GLP-1RA improves diabetic renal injury by alleviating glomerular endothelial cells pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway

Weixi Wu; Yao Wang; Xian Shao; Shuai Huang; Jian Wang; Saijun Zhou; Hongyan Liu; Yao Lin; Pei Yu

doi:10.1371/journal.pone.0314628

. 2024 Dec 2;19(12):e0314628. doi: 10.1371/journal.pone.0314628

GLP-1RA improves diabetic renal injury by alleviating glomerular endothelial cells pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway

Weixi Wu ^1,^2,^#, Yao Wang ^1,^2,^#, Xian Shao ^1,^2,^#, Shuai Huang ^1,², Jian Wang ^1,², Saijun Zhou ^1,², Hongyan Liu ^1,², Yao Lin ^1,², Pei Yu ^1,^2,^*

Editor: Joel Montané³

PMCID: PMC11611192 PMID: 39621727

Abstract

Background

Lipotoxicity has been implicated in diabetic kidney disease (DKD). However, the role of high glucose levels in DKD and the underlying renal protective mechanisms of GLP-1 receptor agonists (GLP-1RAs) remain unclear.

Methods

To investigate cholesterol accumulation, pyroptosis in glomerular endothelial cells (GEnCs), and the renal protective mechanisms of GLP-1RAs, we used various techniques, including RT-qPCR, Oil Red O staining, Western blotting, lactate dehydrogenase (LDH) activity assays, circRNA microarrays, bioinformatics analysis, gain and loss-of-function experiments, rescue experiments, and luciferase assays. Additionally, in vivo experiments were conducted using C57BL/6J and ApoE-deficient (ApoE^-/-) mice.

Results

GEnCs exposed to high glucose exhibited reduced cholesterol efflux, which was accompanied by downregulation of ATP-binding cassette transporter A1 (ABCA1) expression, cholesterol accumulation, and pyroptosis. Circ8411 was identified as a regulator of ABCA1, inhibiting miR-23a-5p through its binding to the 3’UTR. Additionally, higher glucose levels decreased circ8411 expression by inhibiting RXRα. GLP-1RAs effectively reduced cholesterol accumulation and cell pyroptosis by targeting the RXRα/circ8411/miR-23a-5p/ABCA1 pathway. In diabetic ApoE^-/- mice, renal structure and function were impaired, with resulted in increased cholesterol accumulation and pyroptosis; however, GLP-1RAs treatment reversed these detrimental changes.

Conclusions

These findings suggest that the RXRα/circ8411/miR-23a-5p/ABCA1 pathway mediates the contribution of high glucose to lipotoxic renal injury. Targeting this pathway may represent a potential therapeutic strategy for patients with DKD and hypercholesterolemia. Moreover, GLP-1RAs may provide renal protective effects by activating this pathway.

Introduction

Diabetic kidney disease (DKD) is a leading cause of end-stage renal disease (ESRD) [1], which poses a significant health and economic burden [2]. Current strategies to prevent or treat DKD have limited efficacy, such as the management of blood glucose, blood pressure, and urinary protein excretion. This limitation can be attributed to an insufficient understanding of the underlying pathophysiological mechanisms [3].

Numerous studies have established a strong association between abnormal lipid metabolism and DKD. The accumulation of triglycerides (TG) and cholesterol in the kidneys has been implicated in the pathogenesis of DKD [4–6]. Lipotoxicity, which is characterized by the dysregulation of intracellular homeostasis due to lipid accumulation, leads to metabolic, inflammatory, and oxidative stress [7]. Hyperlipidemia, oxidized low-density lipoprotein (ox-LDL), and cholesterol crystals have been shown to activate caspase-1 in endothelial cells, thereby triggering pyroptosis [8,9]. Pyroptosis is an inflammatory process that is characterised by the release of pro-inflammatory factors, including interleukin-1β (IL-1β), IL-18, and lactate dehydrogenase (LDH). These factors can contribute to a more pronounced inflammatory response[10]. However, the specific mechanisms underlying pyroptosis in the context of DKD development remain unclear.

There is an increasing consensus that glomerular endothelial cells (GEnCs) play a critical role in the development and progression of DKD [11–13]. The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of cholesterol efflux from cells, promoting the removal of cholesterol [14–16]. Previous researches suggest that ABCA1 expression in GEnCs may help to prevent endothelial dysfunction [5,17].

ABCA1 is a plasma membrane protein that serves as a key regulator of cholesterol efflux from cells[18,19]. In vitro studies have demonstrated that stimulation of high glucose can downregulate ABCA1 expression in renal cells, and a similar decrease in ABCA1 has been observed in diabetic and nephrotic mouse models [20,21]. Furthermore, our previous research indicated that the dysregulation of glucose and cholesterol metabolism can impair ABCA1 function [22]. Collectively, these findings suggest that dysregulation of ABCA1 may contribute to cholesterol accumulation in the kidney.

Noncoding RNAs (ncRNAs) are a class of RNAs that do not encode proteins. A specific subset of ncRNAs are known as circular RNAs (circRNAs). CircRNAs are characterized by a covalently closed loop formed through a back-splicing process [23]. CircRNAs can act as microRNA (miRNA) sponges or interact with RNA-binding proteins, thereby regulating gene expression [24]. They have been identified as key regulators in various diseases [25]. However, the potential role of circRNAs in the progression of DKD remains unexplored. The glucose-like peptide-1 receptor (GLP-1R) and its agonists (GLP-1RAs) have shown protective effects against oxidative stress and macrophage activation in DKD [26]. Specifically, Exendin-4, a GLP-1RA, has been shown to ameliorate lipotoxicity-induced injury in GEnCs by enhancing ABCA1-mediated cholesterol efflux [27,28]. Based on these findings, we hypothesize that GLP-1RAs may exert their renal protective effects in DKD by regulating lipotoxicity-induced pyroptosis in GEnCs through the modulation of ABCA1. Notably, circRNAs may play a significant role in this regulatory process.

Materials and methods

Cell culture experiments

The GEnCs (SienCell, United States) were cultured in an endothelial cell culture medium. To investigate the effects of high glucose and high cholesterol on GEnCs, the cultures were divided into four groups: a low glucose control group (LG, 5.5 mmol/L D-glucose), a high glucose group (HG, 25.5 mmol/L D-glucose), a high cholesterol group (HC, 400 μg/ml water-soluble cholesterol, Sigma, United States), and a combined high glucose and high cholesterol group (HG+HC, 25.5 mmol/L D-glucose + 400 μg/ml water-soluble cholesterol).

Animal experimental design

Animal experiments were conducted with the approval of the Tianjin Medical University Animal Ethics Committee. Male mice of the C57BL/6J and ApoE^-/- strains (6 weeks old) were obtained from the Huafukang Animal Center, Beijing, China, and housed at the Laboratory Animal Center of the Tianjin Key Laboratory of Metabolic Diseases, Chu Hsien-I Memorial Hospital. The mice were divided into seven groups: a wild-type control group(WT-NC), a diabetic C57BL/6J group(WT-DM), an ApoE^-/- group(ApoE^-/-), a diabetic ApoE^-/- group(ApoE^-/-DM), and three diabetic ApoE^-/- groups treated with liraglutide, loxenatide, or insulin. All groups except the wild-type control and ApoE^-/- groups were fed a Western diet and injected with low-dose streptozotocin (50 mg/kg) in citrate buffer after an overnight fast. Mice with a random blood glucose level exceeding 16.7 mmol/L for three consecutive days were considered diabetic. The wild-type control and ApoE^-/- groups were injected with citrate buffer only. All mice were maintained on their respective diets until the conclusion of the study. The ApoE^-/-DM+Lira group received subcutaneous injections of liraglutide (0.2 nmol/kg/day), while the ApoE^-/-DM+Loxenatide group received subcutaneous injections of loxenatide (0.3 nmol/kg/week) for eight weeks following the induction of diabetes. Moreover, we incorporated an insulin-treated diabetic ApoE^-/- group into our study to investigate whether the beneficial renal effects of GLP-1RAs were independent of their glycemic control capabilities. All mice were subjected to endpoint metabolic cages, where their food consumption, water intake, and urine output were recorded over a 24 hours period. To minimize distress, the mice were closely monitored throughout the study and were euthanized prior to reaching the humane endpoint. The mice were sacrificed by cervical decapitation under anesthesia, utilizing inhalation of 5% isoflurane. Blood and tissue samples were collected and subsequently allocated for various assays. The kidneys were preserved in liquid nitrogen for future analysis.

Quantification of total cholesterol

Enzymatic colorimetric assays were performed using a cholesterol determination kit from Jiancheng Bioengineering (Nanjing, China) to quantify cholesterol levels in GEnCs. Six-well plates containing GEnCs were subjected to ultrasonic disruption, followed by cell lysis. The resulting lysates were then processed according to the manufacturer’s protocol for the total cholesterol assay. Absorbance measurements were taken at a wavelength of 510 nm using a microplate reader to determine the cholesterol concentration in the samples.

