Immunization with the NcMYR1 gene knockout strain effectively protected C57BL/6 mice and their pups against the Neospora caninum challenge

ABSTRACT

Neospora caninum is an important protozoan parasite that causes abortion in cattle and nervous system dysfunction in dogs. No effective drugs and vaccines for neosporosis are available. Further elucidation of proteins related to N. caninum virulence will provide potential candidates for vaccine development against neosporosis. In the present study, N. caninum c-Myc regulatory protein (NcMYR1) gene knockout strains (ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3) were generated using the CRISPR-Cas9 gene editing system to investigate phenotype changes and the potential of the ΔNcMYR1-1 strain as an attenuated vaccine, and this is the first time of using the N. caninum CRISPR-Cas9 gene knockout strain as an attenuated vaccine. NcMYR1 was determined to be a cytoplasmic protein in N. caninum tachyzoites. The deficiency of NcMYR1 decreased the plaque area and the rate of invasion, replication, and egression of the parasites. ΔNcMYR1-1 strain-infected C57BL/6 mice had 100% survival rate, reduced parasite burden, and alleviated pathological changes in tissues compared with those in Nc-1 strain-infected mice. Immunization with ΔNcMYR1-1 tachyzoites increased the productions of cytokines in mice, with a survival rate reaching 80%, and the parasite burdens in the liver and spleen were greatly reduced when challenged with the Nc-1 strain with a lethal dose after 40 days of ΔNcMYR1-1 tachyzoite immunization. ΔNcMYR1 immunization could decrease the abortion rate of female mice from 71.4% to 12.5% and increase the survival rate of pups from 12.5% to 83.3% against the N. caninum challenge. Above all, NcMYR1 is a virulence factor and the ΔNcMYR1-1 strain could be used as a candidate vaccine against N. caninum infection and vertical transmission.

INTERPRETIVE SUMMARY

Neospora caninum is an intracellular parasite that causes abortion, stillbirth, and mummified fetuses in cows; the key strategy for the prevention of N. caninum is vaccine; and the study of the virulence gene of N. caninum is key to developing effective vaccines against neosporosis. NcMYR1 is critical for the processes of growth, invasion, and replication and is a virulence factor in N. caninum. The ΔNcMYR1-1 strain could provide an effective protection against N. caninum infection and increase the abortion rate of mice and the survival rate of pups, indicating that the ΔNcMYR1-1 strain may be a promising vaccine candidate for neosporosis, which lays a theoretical foundation for the prevention of neosporosis.

GRAPHICAL ABSTRACT

Background

Neospora caninum is an intracellular protozoan parasite that causes abortion, stillbirth, and mummified fetuses in cows [1]. Canines are its definitive hosts, and a variety of domestic animals serve as the intermediate hosts. Neosporosis is distributed worldwide, which leads to huge economic losses in the cattle industry [2]. So far, there are still no effective therapeutic drugs and prophylactic vaccines for neosporosis.

Understanding the basic biology and pathogenic mechanisms of N. caninum is key to identifying potential targets for developing effective vaccines and drugs against neosporosis. In recent years, many genes involved in parasite invasion and proliferation have been found to affect the virulence of N. caninum. As a member of apicomplexan protozoa, N. caninum has specific organelles, such as microneme, dense granule, and rhoptry, which secret various proteins that can be adsorbed to the surface of N. caninum or host cells to form the connection structure when N. caninum invades host cells [3]. In the late stage of invasion, the protein secretion from rhoptries, micronemes, and dense granules increased; then the host cell membrane appears to be cavitated; and parasitophorous vacuoles (PVs) are formed, leading to the completion of the integral invasion [4]. Rhoptry protein (ROP) 2 [5], ROP5 [6], microneme protein (MIC) 3 [7], MIC4 [8], MIC6 [9,10], and MIC8 [10] have been found to be involved in the N. caninum invasion process. Some virulence genes, such as dense granule antigen (GRA)2 [11], GRA7 [4], and NcROP40 [12] and the NcPuf (named after Pumilio in Drosophila melanogaster and fem-3 binding factor in Caenorhabditis elegans) protein [13], have been used to develop vaccines against neosporosis, which exhibit effective protection against neosporosis. Nonetheless, the functions of many N. caninum genes, especially those associated with the pathogenesis of N. caninum are still unclear.

Proto-oncogenes (c-Myc) are one of the key factors of cancer and are usually expressed at a low level in normal cells. The c-Myc upregulation may increase the possibility of cell transformation. Recent studies have reported that Plasmodium, T. gondii, and Trypanosoma can significantly increase the expression of c-Myc in host cells. The c-Myc regulatory proteins (MYRs) were first discovered in T. gondii. Further work identified that T. gondii MYR1–4 are associated with host cell c-Myc, PVs, and parasite pathogenicity. The TgMYR1 protein is localized on PVs and PV membrane with TgMYR2 and TgMYR3, which indirectly regulates host cell division and differentiation [14,15]. In addition, TgMYR1 has been identified as a crucial virulence protein, which plays an important role in delivering TgGRA16 and TgGRA24 to the infected cells. As a secretory protein, TgMYR1 has the potential to be a target vaccine candidate exhibiting strong B-cell and T-cell epitopes [16]. The pVAX1-TgMYR1 DNA vaccine can stimulate both humoral and cellular immune responses and significantly prolong the survival of T. gondii-infected mice, indicating that TgMYR1 is a promising immune-protective antigen [17]. N. caninum is similar with T. gondii in morphological and biological characteristics [18]. The NcMYR1 gene from N. caninum has been identified by TgMYR1 sequence homology search in ToxoDB. However, the function of N. caninum MYR1 remains unknown.

In the present study, the subcellular localization of the NcMYR1 protein was observed by immunofluorescence. NcMYR1 gene knockout strains (ΔNcMYR1) were established using the CRISPR-cas9 genome editing system to study NcMYR1 gene functions in growth, invasion, replication, egress, and pathogenesis of N. caninum. In addition, the protective efficacies of the ΔNcMYR1 strain as a vaccine against the N. caninum challenge were also assessed in non-pregnant and pregnant mice, and pups.

Methods

Animals, parasites, and cells

Female C57BL/6 mice and BALB/c mice aged 6–8 weeks were purchased from Liaoning Changsheng Biotechnology and maintained in the animal house of the Laboratory Animal Center of Jilin University. The procedures were approved by the Animal Welfare and Research Ethics Committee at Jilin University (IACUC permit number: 20160612). These experiments adhered to the ARRIVE guidelines.

