti-rabbit IgG as the secondary antibody. The membranes were developed with ECL substrate (Beyotime, Beijing, China).

MDBK or BT cells were seeded in six-well plates and treated with 100 MOI of BacMam-BoIFNα virus for 4.5 h. After this initial treatment, the medium was replaced with DMEM containing 0.1 nM, 1 nM, 10 nM oclacitinib maleate (JAK1 inhibitor, HY-13577A, MCE, USA) for an additional 7.5 h. Following this treatment, RNA was extracted from the cells and reverse-transcribed into cDNA. Real-time PCR was performed to evaluate gene expression of ISGs. Additionally, MDBK cells were lysed and subjected to Western blot analysis to evaluate protein expression of M×1 according to the methods described above.

Antiviral activity of BoIFNα in mice

The antiviral activity of BoIFNα, delivered in vivo via the BacMam-BoIFNα virus, was evaluated using mice infected with BPIV3. Recombinant BacMam-BoIFNα virus was concentrated by ultracentrifugation (25,000 rpm, 4°C, 3 hours) and diluted to different doses. Mice received intranasal administration of BacMam-BoIFNα virus, while control groups received either PBS or a negative BacMam virus. The dosing and durations varied according to each experiment, as outlined below.

In the first experiment, 36 mice were randomly divided into 6 groups (n = 6 per group) and were intranasally administered 109 PFU of BacMam-BoIFNα virus. Mice were euthanized at 2, 5, 7, 10, and 20 days post-administration. Tissues, including the heart, liver, spleen, lung, and trachea were harvested, immediately frozen in liquid nitrogen, and processed for RNA extraction using Trizol (Invitrogen, USA). The RNA was reverse-transcribed into cDNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Japan). Quantitative real-time PCR wasperformed to evaluated BoIFNα transcription levels, and the data were analyzed using the 2−ΔCt method.

In the second experiment, 30 mice were randomly divided into 5 groups (n = 6 per group) and received different doses of BacMam-BoIFNα virus (107, 108, 109, or 1010 PFU). Mice were euthanized 5 days after intranasal administration, and tissues (heart, liver, spleen, lung, and trachea) were collected as described above. RNA extraction, cDNA synthesis, and qPCR were conducted to assess BoIFNα transcription levels. Based on the results, 109 PFU was determined to be the optimal dose for further experiments.

In the third experiment, 150 mice were randomly assigned into 5 groups with 5 time points, with 6 mice per group for each time point. All mice received 109 PFU of BacMam-BoIFNα virus intranasally for 2 days, followed by an intratracheal administration of 1.4 × 104 PFU BPIV3 virus. Mice were euthanized at 1, 2, 3, 4, and 5 days post-BPIV3 infection. Lung and trachea tissues were harvested for RNA extraction, and BPIV3 mRNA levels were measured using qPCR. The antiviral effect of BoIFNα was assessed by comparing viral replication levels between the treated and control groups using the 2−ΔCt method.

Statistical analysis

Data were analyzed using GraphPad Prism software version 6.x (GraphPad Software Inc., San Diego, CA) and expressed as mean ± standard deviation (SD). Statistical significance was determined using Student’s t-test, with a P-value <0.05 considered statistically significant.

Results

Preparation of DH10EMBacVSV-BoIFNα bacmid and BacMam-BoIFNα virus

The BoIFNα gene was enzymatically digested and ligated into pACEMam1 vectors. The recombinant plasmid was identified with BamH I digestion, yielding a signal band of 3981 bp, and was designated as pACEMam1-BoIFNα after sequencing (Figure 1a). The pACEMam1-BoIFNα plasmid was then transformed into the DH10EMBacVSVTM cells, the white colonies were selected post blue-white selecting, while the blue colonies served as the negative control. A band of 3200 bp was amplified from the DH10EMBacVSV-BoIFNα bacmid and a band of 300 bp from the DH10EMBacVSV bacmid (Figure 1b). Following transfection, the BacMam-BoIFNα virus was collected and visualized via transmission electron microscopy (TEM) (Figure 1c). The titer of BacMam-BoIFNα virus, measured by plaque formation assay, was 3.11 × 107 PFU/mL. The BacMam-BoIFNα virus was capable of transducing various cells to produce BoIFNα (Figure 1d).

Figure 1.

Figure 1.

Overview of BacMam system for producing BoIFNα.