Immunofluorescence

Concentration of 4% Paraformaldehyde was applied to the cells for 30 minutes. This was followed by the application of goat serum at a concentration of 5%. Subsequently, a primary antibody from Abcam, diluted 1:200, was incubated with the cells overnight at a temperature of 4 degrees Celsius. A secondary antibody, a FITC-conjugated goat anti-rat IgG (H+L) obtained from Sun Gene Biotech, China, was then incubated with the cells for a period of 1 hour in a dark environment. The nucleus were stained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 minutes. Finally, fluorescence microscopy was employed to visualize the cells.

Cell death assay

The release of LDH was employed as a biomarker to assess pyroptotic cell death. Cells cultured in six-well plates were subjected to ultrasonic disruption to lyse the cells. Following this, the LDH activity within the lysate was quantified using an LDH assay kit obtained from Jiancheng Bioengineering in Nanjing, China. The manufacturer’s guidelines were strictly adhered to during the execution of the assay. To measure the absorbance of the resulting reaction mixture, a microplate reader was utilized, with readings taken at a wavelength of 450 nm.

Cell transfection

A circ8411-pcDNA3.1 plasmid and a control plasmid, siRNAs targeting circ8411 and its negative control RNA (si-NC), a miR-23a-5p mimic, and its negative control were obtained from GenePharma (Shanghai, China). GEnCs were transfected with these plasmids using the Lipofectamine 2000 system (Thermo Fisher Scientific) according to the manufacturer’s instructions. The specific siRNA sequences used are listed in Table 1.

Table 1. The primer sequences for cell transfection.

Si-circ8411-1	5’-`CCACUCUGUACCUGGGACGTT`-3’
Si-circ8411-1	5’-`CGUCCCAGGUACAGAGUGGTT`-3’
Si-circ8411-2	5’-`GUACCUGGGACGCUGGGGUTT`-3’
Si-circ8411-2	5’-`ACGUGACACGUUCGGAGAATT`-3’
miR-23a-5p mimic	5’-`GGGGUUCCUGGGGAUGGGAUUU`-3’
miR-23a-5p mimic	5’-`AUCCCAUCCCCAGGAACCCCUU`-3’
miR-23a-5p	5’-`UUCUCCGAACGUGUCACGUTT`-3’
mimic NC	5’-`ACGUGACACGUUCGGAGAATT`-3’

Open in a new tab

RNA isolation and quantitative real-time PCR analyses

The Trizol Reagent (Invitrogen, Waltham, the United States) was employed to extract the total RNA from GEnCs following transfection with circ8411-pcDNA3.1 or siRNA, miR‐125a‐5p mimic, or treatment with drugs. Subsequently, cDNA was synthesized from RNA using a reverse transcription set (Takara, China). Quantitative real-time polymerase chain reactions (RT-qPCR) were conducted using SYBR Green Master (Takara, Beijing, China) and CFX96 real-time PCR detection systems (Bio-Rad, United States), with the primer sequences listed in Table 2.

Table 2. The primer sequences for RT-qPCR.

ABCA1	5’-`GCAGGCAATCATCAGGGTGC`-3’
	5’-`TTCAGCCGTGCCTCCTTCTC`-3’
Caspase-1	5’-`TCAGCAGCTCCTCAGGCAGTG`-3’
	5’-`AAGACGTGTGCGGCTTGACTTG`-3’
GSDMD	5’-`GCCAGAAGAAGACGGTCACCATC`-3’
	5’-`TTCGCTCGTGGAACGCTTGTG`-3’
IL-1β	5’-`GCGGCATCCAGCTACGAATCTC`-3’
	5’-`AACCAGCATCTTCCTCAGCTTGTC`-3’
circ1692	5’-`AGGAGACCATGGTTCCACCC`-3’
	5’-`CCTCAACAGGCTGAGCAGGA`-3’
circ8411	5’-`AGGAGACCATGGTTCCACCC`-3’
	5’-`CCTCAACAGGCTGAGCAGGA`-3’
circ1477	5’-`CTGGTCGCACAGGCACAAA`-3’
	5’-`TTCGCTCGTGGAACGCTTGTG`-3’
circ31366	5’-`GAATAGCTGCGCTTCCCTGG`-3’
	5’-`GGAGAGCCACTCAAACATGTTGA`-3’
RXRα	5’-`AAGATGCGGGACATGCAGAT`-3’
	5’-`CGAGAGCCCCTTGGAGTCA`-3’
HIF-1a	5’-`CTGCCACTGCCACCACAACTG`-3’
	5’-`TGCCACTGTATGCTGATGCCTTAG`-3’
C/EBPα	5’-`TCGGTGGACAAGAACAGCAACG`-3’
	5’-`GGCGGTCATTGTCACTGGTCAG`-3’
GAPDH	5’-`ATGGGGAAGGTGAAGGTCG`-3’
	5’-`GGGGTCATTGATGGCAACAATA`-3’

Open in a new tab

Western blot analysis

Protein extraction from treated cells was accomplished by lysing them in a RIPA lysis buffer supplemented with a protease inhibitor cocktail. Subsequently, the proteins were separated on a polyacrylamide gel denatured with sodium dodecyl sulfate (SDS). Following this, the proteins were transferred onto a nitrocellulose (NC) membrane with a concentration of 8–10% SDS. After blocking with 5% skim milk, the membranes were incubated with primary antibodies specific for ABCA1, Caspase-1, GSDMD, N-GSDMD (Abcam), RXRa (ABclonal), and Anti-β-actin (ProteinTech), GAPDH (ABclonal)) at 4°C overnight. Subsequent to washing, the membranes were incubated with secondary antibodies conjugated with horseradish peroxidase (1:3000–5000; Sanjian, Tianjin, China). Finally, Immobilon Western Chemiluminescent HRP Substrate (Thermo Fisher Scientific) was utilized to visualize the protein.

Microarray analysis

Total RNA was extracted from GEnCs utilizing TRIzol reagent, a commercially available product obtained from Invitrogen, a company headquartered in Waltham, United States. CircRNA microarrays were subsequently analyzed using Affymetrix arrays procured from CapitalBio Corporation, Beijing, China. The microarray hybridization process was conducted in strict adherence to the standardized protocols established by Affymetrix.

Luciferase assay

The wild-type and mutant circ8411 UTR sequences were inserted into the luciferase reporter vector pmirGLO. Subsequently, these luciferase vectors were transfected into 293T cells expressing either mimic of miR-23a-5p or negative control sequences using Lipofectamine 2000. To assess relative luciferase activity, a Dual Luciferase Reporter Assay kit (Promega, American) was employed. The lysates obtained were analyzed for both firefly and Renilla luciferase activity. Variations in transfection efficiency were determined by measuring Renilla luciferase activity.

Biochemical measurements and morphological analysis of kidneys

Blood samples were collected at the study’s conclusion through a cardiac puncture procedure using heparinized syringes to prevent clotting. These samples were immediately chilled on ice and then centrifuged at a speed of 5000 g for 10 minutes at a temperature of 4°C. The liquid portion of the blood, known as plasma, was promptly frozen at -80°C for future analysis. To standardize the biochemical measurements obtained from urine samples, the total urine output over a 24-hour period was collected using specialized metabolic cages, as previously described. Blood urea nitrogen (BUN), serum creatinine (Scr), plasma total cholesterol (TC), low-density lipoprotein cholesterol (LDL-c), high-density lipoprotein cholesterol (HDL-c), plasma triglycerides (TG), and urinary protein quantity (UTP) were quantified using a biochemical autoanalyzer equipped with commercial kits. Blood glucose levels were measured with a glucose analyzer.

Hematoxylin and eosin (H&E) staining

After the study, the kidneys were removed and weighed individually. A portion of the right kidney was preserved in a 4% paraformaldehyde fixation solution for 24 hours, followed by an additional 24 hours in 70% ethanol. After being perfused with 0.01 mol/L PBS for 10 minutes, the tissue was embedded in paraffin and cut into 4 μm sections. Histological examination was conducted using a light microscope, employing H&E staining according to the manufacturer’s established protocol.

Statistical analysis

Data were presented as the “mean ± standard deviation (SD)”. To compare two groups, a Student’s t-test was employed. For comparisons involving multiple groups, a one-way analysis of variance (ANOVA) was conducted. Statistical significance was defined as a p-value less than 0.05. The statistical analysis was performed using Prism 8.0 software (GraphPad, La Jolla, CA, USA).

Results

High glucose exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load in GEnCs

CCK8 assay and Oil Red O staining were employed to determine the optimal concentration and time for cholesterol. Based on the results, 400 μg/ml cholesterol and 24 hours were identified as optimal intervention concentration and time for GEnCs (Fig 1A and 1B). The treatment of GEnCs with varying concentrations of glucose and cholesterol demonstrated a gradual elevation in ABCA1 mRNA expression with increasing cholesterol levels (Fig 1D), and the reduction in ABCA1 mRNA was most pronounced when cells were treated with 25.5mmo/L glucose (Fig 1E and 1F). Accordingly, 400 μM cholesterol and 25 μM glucose were selected as the intervention concentrations for the subsequent cell experiments. When compared to high glucose or high cholesterol individually, intracellular cholesterol accumulation was significantly elevated in cells treated with a combination of high glucose and high cholesterol (Fig 1G and 1H). Furthermore, the results demonstrated that ABCA1 levels were downregulated in the HG group compared to LG and significantly upregulated in the HC group. ABCA1 expression was significantly downregulated in the HG and HC groups compared to HC (Fig 1I–1K). In summary, these findings suggest that high glucose may exacerbate intracellular cholesterol accumulation under conditions of cholesterol overload, the process may be mediated by ABCA1.