Vero cells (Cell Bank of Type Culture Collection of the Chinese Academy of Science, Shanghai, China) were used to culture N. caninum tachyzoites (Nc-1 strain). The tachyzoites were propagated in Vero cells cultured in Roswell Park Memorial Institute-1640 (RPMI-1640) (Biological Industries, Kibbutz Beit Haemek, Israel) medium supplemented with 1% heat-inactivated fetal bovine serum (Biological Industries, Israel), 2 mm L-glutamine, 100 U mL⁻¹ penicillin, and 100 μg mL⁻¹ streptomycin. Egressed N. caninum tachyzoites were obtained and harvested from Vero cells by cell scraping and were centrifuged at 500 ×g/min for 10 min at room temperature (RT); then, using PBS, N. caninum tachyzoites were resuspended, passed through a 1-ml syringe, and centrifuged at 1,500 ×g for 30 min to remove host cell debris by gradient density centrifugation with a 40% Percoll (GE Healthcare, Uppsala, Sweden) solution (v/v) [19]. Human foreskin fibroblasts cells (HFFs) (Cell Bank of Type Culture Collection of Chinese Academy of Science, China) were cultured in complete Dulbecco’s modified Eagle medium (Biological Industries, Israel) supplemented with 12% FBS, 2 mm L-glutamine, 100 U mL⁻¹ penicillin, and 100 μg mL⁻¹ streptomycin.

Analysis of the NcMYR1 amino acid sequence

The NcMYR1 sequence was identified by searching the ToxoDB (https://toxodb.org/toxo/app). Amino acid sequence alignment was performed among N. caninum (NCLIV_008760), T. gondii (TGGT1_254470, TGFOU_254470, TGMAS_254470, TGME49_254470), Hammondia hammondi (HHA_254470), Cystoisospora suis (CSUI_008403), and Besnoitia besnoiti (BESB_012450) by using clustalw (https://www.genome.jp/tools-bin/clustalw) and ESPript (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). The transmembrane domain, signal peptide, and the other structure domain of NcMYR1 were analysed through SMART (http://smart.embl-heidelberg.de/) and ToxoDB.

Preparation of the anti-NcMYR1 polyclonal antibody

Egressed N. caninum tachyzoites were obtained and harvested from Vero cells by cell scraping, were centrifuged at 500 ×g/min for 10 min at room temperature (RT), then were resuspended using PBS, passed through a 1-ml syringe, and centrifuged at 1,500 ×g for 30 min to remove host cell debris by gradient density centrifugation with a 40% Percoll (GE Healthcare, Sweden) solution (v/v) [20]. Total N. caninum tachyzoite RNA was extracted using TRIZol (Tiangen, Beijing, China), and the cDNA was synthesized by using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Beijing, China). The first strand cDNA was used as the template to amplify the NcMYR1 gene by Polymerase Chain Reaction (PCR). The specific primers for NcMYR1 amplification were shown in Table 1. PCR products of NcMYR1 were purified using a PCR purification kit (Sangon Biotech, Shanghai, China). The purified PCR products of the NcMYR1 gene sequence was inserted into the pET-32a vector. The recombinant NcMYR1 protein was expressed in Escherichia coli BL21 (DE3) and confirmed by SDS-PAGE and western blot. The recombinant pET-32a-NcMYR1 protein was purified by a His-Tagged Protein Purification Kit (CoWin Biosciences, Beijing, China) according to the manufacturer’s instructions [21]. The purified protein was emulsified with Freund’s complete adjuvant (Sigma Aldrich, Shanghai, China) and used to immunize BALB/c mice by subcutaneous injection at the first time, and Freund’s incomplete adjuvant (Sigma Aldrich, China) was used at second and third times. After three times of immunization, the blood was collection by eyeball blood collection, the blood was stored at 4°C overnight, and the serum was collected by centrifuging for 3000 rpm and stored at −20°C.

Table 1.

The primers of NcMYR1 amplification.

Gene ID	Name	Sequences (5’→3’)	Size (bp)
NCLIV_008760	NcMYR1-F	CCGGAATTCATGGCAGGCTATGTCGTGAAG (EcoR I)	2391
	NcMYR1-R	CCCAAGCTTACCGTCCTCGTAGGTGTAGTAC (Hind III)

Immunofluorescence assay

Cover slides were placed into 12-well plates, and Vero cells (1 × 10⁶) were seeded. When the cells covered the bottom of wells, purified tachyzoites were added and cultured for 24 h. N. caninum-infected cells and purified tachyzoites on cover slides permeated with 3% polylysine were fixed with paraformaldehyde and then permeated with 0.25% Triton X-100 for 10 min. After blocking with 3% BSA for 2 h at room temperature, coverslips were then incubated with the anti-NcMYR1 polyclonal antibody (diluted in 3% BSA, prepared in mouse, 1:50) and anti-NcSAG1 polyclonal antibody (diluted in 3% BSA, prepared in rabbit, 1:50) at 4°C overnight. After washing 3 times, the coverslips were incubated with Alexa Fluor 488 Dye conjugated anti-mouse secondary antibody and Alexa Fluor 594 Dye conjugated anti-rabbit secondary antibody (Proteintech, Rosemont, USA, 1:200) for 1 h at room temperature. After the nuclei were counter-stained with DAPI, images were captured with a laser scanning confocal microscope (Fv1000; Olympus, Tokyo, Japan).

Western blot

Purified N. caninum tachyzoites were lysed with lysis buffer (Thermo Fisher Scientific, Waltham, USA) supplemented with nuclease (Sigma-Aldrich.Inc, China). The protein samples were analyzed by 12% (w/v) SDS-PAGE and transferred onto the PVDF membrane. The membrane was blocked with 5% skim milk in phosphate-buffered saline (PBS) for 2 h at room temperature and then incubated with mouse anti-NcMYR1 polyclonal antibody (1:1000, prepared in mouse) or rabbit anti-beta-actin antibody (Cell Signaling Technology, Boston, USA, 1:1000) for at least 12 h at 4°C. After 4 times washing by PBST, the membrane was incubated with HRP-labelled goat anti-mouse IgG or HRP-labelled goat anti-rabbit IgG (Proteintech, USA, 1:5000). The membranes were visualized by the enhanced chemiluminescence (ECL) western blot detection system (Clinx Science Instruments, Shanghai, China).