(a) Construction of recombinant transfer plasmid pACEMam1-BoIFNα. This panel illustrates the process of creating the pACEMam1-BoIFNα plasmid and its subsequent enzyme identification analysis, showing a band of 3981 bp after BamH I digestion. (b) Preparation of recombinant DH10EMBacVSV-BoIFNα bacmid and verification through PCR amplification. The preparation involves transforming pACEMam1-BoIFNα plasmid into DH10EMBacVSV™ cells, with white colonies selected post blue-white selection. The PCR amplification results show a band of 3200 bp for the DH10EMBacVSV-BoIFNα bacmid and a band of 300 bp for the DH10EMBacVSV bacmid. (c) Production of BacMam-BoIFNα virus. The BacMam-BoIFNα virus is produced through the transfection of the DH10EMBacVSV-BoIFNα bacmid and visualized using transmission electron microscopy. (d) Expression of BoIFNα with BacMam-BoIFNα virus transduction. The BacMam-BoIFNα virus transduces various mammalian cells, including the HEK293T, MDBK, BT, and BL cells, leading to the expression of BoIFNα.

Identification of BoIFNα expression in MDBK and HEK293T cells

Following transduction with 100 MOI of BacMam-BoIFNα virus, the recombinant BoIFNα protein was highly expressed in MDBK (Figure 2a) and HEK293T (Figure 2b) cells at the expected size of 20 kDa, which could secreted into the culture supernatant (Figure 2).

Figure 2.

Figure 2.

Western blot analysis of BoIFNα expression in MDBK cells (a) and HEK293T cells (b) Lane M: PageRuler protein marker; lane 1: lysates of untransfected cells; lane 2: lysates of cells transfected with negative BacMam virus; lane 3: lysates of cells transfected with BacMam-BoIFNα virus; lane 4: culture supernatant of untransfected cells.; lane 5: culture supernatant of cells transfected with negative BacMam virus; lane 6: culture supernatant of cells transfected with BacMam-BoIFNα virus.

Antiviral activity of BoIFNα expressed with BacMam system in vitro

The concentration of BoIFNα secreted in the supernatant of HEK293T cells transduced with the BacMam-BoIFNα virus was measured at 2 μg/mL. The antiviral activity of BoIFNα was then assessed using a cytopathic inhibition assay on MDBK, BT, and BL cells, which demonstrated protective effects against VSV in all three cell types, and against BPIV3, BEV and BVDV in MDBK cells. The antiviral activities were above 106 U/mg, with notably stronger protection against BEV, exceeding 107 U/mg (Figure 3a,b).

Figure 3.

Figure 3.

Antiviral activity of BoIFNα expressed with BacMam system in vitro. (a) Antiviral activities of BoIFNα secreted from HEK293T cells against VSV on MDBK cells, BT cells, and BL cells. (b) Antiviral activities of BoIFNα secreted from HEK293T cells against BPIV3, BEV, and BVDV on MDBK cells. (c–f) Antiviral activities of BacMam-BoIFNα virus transduction on MDBK cells against VSV, BPIV3, BEV, and BVDV measured by the plaque reduction assay.

Post-transduction with BacMam-BoIFNα virus, MDBK cells showed significant resistance against infection by VSV, BPIV3, BEV and BVDV, as evidenced by a substantial reduction in plaque formation (Figure 3c,f). Notably, no plaque formation was observed in MDBK cells transduced with 10 MOI and 50 MOI of BacMam-BoIFNα virus when challenged with these viruses. Even with a transduction of 1 MOI of BacMam-BoIFNα virus, plaque formation was reduced by over 50%, although this reduction was less pronounced compared to higher MOIs. This suggests that lower MOIs lead to less effective interferon production, resulting in a weaker antiviral response. Furthermore, the inhibition rate for the replication of VSV, BPIV3, BEV, and BVDV showed a dose-dependent response to BacMam-BoIFNα virus transduction (Figure 3c,f).

Signaling pathway analysis of BoIFNα expressed with the BacMam system

Transduction with BacMam-BoIFNα virus significantly induce the transcription of OAS, ISG15, ISG56, and M×1 in MDBK and BT cells (Figure 4a,b). The addition of the JAK1 inhibitor Oclacitinib maleate substantially reduced the transcription of these genes (Figure 4c,d).

Figure 4.

Figure 4.