Fig 1 — (A) CCK-8 assay was used to evaluate the influence of water-soluble cholesterol on GEnCs viability (*P < 0.05 vs. Cho-0μg/ml group; **P < 0.01 vs. Cho-0μg/ml group, ***P < 0.001 vs. Cho-0μg/ml group). (B)Representative images of Oil red O staining of GEnCs treated with different concentrations of cholesterol and the quantitative assessment(×400, bar = 50μm; ***P < 0.001 vs. Cho-0μg/ml group). (C) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. Cho-0μg/ml group; **P < 0.01 vs. Cho-0μg/ml group). (D)The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR with different cholesterol concentrations (**P < 0.01 vs. Cho-0 μg/ml group, ***P < 0.001 vs. Cho-0μg/ml group). (E) The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR after intervention with different glucose concentrations without cholesterol(*P < 0.05 vs. Glu-5.5mmol/L group). (F) The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR after intervention with different glucose concentrations under cholesterol load (#P < 0.05 vs. Cho-400μg/ml+Glu-5.5mmol/L group). (G) Representative images of Oil red O staining of GEnCs and the quantitative assessment(×400, bar = 50μm; ##P < 0.01 vs. HC, ***P < 0.001 vs. LG group). (H) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. LG group, **P < 0.01 vs. LG group; ***P < 0.001vs. LG group). (I) RT-qPCR analysis to determine ABCA1 mRNA expression (***P < 0.001 vs. LG group; #P < 0.05 vs. HC group). (J) Western Blot analysis to determine ABCA1 protein expression (***P < 0.001 vs. LG group; #P < 0.05 vs. HC group). (K) Representative images of Immunofluorescence staining of ABCA1(red) in GEnCs(×200, bar = 100μm). Nucleus were stained with DAPI (blue).

To investigate the influence of cholesterol accumulation on cellular pyroptosis, the occurrence of pyroptosis in GEnCs was examined. RT-qPCR and Western blotting revealed that compared to LG conditions, the expression of pyroptosis markers such as caspase-1, gasdermin D (GSDMD), and IL-1β was elevated in HG or HC conditions. Moreover, a more pronounced increase in pyroptosis markers was observed in the combined HG+HC condition compared to HG or HC alone (Fig 2A and 2B). These findings were further supported by the release of LDH (Fig 2C). To assess the impact of ABCA1 expression on the pyroptosis of GEnCs under cholesterol load, 4,4’-diisothiocyanatostilbene-2,2’-disulfonic acid (DIDS), an inhibitor of ABCA1, was employed to suppress ABCA1 expression. A significantly reduction in ABCA1 expression was observed in cells treated with 400 μmol/L DIDS under high glucose and cholesterol conditions (Fig 2D and 2E). Concurrently, the inhibition of ABCA1 led to cholesterol accumulation (Fig 2F and 2G), accompanied by significant increases in the expression of caspase-1, GSDMD, IL-1β, and the release of LDH (Fig 2H–2J). These results suggest that high glucose may exacerbate pyroptosis in GEnCs under cholesterol load by decreasing the expression of ABCA1.

Fig 2 — (A,B) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs under the condition of high glucose or/and high cholesterol (*P < 0.05 vs. LG group,**P < 0.01 vs. LG group; #P < 0.05 vs. HC group, ##P < 0.01 vs. HC group). (C) The release of LDH of GEnCs treated with different conditions(*P < 0.05 vs. LG group, **P < 0.01 vs. LG group; ##P < 0.01 vs. HC group). (D,E) RT-qPCR and Western Blot analysis to determine ABCA1 expression of GEnCs treated with different concentrations of DIDS (*P < 0.05 vs. HG+HC+DIDS-0μmmol/L group,***P < 0.001 vs. HG+HC+DIDS-0μmmol/L group). (F) Representative images of Oil red O staining and analysis of GEnCs treated with 400 μmol/L DIDS (×400, bar = 50μm; **P < 0.01 vs. HG+HC group). (G) Cholesterol quantification experiment was conducted to determine intracellular cholesterol content (*P < 0.05 vs. HG+HC group). (H,I) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with 400 μmol/L DIDS (*P < 0.05 vs. HG+HC group; **P < 0.01 vs. HG+HC group, ***P < 0.001 vs. HG+HC group). (J) Release of LDH of GEnCs treated with 400 μmol/L DIDS (***P < 0.001 vs. HG+HC group).

Circ8411/miR-23a-5p is involved in the regulation of ABCA1

The heat map presented in Fig 3A illustrates the microarray data of aberrantly expressed circRNAs. The circRNA microarray results revealed that, compared to the HC group, the HG+HC group exhibited 611 downregulated and 279 upregulated circRNAs (|logFC| >1.5) (S1 Table). Among the downregulated circRNAs, four candidate circRNAs (circ1692, circ8411, circ1477, and circ31366) were identified based on a |logFC| threshold of >2.0. To investigate its potential biological role in GEnCs, circ8411 was selected for further study (Fig 3B). To examine whether circ8411 expression is responsive to cellular glucose and cholesterol levels, we evaluated circ8411 expression in GEnCs treated with high glucose and cholesterol. Our findings indicated that circ8411 levels increased in the HC group compared to the LG or HG groups but decreased in the HG+HC group (Fig 3C). Additionally, GEnCs were transfected with small interfering RNAs (siRNAs) targeting circ8411 or a control siRNA, as well as empty vectors and circ8411 plasmids, we observed that circ8411 expression was lower in cells transfected with siRNA-1 or siRNA-2 than the negative control siRNA (NC-si), and siRNA-1 demonstrated superior transfection efficiency (Fig 3D). As depicted in Fig 3J–3L, the knockdown of circ8411 using siRNA-1 under LG or HG+HC conditions significantly decreased ABCA1 expression, exacerbated cholesterol accumulation, increased the expression of caspase-1, GSDMD, and IL-1β, and promoted the release of LDH. Conversely, overexpression of circ8411 in GEnCs yielded the opposite effects (Fig 3M–3T).

circRNAs have historically been recognized as miRNA sponges, playing a role in regulating miRNA activity. Consequently, we sought to investigate the potential ceRNA function of circ8411. Yang et al.[29] demonstrated that miR-23a-5p could suppress the expression of ABCA1. In our study, a significant decrease in miR-23a-5p levels was observed in HC, and this change was reversed in HG+HC (Fig 4A). This pattern is in contrast to the expression levels of circ8411 and ABCA1. Bioinformatics analysis suggested that circ8411 might act as a ceRNA for miR-23a-5p. Our findings revealed that knocking down circ8411 led to an increase in miR-23a-5p expression (Fig 4B) while overexpressing circ8411 resulted in a noticeable decrease in miR-23a-5p expression (Fig 4C). Furthermore, miR-23a-5p mimic reduced ABCA1 expression (Fig 4E). We observed that overexpressing miR-23a-5p could repress ABCA1 expression, and this repression was abrogated by the overexpression of circ8411 (Fig 4F and 4G). The results from our luciferase assay showed that the luciferase activity in the circ8411-3’UTR-WT+miR-23a-5p mimic group was significantly lower compared to the circ8411-3’-UTR-WT+miR-23a-5p-NC group. There was no significant difference in luciferase activity between the circ8411-3’UTR-WT+miR-23a-5p mimic and circ8411-3’ UTR-WT+miR-23a-5p mimic groups (Fig 4H).

Fig 4 — RT-qPCR analysis to determine miR-23a-5p in the GEnCs under different conditions (**P < 0.01 vs. LG group; ###P < 0.001 vs. HG group). (B) RT-qPCR analysis to determine miR-23a-5p expression with the knockdown of circ8411(**P < 0.01 vs. LG+si-NC group, ##P < 0.01 vs. HG+HC+si-NC group). (C) RT-qPCR analysis to determine miR-23a-5p expression with the overexpression of circ8411 (**P < 0.01 vs. LG+circ8411-vector group, ##P < 0.01 vs. HG+HC+circ8411-vector group). (D) RT-qPCR analysis to determine the overexpression efficiency of miR-23a-5p in cells treated with the miR-23a-5p mimic (***P < 0.001 vs. miR-23a-5p mimic-NC group). (E) RT-qPCR analysis to determine the expression of ABCA1 in cells treated with the miR-23a-5p mimic (**P < 0.01 vs. HG+HC+mimic-NC group). (F) Rescue experiments to determine the regulatory effect of circ8411/miR-23a-5p/ABCA1 in GEnCs (*P < 0.05 vs. HG+HC+mimic-NC group, #P < 0.05 vs. HG+HC+mimic-miR-23a-5p+circ8411 vector group). (G) Western blot analysis to determine expression of ABCA1 in rescue experiments(*P < 0.05 vs. HG+HC+mimic-NC group; #P < 0.05 vs. HG+HC+mimic-miR-23a-5p+circ8411 vector group). (H) Luciferase reporter assay on GEnCs co-transfected with circ8411-3’UTR-WT or circ8411-3’UTR-MUT and miR-23a-5p mimic or NC (**P < 0.01 vs. mimic-NC group).