Construction and identification of the NcMYR1 gene knockout strain (ΔNcMYR1)

The protospacer containing PAM sequence structure in the NcMYR1 gene sequence was identified through http://grna.ctegd.uga.edu/. Homologous sequences (Table 2) were designed through http://nebasechanger.neb.com/. The Nc-pSAG1-Cas9:U6-SgUPRT-NcMYR1 plasmid was constructed with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Massachusetts, USA) and confirmed by sequencing. For the DHFR-NcMYR1 homologous recombinant gene fragment, a pair of primers were designed in the 5’ and 3’ UTR area based on the ToxoDB (NCLIV_008760) with the DHFR added to the 3’ end of the designed primers. The primers were designed with the pNC-DHFR vector (Table 2), PCR was used to amplify DHFR-NcMYR1, and the PCR fragments were obtained by the DiaSpin PCR Product Purification Kit (Sangon Biotech, China) and identified by sequencing.

Table 2.

The primers for the construction of NcMYR1 gene knockout plasmids and DHFR homologous recombinant gene fragments.

Name	Sequences (5’→3’)		Size (bp)
NcMYR1-CRISPR F:	AGAGGTAGTCGTTTTAGAGCTAGAAATAGC			11682
NcMYR1-CRISPR R:	TCTTCGTCCCAAACAACAATGTCCCTTTG
NcMYR1- DHFR-F:	AGTTGGTTCTGTTTTGTCCCGTAAGCTTTACTCGTCGCCAGCAGT			4036
NcMYR1- DHFR-R:	CGGCAGCTAAGGCATACAGGGGTCGGAATTTAGGTCGGAAAAGT

The Nc-pSAG1-Cas9:U6-SgUPRT-NcMYR1 plasmid (6 μg) and the homologous recombinant fragment (2 μg) were mixed and diluted in 400 μL Cytomix buffer. Purified Nc-1 tachyzoites (1 × 10⁷) were electroporated with the above mixture, then quickly added into HFF cells, and cultured with a medium containing 1% FBS and 1 μM methylamine [11,13]. Monoclonal screening was performed in 96-well plates, and all monoclonal strains were identified by PCR (primers in Table 3), western blot, and IFA. The tachyzoites of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were cultivated and purified under the same conditions as the Nc-1 strain.

Table 3.

PCR primers for the identification of the NcMYR1 knockout strain (ΔNcMYR1).

Name	Sequences (5’→3’)	Size (bp)
NcMYR1-validate-F	ATGGCAGGCTATGTCGTGAAG	Negative: 311
NcMYR1-validate-R	GTCCGGCACACCATTTGCACTC	Positive: 4347

Plaque assay

The HFF cells were cultured in 6-well plates [22]. HFF monolayers were infected with purified tachyzoites of Nc-1 and ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains from the same electrotransfection experiment with a multiplicity of infection (MOI) of 1 × 10⁻⁴, respectively. After incubation at 37°C with 5% CO₂ for 7 days, HFF cells were washed three times with sterile PBS, fixed with ethanol for 15 min, and then stained with 2% crystal violet for 30 min at room temperature. The stained wells were washed with distilled water, airdried, and scanned using a Canon digital scanner [23]. The plaque area was measured with Fiji (GitHub, Inc, San Francisco, USA). Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences).

Invasion assay and replication assay

For the invasion assay, Vero cells were infected with Nc-1 and ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains at an MOI of 3, respectively. The cells were incubated at 37°C in RPMI-1640 medium with 1% FBS for 4 h. After washing 3 times with sterile PBS, the cultures were maintained at 37°C for 18 h in RPMI-1640 medium with 1% FBS [22]. IFA was performed using an anti-NcSAG1 primary antibody (diluted in 3% BSA, made in rabbit 1:50) and Alexa Fluor 594 Dye-conjugated anti-rabbit secondary antibody (Proteintech, USA, 1:200) as previously described [22]. The number of PVs and parasites per PV were counted by a fluorescence microscope. In the invasion assay, the percentage of invasion rate is the number of vacuoles per host cells; the percentage of replication rate is the numbers of vacuoles with 1, 2, 4, and 8 tachyzoites per vacuole, respectively. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences).

Egress assay

12-well plates containing HFF cells were infected with Nc-1 and ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains at an MOI of 2 × 10⁻¹ for 24 h, respectively. Egress of tachyzoites was triggered with 8 µM of the Ca²⁺ ionophore A23187 (Abcam, Cambridge, England) for 3 min at 37°C [24]. IFA was performed as described above by using the anti-NcSAG1 antibody. The average number of egressed vacuoles was determined by counting at least 100 PVs per slide. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences).

Virulence assay

Female 6–8 weeks old C57BL/6 mice were intraperitoneally infected with 2.5 × 10⁷ tachyzoites of Nc-1 and ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains, or treated with PBS as the negative control was housed in filter-top cages in an air-conditioned animal facility in the National Experimental Teaching Demonstration Center of Jilin University (Changchun, China). In these experiments, the Nc-1 and ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were resuscitated in vitro with Vero cells. When strains were resuscitated and egressed from host cells, strains were passaged in vitro with Vero cells for several generations. After parasite purification, trypan blue exclusion was used to detect N. caninum viability as previously described [25–27]. In order to test the virulence of parasites before our infection experiments, mice were infected with different strains of tachyzoites. Water and normal mouse food were provided ad libitum. Mice (n = 10 per group) were recorded twice daily for the survival rate for 40 days [28]. To examine the parasite burden and to observe the histopathological changes in tissues, the heart, liver, spleen, lung, kidney, and brain tissues of mice in each group (n = 10 per group) were obtained; mice were euthanized after 5 days post-infection and stored at −20°C [29]. Genomic DNA from these tissues was extracted by the tissue & cell genome extraction kit (Tiangen, China), and the parasite burden in tissues was examined by quantitative PCR [29] (qPCR) using Nc5 primers (Table 4). Amplification, data acquisition, and data analysis were performed, and the cycle threshold values were calculated as described previously [28]. The levels of IL-6, IL-12p40, TNF-α, and IFN-γ [30,31] in serum were detected by enzyme linked immunosorbent assay (ELISA) kits (Thermo Fisher Scientific, USA) according to the instructions at 5 d.p.i. Meanwhile, these tissues were fixed in 10% formalin, and then pathological sections were made with the paraffin section method and stained with hematoxylin–eosin staining as previously described [32]. The histopathological changes were observed under the microscope. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences). These experiments have adhered to the ARRIVE guidelines.