Signal pathway analysis of BoIFNα expressed with the BacMam system. (a–b) Real-time PCR analysis of the transcription levels of OAS, ISG15, ISG56, and M×1 in MDBK and BT cells following transduction with BacMam-BoIFNα virus. (c–d) Real-time PCR analysis of the transcription levels of the same genes in MDBK and BT cells transduced with BacMam-BoIFNα virus and treated with the JAK1 inhibitor oclacitinib maleate. (e) Western blot analysis of M×1 protein expression in MDBK cells at various time points post-transduction with BacMam-BoIFNα virus. (f) Western blot analysis of M×1 protein expression in MDBK cells transduced with the BacMam-BoIFNα virus and treated with the JAK1 inhibitor oclacitinib maleate.

When MDBK cells were transduced with 100 MOI of BacMam-BoIFNα virus, M×1 expression was significantly induced in a time-dependent manner. The results revealed two bands corresponding to M×1 and GAPDH at the expected sizes of 76 kDa and 36 kDa, respectively. This induction of M×1 began as early as 3 h and peaked at 24 h post-transduction in MDBK cells (Figure 4e), indicating an early activation of the antiviral response that precedes the significant presence of IFN-α in the supernatant. The addition of the 10 nM Oclacitinib maleate completely inhibit the M×1 expression induced with BacMam-BoIFNα virus transduction in MDBK cells (Figure 4f).

Antiviral activity of BoIFNα expressed with BacMam system in vivo

In the heart, lung, and trachea tissues of mice, the transcription of BoIFNα was notably increased after 2, 5 and 7 days, with the most significant increase observed at 5 days post-transduction with the BacMam-BoIFNα virus (Figure 5a). A dose of 109 PFU of virus significantly induced BoIFNα transcription in the lung and trachea tissue at 5 days post-transduction (Figure 5b).

Figure 5.

Figure 5.

Analysis of antiviral activity of BoIFNα in vivo. (a) Real-time PCR analysis of BoIFNα transcription in mice tissues after BacMam-BoIFNα virus transduction for 2, 5, 7, 10, and 20 days. (b) Real-time PCR analysis of BoIFNα transcription in mice tissues with different doses of BacMam-BoIFNα virus transduction. (c-d) real-time PCR analysis of BPIV3 replication in the lung and trachea tissues of mice transduced with BacMam-BoIFNα virus for 1 to 3 days, followed by a BPIV3 challenge for 1 to 5 days.

Mice were challenged with BPIV3 for 1 to 5 days following 1 to 3 days of BacMam-BoIFNα virus transduction. The highest titers of BPIV3 were observed with 3 days of infection. BacMam-BoIFNα virus transduction in the mice’s trachea significantly inhibited BPIV3 replication in the lung and trachea tissues. While BPIV3 infection did not cause clinical symptoms, the observed reduction in viral replication suggest that BacMam-BoIFNα pre-treatment may prime the immune response and mitigate disease severity. Transduction with BacMam-BoIFNα virus for 1 to 3 days provided varying degrees of protection in the lung and trachea tissues against BPIV3 challenge for 1 to 4 days (Figure 5c,d).

Discussion

IFNs and the IFN-induced cellular antiviral response are primary defense mechanisms against viral infection, playing a crucial role in the antiviral defense of the innate immune system, especially type I IFNs. Among type I IFNs, IFNα has been extensively used in the treatment of hepatitis C [33,34], melanoma [9,35], and as adjuvants in antiviral and antitumor vaccines [6]. Studies on bovine IFNαs in yeast P. pastoris and prokaryotic expression system have shown antiviral activities against viruses like VSV and BVDV [11,12,36–38]. In this stud y, the antiviral capabilities of BoIFNα expressed with the BacMam system were explored in vitro using cells and in vivo using BPIV3-infection mouse models. We found that BoIFNα not only provides protection against VSV, BPIV3, BEV, and BVDV in MDBK, BT, and BL cells, but also inhibits BPIV3 replication in the lung and trachea tissues of mice.