We observed that elevated glucose levels can decrease the expression of circ8411. However, additional research is necessary to fully understand the underlying molecular mechanisms. One potential explanation is that high glucose concentrations may interfere with the transcription of circ8411 by transcription factors (TFs). Bioinformatics tools (Gene, PROMO, JASPAR) predicted and identified three TFs (CEBP/α, RXRα, HIF-1a) as potential regulators. Among these, CEBP/α and RXRα exhibited significantly decreased expression in GEnCs cultured in HG+HC group compared to those cultured in HC group (Fig 5A). RXRα was selected for further investigation in the subsequent study. To suppress RXRα expression effectively in GEnCs, we employed different concentrations of UVI3003. Treatment with 10 μmol/L UVI3003 resulted in a noticeable decrease in RXRα expression (Fig 5B). Moreover, inhibiting RXRα led to downregulation of circ8411α and ABCA1 (Fig 5C–5E). These findings suggested that RXRα may play a role in the transcriptional regulation of circ8411.

Fig 5 — (A) RT-qPCR analysis to determine the expression of RXRα, CEBP/α, Hif-1a in the GEnCs undering glucose and cholesterol (*P < 0.05 vs. HC group, **P < 0.01 vs. HC group). (B) The mRNA expression of RXRα in GEnCs treated with different concentrations of UVI3003 (*P < 0.05 vs. UVI3003-0μmol/L group). (C) The mRNA expression of Circ8411 in GEnCs treated with 10 μmol/L UVI3003(**P < 0.01 vs. NC group). (D)The mRNA expression of ABCA1 expression in GEnCs treated with 10 μmol/L UVI3003 (*P < 0.05 vs. NC group). (E) Representative Western blot images and quantitative data of ABCA1 in GEnCs treated with 10 μmol/L UVI3003(**P < 0.01 vs. UVI3003-0μmol/L group).

GLP-1RA attenuated cholesterol accumulation and pyroptosis in GEnCs through RXRα-circ8411-miR-23a-5p-ABCA1

We investigated the impact of GLP-1RAs on the expression of ABCA1 in GEnCs exposed to HG+HC. Our findings revealed that liraglutide and loxenatide enhanced the viability of GEnCs in HG+HC and upregulated ABCA1 expression. Specifically, ABCA1 expression was significantly elevated in GEnCs treated with 1000 nmol/L liraglutide and 80 nmol/L loxenatide in HG+HC (Fig 6A–6D). Additionally, we observed that liraglutide and loxenatide treatments decreased cholesterol accumulation and pyroptosis in GEnCs (Fig 6E–6N). Furthermore, we found that the expression of caspase-1, GSDMD, IL-1β, and the release of LDH were reduced in the treatment groups compared to the control group (Fig 6I–6N). These results suggest that liraglutide and loxenatide upregulate ABCA1 expression and ameliorate cholesterol accumulation and pyroptosis in GEnCs. To delve deeper into the underlying mechanisms through which GLP-1RAs influence ABCA1-mediated cholesterol efflux, we examined the expression of RXRα, circ8411, and miR-23a-5p in GEnCs. As depicted in Fig 6O–6T, we demonstrated that liraglutide and loxenatide not only increased the expression of RXRα and circ8411 but also decreased the expression of miR-23a-5p in HG+HC-treated GEnCs. Furthermore, siRNA-mediated knockdown of circ8411 attenuated the upregulatory effect of GLP-1RAs on ABCA1 expression (Fig 6U and 6V).

Fig 6 — (A, B) CCK-8 assay was used to evaluate the influence of liraglutide and loxenatide on GEnC viability (***P < 0.001 vs. HG+HC+Loxe-0nmol/L group, ###P < 0.001 vs. HG+HC+Lira-0nmol/L group). (C) ABCA1 expression in the GEnCs treated with different concentrations of liraglutide (#P < 0.05 vs. HG+HC+Lira-0nmol/L group, ##P < 0.01 vs. HG+HC+Lira-0nmol/L group, ###P < 0.001 vs. HG+HC+Lira-0nmol/L group). (D) ABCA1 expression in the GEnCs treated with different concentrations of loxenatide (***P < 0.001 vs. HG+HC+Loxe-0nmol/L group). (E, G) Representative images of Oil red O staining(×400, bar = 20μm) and quantitative analysis in GEnCs treated with liraglutide and loxenatide(*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (F,H) Cholesterol quantification experiment to determine the cholesterol accumulation in cells treated with liraglutide and loxenatide (*P < 0.05 vs. HG+HC group). (I) The mRNA expression of caspase-1, GSDMD, IL-1β in GEnCs treated with liraglutide (**P < 0.01 vs. HG+HC group). (J) Representative Western blot images and quantitative data of caspase-1, GSDMD, N-GSDMD, IL-1β in GEnCs treated with loxenatide (*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (L) The mRNA expression of caspase-1, GSDMD, IL-1β in GEnCs treated with loxenatide (*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (M) Representative Western blot images and quantitative data of caspase-1, GSDMD, N-GSDMD, IL-1β in GEnCs treated with liraglutide (*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (K,N) Release of LDH of GEnCs treated with loxenatide and liraglutide (*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (O-T) Expressions of RXRα, circ8411, and miR-23a-5p of GEnCs treated with liraglutide and loxenatide (*P < 0.05 vs. HG+HC group, **P < 0.01 vs. HG+HC group). (U) Representative images of Western blot and quantitative data of the ABCA1 expression in GEnCs treated with si-RNA of circ8411 and liraglutide (*P < 0.05 vs. HG+HC+Lira+si-NC group).(V) Representative images of Western blot and quantitative data of the ABCA1 expression in GEnCs treated with si-RNA of circ8411 and loxenatide (*P < 0.05 vs. HG+HC+Loxe+si-NC group).

Renal injury was attenuated in GLP-1RAs-treated mice

Compared with WT-NC, blood glucose, TC, and LDL-c in the WT-DM, ApoE^-/- and ApoE^-/-DM increased, while HDL-c was decreased. There were a higher TG levels in WT-DM than that in the WT-NC and in ApoE^-/-DM than that in the ApoE^-/-. The above trends were reversed partially in the GLP-1RAs group. A notable increase in Scr, BUN and UTP was observed in ApoE^-/-DM mice, and these changes were partially rescued by liraglutide and loxenatide treatment in ApoE^-/-DM mice (Table 3). Renal mesangial hyperplasia and renal tubular vacuolar degeneration were evident in ApoE^-/-DM compared to ApoE^-/-. Histological analysis of the kidneys from ApoE^-/-DM mice revealed that liraglutide and loxenatide improved renal mesangial hyperplasia and renal tubular vacuolar degeneration (Fig 7A).

Table 3. Biochemical characteristics of plasma and urine of mice.

Values	WT-NC	WT-DM	ApoE-/-	ApoE-/-DM	ApoE-/-DM+Lira	ApoE-/-DM+Loxe
Weight (g)	28.20±1.20	27.21±0.14	30.77±0.90^a	25.84±2.02^b	25.12±2.13	22.4±2.86^c
FBG (mmol/L)	5.54±0.50	21.20±2.97^a	5.86±0.35	19.75±2.74^b	10.58±3.50^c	9.12±4.51^c
TG (mmol/L)	1.4±0.30	2.6±0.50^a	1.02±0.30	3.15±00.56^b	1.40±0.66^c	1.02±0.07^c
TC (mmol/L)	1.57±0.10	3.10±1.08^a	21.63±2.53^a	49.63±6.04^b	38.97±5.62 ^c	41.17±2.91^c
LDL-c (mmol/L)	1.35±0.20	5.73±0.37^a	8.10±0.08^a	10.37±1.48^b	8.34±0.37^c	9.43±0.01
HDL-c (mmol/L)	0.95±0.17	1.43±0.06^a	1.79±0.02^a	1.53±0.40^b	1.87±0.51^c	2.2±0.18^c
BUN (mmol/L)	6.02±2.01	12.77±1.28^a	8.44±0.59^a	15.64±0.28^b	6.35±2.45^c	6.16±0.20³^c
Scr (umol/L)	12.50±0.40	21.30±2.39^a	29.75±1.48^a	39.9±5.09^b	27.65±2.05^c	35.5±6.92^c
UTP (mg/d)	0.44±0.19	1.54±0.18^a	0.89±0.10^a	2.28±0.53^b	1.63±0.20^c	0.96±0.15^c

Open in a new tab

Values represent the mean± SD

^a<0.05 vs. WT-NC

^b<0.05 vs. ApoE-/-

^c<0.05 vs. ApoE-/-DM.