Table 4.

Primers of absolute fluorescence quantitative PCR for N. caninum.

Name	Sequences (5’→3’)	Size (bp)
Nc5-F	ACTGGAGGCACGCTGAACAC	328
Nc5-R	AACAATGCTTCGCAAGAGGAA

Protective effects of the ΔNcMYR1 strain against N. caninum infection in mice

Through the above experiments, we found that plaque area and the rate of invasion; replication; and egress of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were all decreased. Moreover, ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strain-infected C57BL/6 mice all had a 100% survival rate, which means any one of those three strains could be used for immunization. In this experiment, we chose the ΔNcMYR1-1 strain.

70 female C57BL/6 mice were randomly divided into 7 groups (n = 10 per group). Mice in one group were mock infection; one group was intraperitoneally injected, with sterile PBS used as an infection negative control; and mice in other five groups were immunized with 2.5 × 10⁷ ΔNcMYR1-1 tachyzoites for 10 d, 20 d, 30 d, 40 d, and 50 d, respectively. After reaching the immune time of each group, ΔNcMYR1-1 tachyzoite-immunized groups and the non-immunized mice group were intraperitoneally infected with N. caninum Nc-1 tachyzoites (2.5 × 10⁷), respectively, and the mock infection group was intraperitoneally injected with PBS. The survival rate of mice was monitored and recorded twice daily for 40 d after challenged with Nc-1 tachyzoites; the parasite burden in tissue was examined by qPCR; and the levels of IgG, IgG1, IgG2a, IL-6, IL-12p40, TNF-α, and IFN-γ in serum were detected by ELISA (Thermo Fisher Scientific, USA).

To further evaluate the protective effects of the ΔNcMYR1-1 strain against N. caninum infection in pregnant mice and their pups, the female (n = 10) mice were immunized with ΔNcMYR1-1 tachyzoites 2.5 × 10⁷ for 40 days as the immunized group and another mice group was intraperitoneally injected with sterile PBS as a negative control. Then, one male and two female mice were caged together for pregnancy. When the vaginal plugs were observed, the female mice were considered to be fertilized and were isolated and monitored as day 0, and the qualities of female fertilized mice were recorded every day. On day 5 of fertilized, in the infection group, each fertilized mouse was intraperitoneally infected with 1 × 10⁶ N. caninum Nc-1 tachyzoite, in the negative control group, fertilized mice and were intraperitoneally injected with PBS [33]. Mice were monitored daily, and the pregnant rate, abortion rate, and survival rate of pups were recorded and calculated. To further determine the immune protective effect of the ΔNcMYR1-1 strain, the live pups were euthanized on the 40 days after birth, the tissues were collected, and then genome DNA of tissues were extracted and used to detect the parasite burden in the tissue of N. caninum by qPCR. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences). These experiments have adhered to the ARRIVE guidelines.

Statistical analysis

Data was analyzed by GraphPad Prism version 6 (GraphPad, USA). The results were expressed as mean ± SD. Differences among those groups were analyzed by t-test, one-way ANOVA, and two-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 were considered statistically significant.

Results

Sequence analysis, subcellular localization of the NcMYR1 protein, and establishment of the ΔNcMYR1 strain

The NCLIV_008760 gene was identified as NcMYR1 with 2394 bp encoding 797 aa by searching ToxoDB (https://toxodb.org/). The amino acid sequences of NcMYR1 contained a MYR1-like domain at 236–402 aa with a signal peptide (1-21aa) and a transmembrane domain (684-745aa) (Figure S1). The BLAST results showed that NcMYR1 showed a 51% similarity with MYR1 of T. gondii (TGGT1_254470, TGFOU_254470, TGMAS_254470, and TGME49_254470), 47% of H. hammondi (HHA_254470), 50% of C. suis (CSUI_008403), and 47% of B. besnoiti (BESB_012450) (Figure S1). The total protein of N. caninum tachyzoites was extracted, and the NcMYR1 protein in N. caninum was detected by the anti-NcMYR1 polyclonal antibody using western blot. A clear band was observed at 86.8 kDa, which was in accordance with the predicted molecular weight of NcMYR1 (Figure 1(a)), indicating that the prepared polyclonal antibody can recognize the NcMYR1 protein in N. caninum. N. caninum tachyzoite-infected cells and purified tachyzoites were used to examine the localization of the NcMYR1 protein by an immunofluorescence assay. Results showed that the NcMYR1 protein (green fluorescence) was localized in the cytoplasm of N. caninum tachyzoites (Figure 1(b)). To further analyse the function of NcMYR1, three knockout mutants of NcMYR1 were established by the CRISPR/Cas9 gene editing system (Figure 2(a)). The deletion of the NcMYR1 gene of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains was confirmed by PCR (Figure 2(b)). Western blot results also showed that the expression of NcMYR1 was eliminated in ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 tachyzoites (Figure 2(c)). Meanwhile, IFA further confirmed that ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 tachyzoites did not express NcMYR1 protein (Figure 2(d)). These results indicated that ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were successfully established.

Figure 1.

Identification and subcellular localization of NcMYR1 proteins. (a) The total nc-1 strain tachyzoite protein was extracted and detected by western blot using the anti-NcMYR1 serum. (b) N. caninum-infected vero cells and the purified tachyzoites were labeled with anti-NcMYR1 serum, and the localization of NcMYR1 (green) was detected by immunofluorescence assay. The nuclear DNA was stained with DAPI (blue). Scale bar, 5 μm.

Figure 2.

Construction and identification of ΔNcMYR1 strains. (a) Strategy for the construction of the nc-pSAG1-Cas9:U6-SgUPRT-NcMYR1 plasmid expressing Cas9 and a sgRNA in N. caninum. Cas9 was expressed from the SAG1 promoter, and the sgRNA was expressed from the NcU6 promoter. (b) NcMYR1 expression was detected by western blot with anti-NcMYR1 antibodies in Nc-1, ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains. N. caninum actin was used as the control. (c) DHFR homologous fragment in ΔNcMYR1 strains and Nc-1 strain was amplified by PCR. (d) The localization and expression of NcMYR1 (green) in both Nc-1 and ΔNcMYR1 strains were determined by IFA analysis. The nuclear DNA was stained with DAPI (blue). Scale bar, 5 μm.