The BacMam system utilizes a strong CMV promoter for driving high-level expression in mammalian cells. MultiBacMam™ is a MultiBac™-based virus 0(VSV-pseudotyped to enhance mammalian cell transduction efficiency), comprising the DH10EMBacVSV genome and a series of plasmid transfer vectors that enable multiprotein expression in a wide range of mammalian and primary cells [27]. In this study, BoIFNα was expressed in various cells, including HEK293T cells, MDBK cells, BT cells, as well as in mouse lung and trachea tissues, revealing its biologic activities and highlighting the BacMam system’s efficacy as a delivery tool for BoIFNα. No cytotoxic effects were observed in MDBK and BT cells during BacMam-BoIFNα transduction, consistent with established findings that BacMam viruses are well-tolerated by mammalian cells, even at higher MOIs [39]. This indicates that the observed antiviral effects were not caused by cytotoxicity but were specifically due to the action of BoIFNα. The BacMam-BoIFNα virus effectively transduced and expressed BoIFNα in mouse lung and trachea tissues, facilitating the establishment of an antiviral state, providing antiviral activity, and protecting the protein from degradation in vivo. This delivery strategy achieves sustained expression of the interferon gene in vivo, significantly surpassing the efficacy of single protein injection methods. The continuous expression of interferon over a certain period demonstrated remarkable antiviral effects. The lower antiviral efficacy observed at 0.1 and 1 MOI is likely attributed to reduced transduction efficiency and interferon production at these viral loads, further compounded by the inherently lower transduction efficiency of MDBK cells compared to other cell types [40].

Type I IFNs induce a broad antiviral response through the activation of hundreds of ISGs, signaling through JAK-STAT pathway [41]. ISGs plays a crucial role in controlling the replication and spread of viruses in vivo by modulating various processes, such as nucleic acid metabolism, virus entry, protein translation, and virus release. Mx1, OAS, PKR are three classical ISGs involved in these antiviral response [4]. In the study, transduction of BacMam-BoIFNα virus in MDBK and BT cells significantly induced the transcription and expression of ISGs, including OAS, ISG15, ISG56, and Mx1. The early induction of these ISGs correlates with a reduction in viral replication, highlighting that BacMam-BoIFNα triggers a rapid antiviral response even before substantial IFN-α levels are detected. This emphasizes the role of ISGs expression as a sensitive indicator of interferon activity. Notably, the addition of the JAK1 inhibitor Oclacitinib maleate effectively inhibited these inductions, indicating that BoIFNα expressed with the BacMam system stimulates downstream ISGs expression. The JAK1 inhibitor can block this antiviral signals transduction, highlighting the role of the JAK-STAT pathway in mediating the antiviral effects of BoIFNα.

While BacMam-BoIFNα has demonstrated strong antiviral effects as a pre-treatment, its effectiveness in a post-exposure context remains untested. Given the role of interferon in inhibiting viral replication, it could potentially offer therapeutic benefits after exposure, particularly in managing respiratory infections [42]. This is especially relevant for bovine respiratory disease (BRD), a complex syndrome in which BPIV3 plays a critical role. Exploring BacMam-BoIFNα’s efficacy in post-exposure scenarios within BRD models presents a significant opportunity for future research. Although BPIV3 infection alone did not result in severe clinical symptoms, the significant reduction in viral loads and the robust ISGs response induced by BacMam-BoIFNα pre-treatment highlight its potential to modulate disease severity, especially in the presence of more virulent virus or co-infections, as seen in BRD. These findings underscore the importance of further investigating BacMam-BoIFNα’s role in more complex disease models.

In conclusion, the BacMam system has proven to be a highly effective method for expressing BoIFNα in mammalian cells, both in vitro and in vivo. This study successfully engineered recombinant pACEMam1-BoIFNα bacmids and BacMam-BoIFNα virus. Transduction of HEK293T cells with BacMam-BoIFNα virus resulted in the secretion of BoIFNα into the culture supernatant, exhibiting potent antiviral activity against multiple viruses and triggering the expression of ISGs via the JAK-STAT signaling pathway. Furthermore, BacMam-BoIFNα virus significantly reduced BPIV3 replication in the lung and trachea tissues of infected mice. These results demonstrate that BacMam-BoIFNα virus not only has robust antiviral effects both in vitro and in vivo but also effectively activates the JAK-STAT pathway. This system provides a powerful and promising approach for delivering interferon genes to combat bovine viral infections, highlighting its potential for broader antiviral therapeutic applications.