Fig 7 — (A) Representative images of HE staining of the kidney tissues of mice (×400, bar = 50μm). (B) Representative images of Oil red O staining and the quantitative assessment of the kidney tissues of mice (×400, bar = 50μm, **P < 0.01 vs. WT-NC group, ***P < 0.001 vs. WT-NC group, ###P < 0.001 vs. *ApoE*^-/-DM group). (C) Cholesterol quantification experiment to determine the cholesterol accumulation in the kidneys of mice (**P < 0.01 vs. WT-NC group, ***P < 0.001 vs. WT-NC group, ##P < 0.01 vs. *ApoE*^-/-DM group).(D) The mRNA expression of caspase-1, GSDMD, IL-1β in the kidneys of mice (*P < 0.05 vs. WT-NC group, **P < 0.01 vs. WT-NC group,***P < 0.001 vs. WT-NC group, #P < 0.05 vs. *ApoE*^-/-DM group, ##P < 0.01 vs. *ApoE*^-/-DM group, ###P < 0.001 vs. *ApoE*^-/-DM group). (E) Representative Western blot images and quantitative data of of caspase-1, GSDMD, IL-1β in the kidneys of mice (*P < 0.05 vs. WT-NC group, **P < 0.01 vs. WT-NC group, #P < 0.05 vs. *ApoE*^-/-DM group).(F) Release of LDH in the kidneys of mice (**P < 0.01 vs. WT-NC group, ##P < 0.01 vs. *ApoE*^-/-DM group). (G) Circ8411 expression of renal of mice (*P < 0.05 vs. WT-NC group, ##P < 0.01 vs. *ApoE*^-/- group, &P < 0.05 vs. *ApoE*^-/-DM group). (H) miR-23a-5p expression of renal of mice (**P < 0.01 vs. WT-NC group,###P < 0.001 vs. *ApoE*^-/- group, &P < 0.05 vs. *ApoE*^-/-DM group). (I-J) RT-qPCR and Western Blot experiment were conducted to determine ABCA1 expression in the kidneys of mice (**P < 0.01 vs. WT-NC group, ***P < 0.001 vs. WT-NC group, ##P < 0.01 vs. *ApoE*^-/- group, ###P < 0.001 vs. *ApoE*^-/- group,&P < 0.05 vs. *ApoE*^-/-DM group). (K) Representative images of the immunofluorescence staining(×200, bar = 50μm) of ABCA1(red) in the kidneys of mice. nucleus were stained with DAPI (blue).

GLP-1RAs attenuated cholesterol accumulation and pyroptosis in the kidneys of ApoE^-/-DM Mice by increasing circ8411-ABCA1 expression

Glomerular cholesterol accumulation was significantly elevated in ApoE^-/-DM compared to ApoE^-/- mice, and this trend was markedly reversed in the GLP-1RA group (Fig 7B and 7C). In ApoE^-/-DM mice, we observed a significant increase in the levels of caspase-1, GSDMD, IL-1β, and the release of LDH, all of which were partially reversed in the GLP-1RAs group (Fig 7D–7F). Furthermore, compared to ApoE^-/- mice, ApoE^-/-DM mice exhibited a remarkable increase in the expression of circ8411, and ABCA1, while miR-23a-5p expression was significantly reduced. These changes were reversed in the GLP-1RAs group (Fig 7E–7L). These results suggest that hyperglycemia exacerbates renal cholesterol accumulation and pyroptosis in ApoE^-/- mice, and these effects can be mitigated by GLP-1RAs through the regulation of the RXRα-circ8411-miR-23a-5p-ABCA1 pathway. Finally, we examined ABCA1 expression in the insulin (INS) group and found no significant increase in ABCA1 expression (S1 Fig). These findings suggest that controlling hyperglycemia alone may not be sufficient to increase ABCA1 expression in diabetic kidneys.

Discussion

It has been reported that glucotoxicity and lipotoxicity synergistically contribute to renal injury in DKD [29]. This study investigated the mechanisms underlying the effects of high glucose on lipotoxic renal injury. We discovered that high glucose exacerbated cholesterol accumulation and pyroptosis in GEnCs exposed to cholesterol load, as well as in the kidneys of ApoE-deficient diabetic mice, by suppressing ABCA1 expression. We further elucidated that high glucose downregulates RXRα and circ8411, thereby mediating the suppression of ABCA1 expression. Knockdown of circ8411 also downregulated ABCA1 expression, leading to aggravated cholesterol accumulation and pyroptosis (Fig 8). Luciferase reporter assays and rescue experiments revealed that circ8411 exerts these effects by binding to miR-23a-5p. Emerging evidence suggests that GLP-1RAs possess extra-renal protective effects [26]. However, the precise mechanisms underlying these renal protective effects remain unclear. Experimental studies have demonstrated that GLP-1RAs increase ABCA1 expression, improve ABCA1-mediated cholesterol efflux, and mitigate pyroptosis (Fig 8). In alignment with these findings, we observed that GLP-1RAs significantly ameliorated renal structural and functional damage, cholesterol accumulation, and pyroptosis in ApoE-deficient diabetic mice.

Fig 8 — High glucose decreased the ability of GEnCs to respond to cholesterol load, leading to downregulation of ABCA1 expression, increased cholesterol accumulation, and pyroptosis in GEnCs. Circ8411 regulated ABCA1 by inhibiting the action of miR-23a-5p, and miR-23a-5p binds to the 3’ UTR of circ8411. High glucose could decrease circ8411 expression by inhibiting RXRα. GLP-1RAs could potentially reduce cholesterol accumulation and cell pyroptosis by modulating the RXRα/circ8411/miR-23a-5p/ABCA1 axis.

Cholesterol is now understood to be primarily utilized by the liver and certain glands, while other cells are unable to directly utilize cholesterol and can only maintain cholesterol homeostasis by excreting excess cholesterol. When the cholesterol load exceeds the limits of excretion, cellular dysfunction occurs [5]. Our study revealed that high glucose induced cholesterol accumulation in GEnCs, impairing their ability to respond to cholesterol load. Subsequently, we investigated the mechanisms underlying high glucose-induced intracellular cholesterol accumulation under cholesterol load. Previous studies have demonstrated that ABCA1 expression safeguards against endothelial dysfunction[17]. In the kidney, increased cholesterol and fatty acid synthesis lead to enhanced cholesterol efflux through ABCA1 [19,20]. However, the expression level of ABCA1 in GEnCs and its role in GEnC injury remained unclear. Our findings indicated that ABCA1 expression was upregulated in GEnCs subjected to high cholesterol levels, likely reflecting a cellular response to increased cholesterol content aimed at promoting the efflux of intracellular cholesterol. However, high glucose inhibited the ABCA1 feedback response triggered by high cholesterol, resulting in cholesterol accumulation in GEnCs. These results aligned with our in vivo experiments. Collectively, these findings confirm that defects in ABCA1 contribute to cholesterol accumulation in GEnCs.

Excessive cholesterol accumulation can impair cellular functions by inducing inflammation, oxidative stress, and apoptosis. This can lead to damage of renal structure and function. Numerous mechanisms link cholesterol accumulation to renal injury in DKD, with pyroptosis being one of them. Inflammasome-activated caspase-1 plays a pivotal role in inducing pyroptosis. Additionally, a series of studies have confirmed that cholesterol can activate caspase-1 in vascular endothelial cells, triggering pyroptosis [8,30]. However, the relationship between pyroptosis and DKD in GEnCs and the underlying mechanisms remain to be fully elucidated. Our results demonstrated that high glucose upregulated the expression of caspase-1, GSDMD, IL-1β, and LDH release in GEnCs treated with high cholesterol. These levels were also elevated in ApoE^-/-DM mice compared to ApoE^-/-mice. These findings suggest that high glucose can exacerbate intracellular pyroptosis in GEnCs under conditions of excess cholesterol.

Emerging evidence suggests a link between circRNAs and cholesterol metabolism, as well as DKD. For instance, circ0092317, circ0003546, and circACC1 may reduce cholesterol efflux from macrophages [31]. Additionally, CircRNA15698 exacerbates diabetic nephropathy by upregulating extracellular matrix production in mesangial cells through the miR-185/TGF-β pathway [32]. Through circRNA microarray analysis, our study identified a novel circRNA, circ8411, involved in regulating cholesterol homeostasis. We observed a decrease in circ8411 levels in the renal tissues of ApoE^-/-DM mice compared to ApoE^-/-mice. Furthermore, high cholesterol levels could upregulate circ8411 expression, which was partially reversed by high glucose, suggesting that its expression is regulated in response to cellular cholesterol changes. Our study hypothesized a role for circ8411 in the response of GEnCs to cholesterol overload, mediated by the upregulation of cholesterol efflux.