Growth, invasion, replication, and egress changes of ΔNcMYR1 strains

We assessed the phenotypes changes of ΔNcMYR1 strains by plaque assay, invasion assay, replication assay, and egress assay. The results showed that the plaque areas of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were all significantly reduced compared to that of the Nc-1 strain (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; and ΔNcMYR1-3: p < 0.0001) (Figure 3(a)), and the invasion rates of ΔNcMYR1-1 (26.8% ± 11.6%, p < 0.0001), ΔNcMYR1-2 (14.8% ± 4.4%, p < 0.0001), and ΔNcMYR1-3 strains (16.7% ± 2.8%, p < 0.0001) were all significantly reduced compared with that of the Nc-1 strain (70.6% ± 22.9%) (Figure 3(b)). Meanwhile, the ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 all noticeably weakened replication ability of tachyzoites in cells, which means that ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 groups have more vacuoles with 1 and 2 tachyzoites than those in the Nc-1 group (vacuoles with 1 tachyzoite: p < 0.0001; vacuoles with 2 tachyzoites: p < 0.0001); ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 groups have less vacuoles with 4 and 8 tachyzoites than those in the Nc-1 group (vacuoles with 4 tachyzoites: p < 0.0001; vacuoles with 8 tachyzoites: p < 0.0001) compared with the Nc-1 strain (Figure 3(c)). ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains had significantly decreased egress rates compared to the Nc-1 strain treated with the Ca²⁺ ionophore A23187 (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; and ΔNcMYR1-3: p < 0.0001) (Figure 3(d)). These results indicated that the deletion of NcMYR1 significantly affected the phenotypes of N. caninum.

Figure 3.

Growth, invasion, replication, and egress rates of ΔNcMYR1 strains. (a) Plaque assay (HFFs were infected at an MOI of 1 × 10⁻⁴ with N. caninum tachyzoites) was performed to assess the growth rate of ΔNcMYR1 strains. (b) Invasion assay (vero were infected at an MOI of 3 with N. caninum tachyzoites) was performed after IFA with a mouse anti-NcSAG1 antibody, and the number of PVs was counted. (c) After IFA with mouse anti-NcSAG1 antibody, the replication assay was performed (Vero were infected at an MOI of 3 with N. caninum tachyzoites), and a total of 100 PVs of each strain were counted. (d) The egress (HFFs were infected at an MOI of 2 × 10⁻¹ with N. caninum tachyzoites) was triggered by the Ca²⁺ ionophore A23187 and IFA was performed, at least a total of 100 randomly selected PVs were counted, and the ratio of ruptured vacuoles/total vacuoles was shown. The results represent 3 independent assays. Data are expressed as the mean ± SD from three independent experiments (****p < 0.0001, ns represents no significant differences).

The virulence of the ΔNcMYR1 strain

To clarify whether NcMYR1 is related to the virulence of N. caninum, mice were infected with ΔNcMYR1-1, ΔNcMYR1-2, ΔNcMYR1-3, or Nc-1 strain tachyzoites, respectively. The survival rate, cytokine secretions, parasite burdens, and pathological changes were evaluated in different groups. Mice in the PBS group had a 100% survival rate, but all Nc-1-infected mice died; however, the survival rates in ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3-infected mice were all significantly increased and could reach 100% (Figure 4(a)). The results indicated that NcMYR1 played an essential role in maintaining the virulence of N. caninum. The qPCR data showed that the parasite burdens in the heart (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; ΔNcMYR1-3: p < 0.0001), liver (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.001; ΔNcMYR1-3: p < 0.0001), spleen (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; ΔNcMYR1-3: p < 0.0001), lung (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; ΔNcMYR1-3: p < 0.0001), kidney (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; ΔNcMYR1-3: p < 0.0001), and brain (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; ΔNcMYR1-3: p < 0.0001) from ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3-infected mice were greatly reduced compared to that in Nc-1-infected mice (Figure 4(b)). The secretions of IFN-γ (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; and ΔNcMYR1-3: p < 0.0001), TNF-α (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; and ΔNcMYR1-3: p < 0.0001), and IL-12p40 (ΔNcMYR1-1: p < 0.0001; ΔNcMYR1-2: p < 0.0001; and ΔNcMYR1-3: p < 0.0001) in the serum of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3-infected mice were decreased (Figure 4(c)), whereas no statistical significance was observed in IL-6 secretion (ΔNcMYR1-1: p = 0.5038; ΔNcMYR1-2: p = 0.3853; and ΔNcMYR1-3: p = 0.4793) (Figure 4(c)). Pathological examination results indicated that Nc-1 infection could cause inflammatory cell infiltration and hepatocyte degeneration around the hepatic interlobular vein in the liver; vascular hemorrhage of myocardial fibers in the heart; splenic hemorrhage and aggregation of inflammatory cells in the sheath artery in the spleen; alveolar wall thickening and interstitial pneumonia in the lung; renal tubular epithelial cell degeneration and inflammatory cell infiltration in the kidney; and cerebral congestion, edema, and inflammatory cell infiltration of the brain. However, the pathological changes of the heart, liver, spleen, lung, kidney, and brain were alleviated in ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3-infected mice compared with that in Nc-1-infected mice. Fewer inflammatory cells around the hepatic interlobular veins; relieved myocardial fiber vascular hemorrhage; disappeared inflammatory cell aggregation in the splenic sheath artery; no significant thickening in the lung interstitium; and mild cerebral congestion, edema, and renal tubular epithelial cell lesion were observed (Figure 5). These results indicated that NcMYR1 was involved in the pathogenicity of N. caninum in mice.

Figure 4.