Supplementary Material

Author Checklist Gao.pdf
KVIR_A_2435372_SM2552.pdf (270.3KB, pdf)
Figure legends.docx

Funding Statement

This work was supported by the Agriculture Research System of China [CARS-36], the National Natural Science Foundation of China [32002296], the Shuangcheng Nestle Dairy Farming Institute [NEAU-JKYZYJY-2020-5], the China Postdoctoral Science Foundation [2021M690583], the Postdoctoral Science Foundation of Heilongjiang Province [LBH-Z21099], and the Heilongjiang Provincial Natural Science Foundation [LH2023C022].

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions statement

All the authors read and approved the final version of the manuscript. Research concepts and design were contributed by Mingchun Gao, Yongli Guo, and Junwei Wang. Experiments were conducted and data were collected by Zhenying Fan, Yajuan Hou, Yue Liu, Jingjing Zhao, Yixiao Wang, Chun Fu, and Shuangfeng Wang. Statistical analysis and data interpretation were performed by Zhenying Fan, Yajuan Hou, Yue Liu, Yongli Guo. The manuscript was drafted and revised by Yongli Guo and Zhenying Fan, and critical revised by Mingchun Gao and Yongli Guo. All authors agree to be accountable for all aspects of the work.

Data availability statement

The data supporting the findings of this study are openly accessible in the Science Data Bank at https://www.scidb.cn/en/s/jim2uu, with the reference DOI: 10.57760/sciencedb.12899.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2024.2435372