To investigate this, we performed loss-of-function and gain-of-function experiments using siRNA and plasmid transfection. Knockdown of circ8411 significantly suppressed the expression of ABCA1, aggravated cholesterol accumulation, and increased the expression of caspase-1, GSDMD, IL-1β, and LDH release in GEnCs treated with high glucose and high cholesterol. Conversely, overexpression of circ8411 led to the opposite effects. CircRNAs can regulate gene expression by competing for miRNA or protein binding. Based on our findings, we propose that circ8411 acts as an endogenous sponge of miRNA, downregulating miRNA expression and thereby removing the suppression of its target gene ABCA1. In the present study, bioinformatics analysis suggested that miR-23a-5p might serve as a mediator between circ8411 and ABCA1. Dual-luciferase reporter assays demonstrated that miR-23a-5p could repress the activity of the 3’ untranslated region (UTR) of circ8411. Additionally, Yang et al. reported that miR-23a-5p binds to ABCA1 [33]. Furthermore, we observed that overexpression of circ8411 downregulated miR-23a-5p. Rescue experiments revealed that overexpression of miR-23a-5p decreased ABCA1 expression, which was partially increased by the addition of circ8411 overexpression, suggesting that circ8411 positively upregulated the expression of ABCA1 in GEnCs by sponging miR-23a-5p. Research on circRNAs primarily focuses on miRNA sponging, transcription, and translation. However, few circRNAs have been utilized as target molecules to investigate their upstream transcriptional regulation. Existing studies have shown that TFs are involved in the transcriptional regulation of circRNAs, such as the TF Twist1, which promotes CUL2 circRNA transcription [34]. To explore the mechanisms underlying high glucose regulation of circ8411, bioinformatics analysis was conducted to identify RXRα as a potential TF of circ8411.

Moreover, RXRα plays a crucial role in phosphorus homeostasis, basal metabolism, and cholesterol metabolism [35]. In our study, we found that high glucose could decrease RXRα expression under cholesterol overload. Inhibition of RXRα using UVI3003 significantly suppressed the expression levels of circ8411 and ABCA1. These findings suggest that RXRα may be involved in the regulation of circ8411 by high glucose. Taken together, we propose that high glucose suppresses the expression of circ8411 by decreasing RXRα expression, ultimately promoting cholesterol accumulation and pyroptosis through the upregulation of miR-23a-5p and subsequent inhibition of ABCA1 expression.

GLP-1R activation stimulates the cAMP and PKA pathways, exerting antioxidant functions, suggesting that GLP-1RAs protects various tissues from oxidative stress [36]. Despite these findings, it remains unclear whether the progression of renal injury under conditions of chronic hyperglycemia is influenced by alterations in GLP-1R signaling. Therefore, we investigated the protective effects of GLP-1RAs on the kidney from the perspective of glucose-lipid metabolism interactions. In our study, we observed that liraglutide and loxenatide exhibited renal protective and lipid-regulating effects in ApoE^-/-DM mice. These GLP-1RAs decreased cholesterol accumulation in ApoE^-/-DM mice and GEnCs treated with high glucose and high cholesterol. Additionally, liraglutide and loxenatide inhibited the expression of caspase-1, GSDMD, IL-1β, and LDH release. These findings suggest that GLP-1RAs might mitigate the lipotoxic renal effects aggravated by high glucose. Some studies have indicated that exendin-4 can activate GLP-1R in THP-1 macrophages, thereby increasing ABCA1 expression and preventing the formation of atherogenic foam cells [37,38].

Our study demonstrated that liraglutide and loxenatide could increase ABCA1 expression, and the inhibition of ABCA1 led to increased cholesterol accumulation and pyroptosis in GLP-1RAs-treated GEnCs, indicating that ABCA1 plays a crucial role in the anti-lipotoxicity effects of liraglutide and loxenatide. Yin et al. demonstrated that exendin-4 regulated ABCA1 through GLP-1R-mediated signaling [14]. We provided compelling evidence that liraglutide and loxenatide regulate ABCA1 expression through the RXRα/circ8411/miR-23a-5p pathway. Our findings revealed that GLP-1RAs treatment increased the expression of RXRα and circ8411 while decreasing miR-23a-5p. These effects were inhibited by UVI3003 and siRNA, respectively. Collectively, our results suggest that GLP-1RAs can upregulate ABCA1 expression by modulating the RXRα/circ8411/miR-23a-5p axis, thereby reducing cholesterol accumulation and ameliorating pyroptosis.

In summary, we have presented hitherto undocumented evidence that high glucose exacerbates cholesterol accumulation and pyroptosis in GEnCs, contributing to lipotoxic renal injury. Our study revealed that high glucose significantly downregulates ABCA1 expression in GEnCs and the kidneys of ApoE^-/-DM mice. Importantly, we have identified that liraglutide and loxenatide exert renal protective effects by reducing cholesterol accumulation and pyroptosis, at least partially through the RXRα/circ8411/miR-23a-5p/ABCA1 pathway under diabetic conditions. Our findings underscore the critical role of lipotoxicity in GEnCs in the development and progression of DKD. Therapeutic agents that enhance GLP-1R activity may offer protection against GEnC dysfunction and the progression of DKD through this pathway.

Supporting information

S1 Fig. ABCA1 expression in the INS group.

(DOCX)

pone.0314628.s001.docx^{(732.2KB, docx)}

S1 Table. The results of circRNA microarray.

(XLSX)

pone.0314628.s002.xlsx^{(270.8KB, xlsx)}

S1 Raw images

(PDF)

pone.0314628.s003.pdf^{(579.2KB, pdf)}

Acknowledgments

We would like to express our deepest gratitude to the animals participated in the research.

Abbreviations

DKD: diabetic kidney disease
GLP-1RA: GLP-1 receptor agonist
GEnCs: glomerular endothelial cells
IL-1β: interleukin-1β
IL-18: interleukin-18
LDH: lactate dehydrogenase
ABCA1: ATP-binding cassette transporter A1
circRNAs: Circular RNAs
ncRNAs: noncoding RNAs
GLP-1R: Glucagon-like peptide-1 receptor
LG: low glucose
HG: high glucose
ECM: endothelial cell medium
BUN: blood urea nitrogen
Scr: serum creatinine
TC: total cholesterol
LDL-c: low-density lipoprotein cholesterol
HDL-c: high-density lipoprotein cholesterol
TG: plasma triglycerides
UTP: urinary protein quantity
PBS: phosphate buffered saline
TFs: transcription factors

Data Availability

ll relevant data are within the manuscript.