NcMYR1 deficiency impaired the virulence of N. caninum. (a) Mice (n = 10 per group) were infected with a lethal dose (2.5 × 10⁷) of tachyzoites of ΔNcMYR1-1, ΔNcMYR1-2, ΔNcMYR1-3 strains or Nc-1 strains, respectively. The survival rates of mice were recorded for 40 days. (b) At 5 d post-infection, the heart, liver, spleen, lung, kidney, and brain were collected, and the parasite burdens in these tissues were determined by qPCR. Asterisks indicated significant difference. (c) At 5 d post-infection, the serum of mice was collected, and the cytokines IL-6, IFN-γ, TNF-α, and IL-12p40 were detected with ELISA. Data are expressed as the mean ± SD from three independent experiments (***P < 0.001, ****p < 0.0001, ns represents no significant differences).

Figure 5.

Pathological changes of tissues in mice infected with the ΔNcMYR1 strain or Nc-1 strain. Pathological changes in the heart (HE 400×), liver (HE 400×), spleen (HE 400×), lung (HE 400×), kidney (HE 400×), and brain (HE 400×) of C57BL/6 mice infected with ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains or the Nc-1 strain at a dose of 2.5 × 10⁷ or treated with PBS were observed. The black arrows indicated significant pathological changes. Scale bar, 100 μm.

Protective effect of ΔNcMYR1 against Nc-1 infection in mice

We immunized mice with ΔNcMYR1-1 tachyzoites, and the antibody and cytokines were detected by ELISA in blood samples at different days post immunization (d.p.i.). The levels of IgG2a (10 d: p = 0.9077; 20 d: p = 0.0842; 30 d: p < 0.0001; 40 d: p < 0.001; 50 d: p < 0.01), IL-12p40 (10 d: p = 0.4628; 20 d: p = 0.584; 30 d: p < 0.0001; 40 d: p < 0.0001; 50 d: p < 0.0001), and TNF-α (10 d: p > 0.9999; 20 d: p < 0.01; 30 d: p < 0.0001; 40 d: p < 0.0001; 50 d: p < 0.001) in ΔNcMYR1-1-immunized mice peaked at 30 d.p.i. and maintained at a high level at 40 d.p.i. (Figure 6(c,d,f)). The secretions of IgG (10 d: p = 0.821; 20 d: p = 0.4088; 30 d: p < 0.0001; 40 d: p < 0.0001; 50 d: p < 0.001) and IFN-γ (10 d: p > 0.9999; 20 d: p = 0.51; 30 d: p < 0.01; 40 d: p < 0.0001; 50 d: p < 0.0001) increased at 10 d.p.i. and peaked at 40 d.p.i. (Figure 6(a,e)). There was no statistical significance in IgG1 (10 d: p = 0.8811; 20 d: p = 0.8118; 30 d: p = 0.8888; 40 d: p = 0.9682; and 50 d: p = 0.4921) and IL-6 (10 d: p > 0.9999; 20 d: p = 0.9920; 30 d: p = 0.8168; 40 d: p = 0.8188; and 50 d: p = 0.7904) productions (Figure 6(b,g)). These data indicated that the tachyzoites of the ΔNcMYR1-1 strain can stimulate the productions of IgG, IgG2a, IL-12p40, TNF-α, and IFN-γ.

Figure 6.

Secretion of antibodies and cytokines in ΔNcMYR1 strain-immunized mice. The serum in ΔNcMYR1 strain-immunized mice (n = 10) was collected at 0 d, 10 d, 20 d, 30 d, 40 d, and 50 d after immunization. (a) IgG, (b) IgG1, (c) IgG2a, (d) IL-12p40, (e) IFN-γ, (f) TNF-α, and (g) IL-6 productions were detected with ELISA. Data are expressed as the mean ± SD from three independent experiments (**p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences).

Mice were challenged with a lethal dose of Nc-1 tachyzoites at different days post immunization with the ΔNcMYR1-1 strain, and the survival rates and parasite burdens of mice were recorded. After Nc-1-infection, the survival rates of mice were 10%, 10%, 40%, 80%, and 50% in 10, 20, 30, 40, and 50 d.p.i. groups, respectively. It was evident that the survival rate of mice infected with N. caninum at 40 days after ΔNcMYR1-1 vaccination was the highest (Figure 7(a)). Then, we measured parasite burdens in tissues by qPCR. The parasite burdens in the liver (10 d: p < 0.001; 20 d: p < 0.0001; 30 d: p < 0.0001; 40 d: p < 0.0001; and 50 d: p < 0.0001), spleen (10 d: p = 0.9721; 20 d: p < 0.05; 30 d: p = 0.9472; 40 d: p < 0.001; and 50 d: p < 0.001), and kidney (10 d: p < 0.01; 20 d: p < 0.05; 30 d: p < 0.05; 40 d: p = 0.9902; and 50 d: p < 0.05) in immunization groups were significantly reduced (Figure 7(c,d,f)), and no significant changes were observed in the heart (10 d: p = 0.8757; 20 d: p > 0.9999; 30 d: p > 0.9999; 40 d: p = 0.9912; and 50 d: p > 0.9999), lung (10 d: p = 0.9782; 20 d: p = 0.9974; 30 d: p = 0.9952; 40 d: p = 0.9231; and 50 d: p = 0.9989), and brain (10 d: p = 0.7428; 20 d: p = 0.999; 30 d: p = 0.9667; 40 d: p = 0.8369; and 50 d: p = 0.9989) (Figure 7(b,e,g)). These results indicated that ΔNcMYR1-1 could provide effective protection against N. caninum infection.

Figure 7.

Protection of the ΔNcMYR1 strain in mice against Nc-1 tachyzoite infection. (a) The survival rate of ΔNcMYR1 strain immunized mice after challenged with Nc-1 tachyzoites. Mice (n = 10 per group) were immunized with ΔNcMYR1 tachyzoites. After 0 d, 10 d, 20 d, 30 d, 40 d, and 50 d, the mice were challenged with Nc-1 tachyzoites at a lethal dose of 2.5 × 10⁷. One group without any treatment was used as a mock, and one group without immunization was challenged with Nc-1 tachyzoites as a positive control (non-immunized). The survival rates of mice were recorded and analyzed. (b−g) The parasite burdens of tissues in the mice challenged with Nc-1 tachyzoites after ΔNcMYR1 immunization. Mice (n = 10 per group) were immunized with ΔNcMYR1 tachyzoites. After 0 d, 10 d, 20 d, 30 d, 40 d, and 50 d, the mice were challenged with Nc-1 tachyzoites at a dose of 2.5 × 10⁷. 5 days later, the (b) heart, (c) liver, (d) spleen, (e) lung, (f) kidney, and (g) brain were collected, and the parasite burdens in these tissues were determined by qPCR. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns represents no significant differences).