References

  • [1].Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev. 2001;14(4):778–11. doi: 10.1128/CMR.14.4.778-809.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Doly J, Civas A, Navarro S, et al. Type I interferons: expression and signalization. CMLS, Cell Mol Life Sci. 1998;54(10):1109–1121. doi: 10.1007/s000180050240 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Wang Y, Jiang S, Jiang X, et al. Cloning and codon optimization of a novel feline interferon omega gene for production by Pichia pastoris and its antiviral efficacy in polyethylene glycol-modified form. Virulence. 2022;13(1):297–309. doi: 10.1080/21505594.2022.2029330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Schoggins JW. Interferon-stimulated genes: roles in viral pathogenesis. Curr Opin Virol. 2014;6:40–46. doi: 10.1016/j.coviro.2014.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Schneider WM, Chevillotte MD, Rice CM. Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol. 2014;32(1):513–545. doi: 10.1146/annurev-immunol-032713-120231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Arico E, Belardelli F. Interferon-α as antiviral and antitumor vaccine adjuvants: mechanisms of action and response signature. J Interferon Cytokine Res. 2012;32(6):235–247. doi: 10.1089/jir.2011.0077 [DOI] [PubMed] [Google Scholar]
  • [7].Ferrantini M, Capone I, Belardelli F. Interferon-α and cancer: mechanisms of action and new perspectives of clinical use. Biochimie. 2007;89(6–7):884–893. doi: 10.1016/j.biochi.2007.04.006 [DOI] [PubMed] [Google Scholar]
  • [8].Nagase Y, Yotsuyanagi H, Okuse C, et al. Effect of treatment with interferon α-2b and ribavirin in patients infected with genotype 2 hepatitis C virus. Hepatol Res. 2008;38(3):252–258. doi: 10.1111/j.1872-034X.2007.00257.x [DOI] [PubMed] [Google Scholar]
  • [9].Mocellin S, Lens MB, Pasquali S, et al. Interferon alpha for the adjuvant treatment of cutaneous melanoma. Cochrane Database Syst Rev. 2013;6(11):D8955. doi: 10.1002/14651858.CD008955.pub2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Moraes MP, Chinsangaram J, Brum MC, et al. Immediate protection of swine from foot-and-mouth disease: a combination of adenoviruses expressing interferon alpha and a foot-and-mouth disease virus subunit vaccine. Vaccine. 2003;22(2):268–279. doi: 10.1016/S0264-410X(03)00560-7 [DOI] [PubMed] [Google Scholar]
  • [11].Shao J, Cao C, Bao J, et al. Characterization of the biological activities and physicochemical characteristics of recombinant bovine interferon-α14. Mol Immunol. 2015;64(1):163–169. doi: 10.1016/j.molimm.2014.11.011 [DOI] [PubMed] [Google Scholar]
  • [12].Shao J, Cao C, Bao J, et al. Characterization of bovine interferon α 1: expression in yeast Pichia pastoris, biological activities, and physicochemical characteristics. J Interferon Cytokine Res. 2015;35(3):168–175. doi: 10.1089/jir.2013.0139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Velan B, Cohen S, Grosfeld H, et al. Isolation of bovine ifn-alpha genes and their expression in bacteria. Methods Enzymol. 1986;119:464–174. [DOI] [PubMed] [Google Scholar]
  • [14].Guo HC, Liu ZX, Sun SQ, et al. The effect of bovine ifn-α on the immune response in Guinea pigs vaccinated with DNA vaccine of foot-and-mouth disease virus. Acta Biochim Biophys Sin (Shanghai). 2004;36(10):701–706. doi: 10.1093/abbs/36.10.701 [DOI] [PubMed] [Google Scholar]
  • [15].Felberbaum RS. The baculovirus expression vector system: a commercial manufacturing platform for viral vaccines and gene therapy vectors. Biotechnol J. 2015;10(5):702–714. doi: 10.1002/biot.201400438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Kost TA, Condreay JP, Jarvis DL. Baculovirus as versatile vectors for protein expression in insect and mammalian cells. Nat Biotechnol. 2005;23(5):567–575. doi: 10.1038/nbt1095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Ames RS, Kost TA, Condreay JP. BacMam technology and its application to drug discovery. Expert Opin Drug Discov. 2007;2(12):1669–1681. doi: 10.1517/17460441.2.12.1669 [DOI] [PubMed] [Google Scholar]
  • [18].Fornwald JA, Lu Q, Boyce FM, et al. Gene expression in mammalian cells using BacMam, a modified baculovirus system. Methods Mol Biol. 2016;1350:95–116. [DOI] [PubMed] [Google Scholar]
  • [19].Ames R, Nuthulaganti P, Fornwald J, et al. Heterologous expression of G protein–coupled receptors in U-2 OS osteosarcoma cells. Recept Channels. 2004;10(3–4):117–124. doi: 10.3109/10606820490515012 [DOI] [PubMed] [Google Scholar]
  • [20].Clay WC, Condreay JP, Moore LB, et al. Recombinant baculoviruses used to study estrogen receptor function in human osteosarcoma cells. Assay Drug Dev Technol. 2003;1(6):801–810. doi: 10.1089/154065803772613435 [DOI] [PubMed] [Google Scholar]
  • [21].Katso RM, Parham JH, Caivano M, et al. Evaluation of cell-based assays for steroid nuclear receptors delivered by recombinant baculoviruses. J Biomol Screen. 2005;10(7):715–724. doi: 10.1177/1087057105278873 [DOI] [PubMed] [Google Scholar]
  • [22].Boudjelal M, Mason SJ, Katso RM, et al. The application of BacMam technology in nuclear receptor drug discovery. Biotechnol Annu Rev. 2005;11:101–125. [DOI] [PubMed] [Google Scholar]