Funding Statement

This work was supported by financial support from Tianjin Science and Technology Major Special Project and Engineering Public Health Science and Technology Major Special Project (No.21ZXGWSY00100), Tianjin Natural Science Foundation Key Project (22JCZDJC00590), Tianjin Key Medical Discipline (Specialty) Construct Project (No.TJYXZDXK-032A), Scientific Research Funding of Tianjin Medical University Chu Hsien-I Memorial Hospital (No.ZXY-ZDSYSZD-1), Whitehorn Diabetes Research Fund Project (No.G-X-2019-56), Technology Project of Sichuan Provincial Health Commission (21PJ127) and Chengdu Medical Research Project (2022291).The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.de Boer IH, Khunti K, Sadusky T et al. (2022) Diabetes management in chronic kidney disease: a consensus report by the American Diabetes Association (ADA) and Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int 102: 974–989. doi: 10.1016/j.kint.2022.08.012 [DOI] [PubMed] [Google Scholar]
2.Deng Y, Li N, Wu Y et al. (2021) Global, Regional, and National Burden of Diabetes-Related Chronic Kidney Disease From 1990 to 2019.Front Endocrinol (Lausanne) 12: 672350. doi: 10.3389/fendo.2021.672350 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Zhou L, Huang W, Xu Y et al. (2018) Sweet Taste Receptors Mediated ROS-NLRP3 Inflammasome Signaling Activation: Implications for Diabetic Nephropathy. J Diabetes Res 2018: 7078214. doi: 10.1155/2018/7078214 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Lu J, Chen PP, Zhang JX et al. (2022) GPR43 activation-mediated lipotoxicity contributes to podocyte injury in diabetic nephropathy by modulating the ERK/EGR1 pathway. Int J Biol Sci 18: 96–111. doi: 10.7150/ijbs.64665 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Zhang J, Wu Y, Zhang J et al. (2023) ABCA1 deficiency-mediated glomerular cholesterol accumulation exacerbates glomerular endothelial injury and dysfunction in diabetic kidney disease. Metabolism 139: 155377. doi: 10.1016/j.metabol.2022.155377 [DOI] [PubMed] [Google Scholar]
6.Opazo-Rios L, Mas S, Marin-Royo G et al. (2020) Lipotoxicity and Diabetic Nephropathy: Novel Mechanistic Insights and Therapeutic Opportunities. Int J Mol Sci 21. doi: 10.3390/ijms21072632 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Thongnak L, Pongchaidecha A, Lungkaphin A (2020) Renal Lipid Metabolism and Lipotoxicity in Diabetes. Am J Med Sci 359: 84–99. doi: 10.1016/j.amjms.2019.11.004 [DOI] [PubMed] [Google Scholar]
8.Ding T, Wang S, Zhang X et al. (2018) Kidney protection effects of dihydroquercetin on diabetic nephropathy through suppressing ROS and NLRP3 inflammasome. Phytomedicine 41: 45–53. doi: 10.1016/j.phymed.2018.01.026 [DOI] [PubMed] [Google Scholar]
9.Luo B, Huang F, Liu Y et al. (2017) NLRP3 Inflammasome as a Molecular Marker in Diabetic Cardiomyopathy. Front Physiol 8: 519. doi: 10.3389/fphys.2017.00519 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Ross C, Chan AH, von Pein JB et al. (2022) Inflammatory Caspases: Toward a Unified Model for Caspase Activation by Inflammasomes. Annu Rev Immunol 40: 249–269. doi: 10.1146/annurev-immunol-101220-030653 [DOI] [PubMed] [Google Scholar]
11.Jiang S, Luo M, Bai X et al. (2022) Cellular crosstalk of glomerular endothelial cells and podocytes in diabetic kidney disease. J Cell Commun Signal 16: 313–331. doi: 10.1007/s12079-021-00664-w [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Qi H, Casalena G, Shi S et al. (2017) Glomerular Endothelial Mitochondrial Dysfunction Is Essential and Characteristic of Diabetic Kidney Disease Susceptibility. Diabetes 66: 763–778. doi: 10.2337/db16-0695 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ndisang JF (2018) Glomerular Endothelium and its Impact on Glomerular Filtration Barrier in Diabetes: Are the Gaps Still Illusive? Curr Med Chem 25: 1525–1529. doi: 10.2174/0929867324666170705124647 [DOI] [PubMed] [Google Scholar]
14.Xing SS, Yang XY, Zheng T et al. (2015) Salidroside improves endothelial function and alleviates atherosclerosis by activating a mitochondria-related AMPK/PI3K/Akt/eNOS pathway. Vascul Pharmacol 72: 141–52. doi: 10.1016/j.vph.2015.07.004 [DOI] [PubMed] [Google Scholar]
15.Zhang Y, Zhou H, Wu W et al. (2016) Liraglutide protects cardiac microvascular endothelial cells against hypoxia/reoxygenation injury through the suppression of the SR-Ca(2+)-XO-ROS axis via activation of the GLP-1R/PI3K/Akt/survivin pathways. Free Radic Biol Med 95: 278–92. doi: 10.1016/j.freeradbiomed.2016.03.035 [DOI] [PubMed] [Google Scholar]
16.Schiano C, Benincasa G, Franzese M et al. (2020) Epigenetic-sensitive pathways in personalized therapy of major cardiovascular diseases. Pharmacol Ther 210: 107514. doi: 10.1016/j.pharmthera.2020.107514 [DOI] [PubMed] [Google Scholar]
17.Toma L, Barbalata T, Sanda GM et al. (2021) CRISPR/dCas9 Transcriptional Activation of Endogenous Apolipoprotein AI and Paraoxonase 1 in Enterocytes Alleviates Endothelial Cell Dysfunction. Biomolecules 11. doi: 10.3390/biom11121769 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.He Y, Ronsein GE, Tang C et al. (2020) Diabetes Impairs Cellular Cholesterol Efflux From ABCA1 to Small HDL Particles. Circ Res 127: 1198–1210. doi: 10.1161/CIRCRESAHA.120.317178 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Segrest JP, Tang C, Song HD et al. (2022) ABCA1 is an extracellular phospholipid translocase. Nat Commun 13: 4812. doi: 10.1038/s41467-022-32437-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Wright MB, Varona Santos J, Kemmer C et al. (2021) Compounds targeting OSBPL7 increase ABCA1-dependent cholesterol efflux preserving kidney function in two models of kidney disease. Nat Commun 12: 4662. doi: 10.1038/s41467-021-24890-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Liu P, Peng L, Zhang H et al. (2018) Tangshen Formula Attenuates Diabetic Nephropathy by Promoting ABCA1-Mediated Renal Cholesterol Efflux in db/db Mice. Front Physiol 9: 343. doi: 10.3389/fphys.2018.00343 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Wang Y, Xiao S, Zhou S et al. (2020) High Glucose Aggravates Cholesterol Accumulation in Glomerular Endothelial Cells Through the LXRs/LncRNAOR13C9/ABCA1 Regulatory Network. Front Physiol 11: 552483. doi: 10.3389/fphys.2020.552483 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Liu CX, Chen LL (2022) Circular RNAs: Characterization, cellular roles, and applications. Cell 185: 2016–2034. doi: 10.1016/j.cell.2022.04.021 [DOI] [PubMed] [Google Scholar]
24.Huang A, Zheng H, Wu Z et al. (2020) Circular RNA-protein interactions: functions, mechanisms, and identification. Theranostics 10: 3503–3517. doi: 10.7150/thno.42174 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Chen L, Huang C, Shan G (2022) Circular RNAs in physiology and non-immunological diseases. Trends Biochem Sci 47: 250–264. doi: 10.1016/j.tibs.2021.11.004 [DOI] [PubMed] [Google Scholar]
26.Shao S, Zhang X, Xu Q et al. (2022) Emerging roles of Glucagon like peptide-1 in the management of autoimmune diseases and diabetes-associated comorbidities. Pharmacol Ther 239: 108270. doi: 10.1016/j.pharmthera.2022.108270 [DOI] [PubMed] [Google Scholar]
27.Yin QH, Zhang R, Li L et al. (2016) Exendin-4 Ameliorates Lipotoxicity-induced Glomerular Endothelial Cell Injury by Improving ABC Transporter A1-mediated Cholesterol Efflux in Diabetic apoE Knockout Mice. J Biol Chem 291: 26487–26501. doi: 10.1074/jbc.M116.730564 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Pyke C, Heller RS, Kirk RK et al. (2014) GLP-1 receptor localization in monkey and human tissue: novel distribution revealed with extensively validated monoclonal antibody. Endocrinology 155: 1280–90. doi: 10.1210/en.2013-1934 [DOI] [PubMed] [Google Scholar]
29.Khan S, Gaivin R, Abramovich C et al. (2020) Fatty acid transport protein-2 regulates glycemic control and diabetic kidney disease progression. JCI Insight 5. doi: 10.1172/jci.insight.136845 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Xu YJ, Zheng L, Hu YW et al. (2018) Pyroptosis and its relationship to atherosclerosis. Clin Chim Acta 476: 28–37. doi: 10.1016/j.cca.2017.11.005 [DOI] [PubMed] [Google Scholar]
31.Yu G, Yang Z, Peng T et al. (2021) Circular RNAs: Rising stars in lipid metabolism and lipid disorders. J Cell Physiol 236: 4797–4806. doi: 10.1002/jcp.30200 [DOI] [PubMed] [Google Scholar]
32.Hu W, Han Q, Zhao L et al. (2019) Circular RNA circRNA_15698 aggravates the extracellular matrix of diabetic nephropathy mesangial cells via miR-185/TGF-beta1. J Cell Physiol 234: 1469–1476. doi: 10.1002/jcp.26959 [DOI] [PubMed] [Google Scholar]
33.Yang S, Ye ZM, Chen S et al. (2018) MicroRNA-23a-5p promotes atherosclerotic plaque progression and vulnerability by repressing ATP-binding cassette transporter A1/G1 in macrophages. J Mol Cell Cardiol 123: 139–149. doi: 10.1016/j.yjmcc.2018.09.004 [DOI] [PubMed] [Google Scholar]
34.Meng J, Chen S, Han JX et al. (2018) Twist1 Regulates Vimentin through Cul2 Circular RNA to Promote EMT in Hepatocellular Carcinoma. Cancer Res 78: 4150–4162. doi: 10.1158/0008-5472.CAN-17-3009 [DOI] [PubMed] [Google Scholar]
35.Evans RM, Mangelsdorf DJ (2014) Nuclear Receptors, RXR, and the Big Bang. Cell 157: 255–66. doi: 10.1016/j.cell.2014.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Fujita H, Morii T, Fujishima H et al. (2014) The protective roles of GLP-1R signaling in diabetic nephropathy: possible mechanism and therapeutic potential. Kidney Int 85: 579–89. doi: 10.1038/ki.2013.427 [DOI] [PubMed] [Google Scholar]
37.Tashiro Y, Sato K, Watanabe T et al. (2014) A glucagon-like peptide-1 analog liraglutide suppresses macrophage foam cell formation and atherosclerosis. Peptides 54: 19–26. doi: 10.1016/j.peptides.2013.12.015 [DOI] [PubMed] [Google Scholar]
38.Nagashima M, Watanabe T, Terasaki M et al. (2011) Native incretins prevent the development of atherosclerotic lesions in apolipoprotein E knockout mice. Diabetologia 54: 2649–59. doi: 10.1007/s00125-011-2241-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0314628.r001

Decision Letter 0

Ravikanth Nanduri

4 Jun 2024

PONE-D-24-13952GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway PLOS ONE

Dear Dr. Yu,

Please submit your revised manuscript by Jul 19 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ravikanth Nanduri, Ph. D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. o comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

4. Thank you for stating the following financial disclosure:

“This work was supported by financial support from Tianjin Science and Technology Major Special Project and Engineering Public Health Science and Technology Major Special Project (No.21ZXGWSY00100), Tianjin Natural Science Foundation Key Project (22JCZDJC00590), Tianjin Key Medical Discipline (Specialty) Construct Project (No.TJYXZDXK-032A), Scientific Research Funding of Tianjin Medical University Chu Hsien-I Memorial Hospital (No.ZXY-ZDSYSZD-1), Whitehorn Diabetes Research Fund Project (No.G-X-2019-56), Technology Project of Sichuan Provincial Health Commission (21PJ127) and Chengdu Medical Research Project (2022291).”

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

7. We notice that your supplementary tables are uploaded with the file type 'Figure'. Please amend the file type to 'Supporting Information'. Please ensure that each Supporting Information file has a legend listed in the manuscript after the references list.