Protective effect of the ΔNcMYR1 strain on the abortion of pregnant mice and survival of their pups

ΔNcMYR1-1-immunized or non-immunized pregnant mice were intraperitoneally infected with N. caninum (Nc-1 strain). The abortion rate and the survival rate of pups were monitored. The results showed that the abortion rate of pregnant mice in the non-immunization group (N. caninum infection) was 71.4% (5/7) and that in ΔNcMYR1-1-immunization+N. caninum infection was 12.5% (1/8) (p = 0.06). 8 pregnant mice did not abort in the mock infection group (Table 5). The number of live pups was significantly increased and the survival rate was 83.3% (20/24) in ΔNcMYR1-1-immunization+N. caninum infection, compared with the 12.5% (1/8) pup survival rate in the non-immunization group (p < 0.001). The survival rate of pups in the mock infection group was 100% (30/30) (Table 5 and Figure 8(a)). These data indicated that ΔNcMYR1-1-immunization could decrease the abortion rate of maternal mice and increase the survival rate of pups.

Table 5.

Abortion rates of pregnant mice, number of born pups, and survival rate of pups.

	Pregnancy rate	Abortion rate	Total born pups	survival rate of pups
Mock infection group	8/10(80%)	0/8(0%)	30/8	30/30(100%)
Non-immunization group	7/10(70%)	5/7(71.4%)	8/2	1/8(12.5%)
Immunization group	8/10(80%)	1/8(12.5%)	24/7	20/24(83.3%)

Figure 8.

The parasite burdens of tissues in the pups. (a) The survival rates of pups were recorded for 40 days, and the analysis of survival rates of pups was made by Kaplan – Meier survival curves. (b) The heart, liver, spleen, lung, kidney, and brain were collected from the pups, and the parasite burdens in these tissues were determined by qPCR. Data are expressed as the mean ± SD from three independent experiments (*p < 0.05, **p < 0.01, ***p < 0.001, ns represents no significant differences).

The parasite burdens in the heart (p < 0.01), spleen (p < 0.05), lung (p < 0.01), kidney (p < 0.05), and brain (p < 0.001) (Figure 8(b)) of pups were significantly decreased in the ΔNcMYR1-1-immunized group when compared to those in the non-immunized group. Parasite burden in the liver (p = 0.2515) between these two groups showed no statistical difference (Figure 8(b)). These indicated that the ΔNcMYR1-1-immunization could reduce the vertical transmission of N. caninum infection in mice.

Discussion

4 MYRs had been found in T. gondii, which localized at PV and PVM in T. gondii-infected cells. TgMYR1 may be a virulence factor that regulates host cell signalling pathways such as PP2A, p38, and c-Myc. Previous studies have shown that TgMYR1 activated the expression of c-Myc and PP2A in host and the phosphorylation level of p-p38. Furthermore, TgMYR1 could regulate TgGRA16 and TgGRA24 from parasites into the host cell nucleus [34]. Subsequent studies showed that GRA16 entered the nucleus and upregulated the proto-oncogene c-Myc, which plays a key role in the growth and division of many animal cells, and abnormally high expression in normal cells may cause cell carcinogenesis [35,36]. In the present study, the amino acid sequence alignment showed that a MYR from N. caninum-designated NcMYR1 containing a MYR1-like domain had a 51% homology to TgMYR1. NcMYR1 possessed a signal peptide in the region from 1 to 21 aa, which is absent in TgMYR1. Similar to TgMYR1, NcMYR1 contained transmembrane domains, which was predicted as a membrane protein. TgMYR1 localized at PV and PVM in T. gondii-infected cells [14]. However, further analysis showed that the NcMYR1 protein localized in the cytoplasm of the parasite, suggesting that the function of NcMYR1 might be different from TgMYR1. TgMYR1 is a secreted protein co-located with TgMYR2 [37], TgMYR3 [15], TgROP17 [38], and TgASP5 [39]. TgMYR1 regulates a variety of secretory proteins from the parasite into host cells by translocating these proteins across PVM, such as GRA16, GRA24, GRA44, and GRA45 [40]. T. gondii MYR1 was associated with host cell c-Myc. We have previously found that NcMYR1 did not regulate the expression of c-Myc in Vero and HFF cells [41] and next further explored whether NcMYR1 had other functions in N. caninum.

The CRIPPR-Cas9 gene editing system is a new technology widely used for gene editing [42], which has been used in the study of the N. caninum gene. Gene knockout strains of NcGRA7 [4], NcGRA17 [28], NcROP5 [6], and NcROP16 [3] using the CRISPR-Cas9 gene editing system showed impaired virulence of N. caninum. TgMYR1 knockout had different influence on the virulence in ME49 and RH strains. The deficiency of TgMYR1 could significantly impair the virulence of the ME49 strain, which showed a 100% survival rate in ΔTgMYR1 ME49 strain-infected mice, whereas the mortality is 100% in ΔTgMYR1 RH strain-infected mice [13]. In the present study, ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were constructed using the CRISPR-Cas9 gene editing system. The survival rate of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strain-infected mice reached 100%. In addition, the parasite burdens in the heart, liver, spleen, lung, kidney, and brain were significantly decreased, and the pathological changes were also alleviated compared with that of the Nc-1 strain group, indicating that NcMYR1 was a new virulence factor of N. caninum. In vitro, the growth of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 was significantly inhibited, which was similar to the previous report on ΔTgMYR1. However, their roles in invasion and replication were different. The deficiency of NcMYR1 significantly reduced the invasion and replication rates, but TgMYR1 deficiency did not [14]. These results suggested that NcMYR1 was a crucial virulence factor and participated in the process of replication, growth, and invasion.