  • [23].Fung KL, Kapoor K, Pixley JN, et al. Using the BacMam baculovirus system to study expression and function of recombinant efflux drug transporters in polarized epithelial cell monolayers. Drug Metab Dispos. 2016;44(2):180–188. doi: 10.1124/dmd.115.066506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Puente-Massaguer E, Cajamarca-Berrezueta B, Volart A, et al. Transduction of HEK293 cells with BacMam baculovirus is an efficient system for the production of HIV-1 virus-like particles. Viruses. 2022;14(3):636. doi: 10.3390/v14030636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Imai A, Tadokoro T, Kita S, et al. Establishment of the BacMam system using silkworm baculovirus. Biochem Biophys Res Commun. 2016;478(2):580–585. doi: 10.1016/j.bbrc.2016.07.104 [DOI] [PubMed] [Google Scholar]
  • [26].Kost TA, Condreay JP. Recombinant baculoviruses as mammalian cell gene-delivery vectors. Trends Biotechnol. 2002;20(4):173–180. doi: 10.1016/S0167-7799(01)01911-4 [DOI] [PubMed] [Google Scholar]
  • [27].Chen CY, Lin CY, Chen GY, et al. Baculovirus as a gene delivery vector: recent understandings of molecular alterations in transduced cells and latest applications. Biotechnol Adv. 2011;29(6):618–631. doi: 10.1016/j.biotechadv.2011.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Fukushima K, Takahashi T, Takaguchi M, et al. Plaque formation assay for human parainfluenza virus type 1. Biol Pharm Bull. 2011;34(7):996–1000. doi: 10.1248/bpb.34.996 [DOI] [PubMed] [Google Scholar]
  • [29].Gao M, Zhang R, Li M, et al. An ELISA based on the repeated foot-and-mouth disease virus 3B epitope peptide can distinguish infected and vaccinated cattle. Appl Microbiol Biotechnol. 2012;93(3):1271–1279. doi: 10.1007/s00253-011-3815-0 [DOI] [PubMed] [Google Scholar]
  • [30].Guo Y, An D, Liu Y, et al. Characterization and signaling pathway analysis of interferon-kappa in bovine. Dev Comp Immunol. 2017;67:213–220. doi: 10.1016/j.dci.2016.09.018 [DOI] [PubMed] [Google Scholar]
  • [31].Guo Y, Gao M, Bao J, et al. Molecular cloning and characterization of a novel bovine IFN-ε. Gene. 2015;558(1):25–30. doi: 10.1016/j.gene.2014.12.031 [DOI] [PubMed] [Google Scholar]
  • [32].Pauwels R, Balzarini J, Baba M, et al. Rapid and automated tetrazolium-based colorimetric assay for the detection of anti-HIV compounds. J Virol Methods. 1988;20(4):309–321. doi: 10.1016/0166-0934(88)90134-6 [DOI] [PubMed] [Google Scholar]
  • [33].Oxenkrug G, Turski W, Zgrajka W, et al. Disturbances of tryptophan metabolism and risk of depression in HCV patients treated with IFN-alpha. J Infect Dis Ther. 2014;2(2):131. doi: 10.4172/2332-0877.1000131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Scagnolari C, Antonelli G. Antiviral activity of the interferon α family: biological and pharmacological aspects of the treatment of chronic hepatitis C. Expert Opin Biol Ther. 2013;13(5):693–711. doi: 10.1517/14712598.2013.764409 [DOI] [PubMed] [Google Scholar]
  • [35].Rozera C, Cappellini GA, D’Agostino G, et al. Intratumoral injection of IFN-alpha dendritic cells after dacarbazine activates anti-tumor immunity: results from a phase I trial in advanced melanoma. J Transl Med. 2015;13(1):139. doi: 10.1186/s12967-015-0473-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Sentsui H, Takami R, Nishimori T, et al. Anti-viral effect of interferon-.ALPHA. On bovine viral diarrhea virus. J Vet Med Sci. 1998;60(12):1329–1333. doi: 10.1292/jvms.60.1329 [DOI] [PubMed] [Google Scholar]
  • [37].Shi X, Xia C, Pan B, et al. Interferon-α genes from Bos and Bubalus bubalus. Anim Biotechnol. 2006;17(1):59–72. doi: 10.1080/10495390500461104 [DOI] [PubMed] [Google Scholar]
  • [38].Elsheikh AA, Braun LJ, Mansour S, et al. The effect of human interferon alpha on replication of different bovine viral diarrhea virus strains. Acta Virol. 2019;63(3):261–269. doi: 10.4149/av_2019_303 [DOI] [PubMed] [Google Scholar]
  • [39].Geneva Biotech . MultiBacMam™ user manual, version 3.0. Geneva Biotech; 2017. Available from: www.geneva-biotech.com [Google Scholar]
  • [40].Osorio JS, Bionaz M. Plasmid transfection in bovine cells: optimization using a realtime monitoring of green fluorescent protein and effect on gene reporter assay. Gene. 2017;626:200–208. doi: 10.1016/j.gene.2017.05.025 [DOI] [PubMed] [Google Scholar]
  • [41].Xu L, Wang W, Peppelenbosch MP, et al. Noncanonical antiviral mechanisms of ISGs: dispensability of inducible interferons. Trends Immunol. 2017;38(1):1–2. doi: 10.1016/j.it.2016.11.002 [DOI] [PubMed] [Google Scholar]
  • [42].Prokunina-Olsson L, Alphonse N, Dickenson RE, et al. COVID-19 and emerging viral infections: the case for interferon lambda. J Exp Med. 2020;217(5):e20200653. doi: 10.1084/jem.20200653 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Author Checklist Gao.pdf
KVIR_A_2435372_SM2552.pdf (270.3KB, pdf)
Figure legends.docx

Data Availability Statement

The data supporting the findings of this study are openly accessible in the Science Data Bank at https://www.scidb.cn/en/s/jim2uu, with the reference DOI: 10.57760/sciencedb.12899.


Articles from Virulence are provided here courtesy of Taylor & Francis

RESOURCES