The key strategy for the prevention of N. caninum is vaccine. Now, the only commercial vaccine based on inactivated tachyzoites (Neoguard®, MSD Animal Health, Millsboro, Delaware, USA) was withdrawn from the market due to low immunity efficacy and instability [43]. N. caninum isolated from asymptomatic calves with congenital infection results in a reduced incidence of bovine miscarriage and may be a good vaccine candidate [44]. Two strains of Nc-Nowra and Nc-Spain1H isolated from asymptomatic calves show a good protective effect against the vertical transmission of N. caninum [45–49] when inoculated in cows prior to copulation. NcGRA2, 6, 7, NcROP2, NcSAG1, and NcSRS2 proteins have been identified as vaccine candidate antigens [50–55], but more potential vaccine candidate antigens are also needed. TgMYR1 is regarded as a potential protective antigen, and pVAX1-TgMYR1 DNA immunization can induce Th1/Th2 cellular immune response, increase secretions of IFN-γ and IL-12p40, and prolong the survival time of immunized-mice but fails to increase the survival rate [17]. In this study, the invasion, replication, growth, and egression rates of ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strains were all decreased and the survival rate of mice infected with ΔNcMYR1-1, ΔNcMYR1-2, and ΔNcMYR1-3 strain was 100%, so the ΔNcMYR1 strain could be used as a vaccine strain to immunize mice. The survival rate of mice was 80%, and the parasite burdens in the liver, spleen, and brain were greatly reduced in the ΔNcMYR1-1-immunized-40 days group after a lethal dose of Nc-1 infection, indicating that the ΔNcMYR1-1 strain provided an effective protection against N. caninum infection.

The levels of antibodies and cytokines are an important index of the immunization effect. IgG2a is an important indicator of Th1 immune response, while IgG1 is that of Th2 immune response [56,57]. The effective inductions of Th1-type cytokines (IFN-γ, TNF-α, and IL-12p40) and Th2-type cytokine (IL-6) are key to the development of a vaccine against N. caninum [58–63]. In this experiment, the productions of IgG2a and TNF-α peaked at 30 d and kept at high levels at 40 d post-ΔNcMYR1-1 immunization, while IgG1 was at a low level. At the same time, the secretions of IL-12p40 and IFN-γ in serum peaked at 40 d.p.i. These results correspond to the antibody titer of IgG2a described above, indicating that the ΔNcMYR1-1 strain activated Th1 type immune response. Otherwise, IgG1 and IL-6 were at a low level after immunization, suggesting that Th2 type immune response was not be activated. Our results indicated that ΔNcMYR1-1 immunization provided an effective protection against Nc-1 infection via inducing Th1 type immune response.

Some vaccines for N. caninum have been for immunized pregnant mice. Then, we explored the role in protective vertical transmission caused by N. caninum. Bovilis® Neoguard, an attenuated vaccine for N. caninum, reduced the rate of abortion in dairy cows by 20%. After immunizing pregnant mice with the Nc-Spain1H strain, the mortality rate of pups was reduced to 2.4% and the postnatal mortality rates were 45%, 11%, and 10.8%, respectively [64]. Immunizing mice with GRA7 antigen encapsulated in the liposome increased the survival rates to 75% and 85.3% of mother and pups, respectively, compared to 53.4% and 78.5% in the WT group [65]. The rNcSAG1+rAtHsp81.2 recombinant protein vaccine can prevent abortion caused by N. caninum, and it was found that the vaccine could reduce the abortion rate, which in the vaccine-immunized group was 31.2% compared with the control group of 64.1% [33]. In this experiment, ΔNcMYR1-1 immunization significantly decreased the abortion rate of pregnant mice (12.5%) compared to that of the N. caninum infection group (71.4%). The survival rate of pups was increased from 12.5% (N. caninum infection group) to 83.3% (ΔNcMYR1-1 immunization). These indicated that, as an attenuated vaccine, the ΔNcMYR1-1 strain could not only cause host’s immune response to resist N. caninum infection but also to prevent vertical transmission of N. caninum, thereby reducing the host abortion rate and increasing the survival rate of pups.

Conclusions

In the present study, we found that NcMYR1 localized in the cytoplasm of N. caninum tachyzoites, which was critical for the processes of growth, invasion, and replication and was a virulence factor in N. caninum. ΔNcMYR1 could mainly induce Th1 immune response, provide an effective protection against N. caninum infection, and increase the abortion rate of mice and the survival rate of pups, indicating that the ΔNcMYR1 strain may be a promising vaccine candidate for neosporosis.

Funding Statement

This work was funded by the Jilin Provincial Scientific and Technological Development Program [grant nos. 20240303078NC and 20230505043ZP]. The experiments conducted in this study comply with the current laws of China.

Abbreviations

N. caninum

Neospora caninum

T. gondii

Toxoplasma gondii

SDS-PAGE

sodium dodecyl sulphate–polyacrylamide gel electrophoresis

PBST

phosphate Buffered Saline with Tween-20

MYR1

proto-oncogene (c-Myc) regulation protein 1

IgG

immunoglobulin G

IL-6

interleukin-6

IL-12

interleukin 12

TNF-α

tumor necrosis factor-α

IFN-γ

interferon gamma

ROP

rhoptry protein

MIC

microneme protein

GRA

dense granule antigen

SAG

surface antigen

SRS

SAGs-related sequences

HFF

human foreskin fibroblasts cells

PCR

polymerase Chain Reaction

DAPI

4’,6-diamidino-2-phenylindole

CRISPR-Cas9

Clustered Regularly Interspaced Short Palindromic Repeats

ELISA

enzyme linked immunosorbent assay

qPCR

Real-time Quantitative PCR Detecting System

d.p.i.

days post immunization

Disclosure statement

No potential conflict of interest was reported by the author(s).

Animal welfare statement

All animal experiments were conducted in strict accordance with the Regulations for the Ad-ministration of Affairs Concerning Experimental Animals approved through the State Council of the People’s Republic of China (1988.11.1) and approved by the Animal Welfare and Research Ethics Committee of Jilin University (IACUC permit number: 20160612).

CRediT author statement

Boya Du and Mengge Chen designed this experimental work, and were involved in the work processing and preparation of the manuscript. Xu Zhang, Xiaocen Wang, and Le Chang participated in in vitro experiments. Xuancheng Zhang participated in data analysis. Pengtao Gong participated in the work of in vivo immunization protection experiments. Nan Zhang assisted with the experimental design of stimulation experiments. Xichen Zhang participated in data analysis. Jianhua Li and Xin Li participated in supervision, project administration, funding acquisition, and final approval of the version to be published. All authors read and approved the final manuscript.

Data availability statement

The data associated with this article is openly available at [Figshare]: DOI: https://doi.org/10.6084/m9.figshare.26870488.

Supplemental data

Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2024.2427844