Additional Editor Comments:

This manuscript need serious English language corrections. Most of the manuscript is not clear. Abbreviations need to be expanded. Authors are requested to answer all the comments of the reviewer.

Profession language proof reading is essential.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: These paper about “GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway “suggesting that excessive hyperglycemia causes lipotoxic renal damage through the RXRα/circ8411/miR-23a-5p/ABCA1 43 pathway. Individuals suffering from hypercholesterolemia and diabetic kidney disease (DKD) may find relief by focusing on this pathway.

The paper is well planned and written to put all the relevant data together. There are few minor corrections to be done.

1. The font size throughout the paper is not the same.

2. The spacings in the paper should be modified to be the same throughout the paper.

3. It would be better if you can reduce the thickness of the error bars in all the figures.

4. In Fig 7K immunostaining panel please mention blue and red in the figure itself.

When all these minor comments are addressed, I think this paper can be considered for acceptance.

Reviewer #2: This study by Weixi Wu et al., mechanistically demonstrated the protective effect of GLP-1 RA against lipototoxity in diabetic renal injury. While this study may be of great interest to the scientific community, there are concerns to address.

* L26-31. It looks to me that the aim of this study is not well described. Are the authors investigated the mechanical protective role of GLP-1 RA or investigated the cholesterol accumulation and pyroptosis in glomerular endothelial cells (GEnCs)? If it is the latter, then it does not clearly match the title. Please clarify and make it consistent with the main result that drive the title of the manuscript.

* L51-53. Please improve the logical flow of the manuscript. I suggest the authors to write the second sentence first, then the first after: "Diabetic microvascular complications including DKD, leads to end stage renal disease [1]. In fact, globally, diabetic kidney disease (DKD) is a serious health and economic problem [2].

* L53-55. Please rewrite the following "The current approaches to preventing or treating DKD have limited effectiveness, such as controlling blood glucose levels, blood pressure, and urinary protein excretion" as: "The current approaches to prevent or treat DKD, which includes controlling blood glucose levels, blood pressure, and urinary protein excretion, have limited effectiveness. This limited effectiveness can be attributed to the lack of knowledge regarding the pathophysiological mechanism involved.

* L58-59. hard to understand sentence: not [... and triglyceride and cholesterol accumulated in the kidney of diabetes models is thought possibly contribute to DKD pathogenesis] BUT [... and accumulation of triglyceride and cholesterol in the kidney of diabetes models potentially contribute to DKD pathogenesis] or [... and accumulation of triglyceride and cholesterol in the kidney of diabetes models is thought to contribute to DKD pathogenesis].

* L69-70. Hard-to-understand sentence [To our knowledge, ATP-binding cassette transporter A1(ABCA1), which serve as transporters that promote cholesterol efflux from cell]. Please, rewrite it simply but accurately, or improve punctuation for a less confusing writing.

* "renoprotective or "reno-protective"? Please be consistent.

* L65. no need to repeat " interleukin-18" just right IL-18.

* It is suggested that the authors provide Ethics numbers or a copy of university ethical approval statement with institutional stamp.

* L92. Suggested to change "Cellular experiments" with "Cell culture experiments"

* L94-97. The cell cultures were divided into different growth conditions, including low glucose (LG, 5.5 mmol/L D-glucose ), high glucose (HG, 25.5 mmol/L D-glucose), high cholesterol (HC, 400 µg/ml watersoluble cholesterol) (Sigma, United States)], and HG combined HC (25.5 mmol/L+400 µg/ml).

* L198. [Values are shown as "mean + SD"]

* Captions in Figures only described what experiments have been performed, but not what each figure actually tells as information that answers the scientific question (the aim) of the study. Figures are meaningless/speechless. Figures, supported with captions should stand alone and provide enough information in order, such that we do not need to read the main text to get the main idea delivered by a figure.

* 205-207. Hard to understand sentence, hampering the result presentation.

* 207-209. The authors said that [The Oil red O staining and total cholesterol quantification showed that cholesterol accumulation "was not remarkable" in HG compared with LG, but increased under HC], but latter said that [these results showed that high glucose might exacerbate the accumulation of intracellular cholesterol under the load of cholesterol]. It looks contradictory to me. Rather, the results shows that the combination of HG and HC is required/associated with cholesterol accumulation, but not only HG alone. However, when we read the following data, it showed that HG alone or together with HC induce cholesterol accumulation and proinflammatory response, through inhibition of ABCA1. The authors should take care of the following sentence [The Oil red O staining and total cholesterol quantification showed that cholesterol accumulation "was not remarkable" in HG compared with LG, but increased under HC], which, I fell, is contradictory.

*L232. rewrite as follows "This heat map presented in Figure 3A displays the microarray data of aberrantly expressed circRNAs."

* I will stop the review at this stage, as and suggest the authors, to take the following together with what precede into accounts:

*** Overall: I would suggest the authors to improve the writeup by fixing the grammatical errors and syntax, and doublechecking the punctuations. This manuscript suffers from serious logical flow, from a sentence to another, and from two consecutive paragraph; this needs to be taken care of. I suggest the authors to seek for help from a scientific, with professional and proficient English.

The methods section needs to be written with clear details that can allow repeatability of the study. English syntax hampers understanding of the shared science. The authors should redo the data analysis. If contradictory results are found, need to stand as limitations of the study or provide better scientific explanations.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Arnaud John KOMBE KOMBE

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Dec 2;19(12):e0314628. doi: 10.1371/journal.pone.0314628.r002

Author response to Decision Letter 0

5 Jul 2024

Dear editor and reviewers,

We would like to express our sincere gratitude to you for your efforts in handling our manuscript. We appreciate you give us the opportunity to revise our paper. We thank the editorial boards and the two reviewer’s points and suggestions to improve our work. Those comments are all valuable and very helpful for revising and improving our paper.

We have studied comments carefully and have made correction which we hope meet with approval. Based on your comment and request, we attached revised manuscript with the correction sections red marked. We also replied the reviewers’ questions point-by-point as following below. The corrections in the paper and the responds to the reviewer’s comments are as following.

Should you have any questions, please contact us without hesitate.

Reviewer #1:

These paper about “GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway “suggesting that excessive hyperglycemia causes lipotoxic renal damage through the RXRα/circ8411/miR-23a-5p/ABCA1 43 pathway. Individuals suffering from hypercholesterolemia and diabetic kidney disease (DKD) may find relief by focusing on this pathway. The paper is well planned and written to put all the relevant data together. There are few minor corrections to be done. When all these minor comments are addressed, I think this paper can be considered for acceptance.

Response: We express our gratitude for your meticulous and constructive review, as well as your insightful comments. Your comments were highly insightful and has significantly enhanced the overall quality of our manuscript. According with your suggestions, we have made necessary revisions to the relevant section of the article. Subsequently, we present our point-by-point responses to each of your comments in the following pages.

1. The font size throughout the paper is not the same.

2. The spacings in the paper should be modified to be the same throughout the paper.

3. It would be better if you can reduce the thickness of the error bars in all the figures.

4. In Fig 7K immunostaining panel please mention blue and red in the figure itself.

Response: We appreciate the valuable advice provided and regret that the details of the article were not detailed enough. We have thoroughly reviewed and made revisions to this section. We've resized the body font to a uniform size, and doubled the line spacing as follows the manuscript body formatting guidelines.

Revised version in line 419-433 (Results):

Figure 7. GLP-1RA alleviated kidney damage, cholesterol accumulation and pyroptosis in renal of ApoE-/-DM mice by increasing circ8411-ABCA1. (A) HE staining of the renal of mice (×400, bar=50μm). (B) Oil red O staining of the renal of mice (×400, bar=50μm). (C) Cholesterol quantification experiment to determine the cholesterol accumulation in renal of mice (**P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, #P < 0.05 vs. ApoE-/-DM, ##P < 0.01 vs. ApoE-/-DM).(D,E) Caspase-1, GSDMD, IL-1β expression of renal of mice (*P < 0.05 vs. WT-NC, **P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, #P < 0.05 vs. ApoE-/-DM, ##P < 0.01 vs. ApoE-/-DM).（F) Release of LDH of renal of mice (**P < 0.01 vs. WT-NC, ##P < 0.01 vs. ApoE-/-DM). (G) Circ8411 expression of renal of mice (*P < 0.05 vs. WT-NC, ##P < 0.01 vs. ApoE-/-). (H-J) RT-qPCR, Western Blot and immunofluorescence experiment (×200, bar=50μm) were conducted to determine ABCA1(red) expression of renal of mice. Nuclei were stained with DAPI (blue). (**P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, ##P < 0.01 vs. ApoE-/-, ###P < 0.001 vs. ApoE-/-, &P < 0.05 vs. WT-NC).

Reviewer#2

This study by Weixi Wu et al., mechanistically demonstrated the protective effect of GLP-1 RA against lipototoxity in diabetic renal injury. While this study may be of great interest to the scientific community, there are concerns to address.

Response: We sincerely thank for your systematic guidance of my manuscript. Your comments were highly insightful, which greatly improved the content of this article as well as its framework and writing standards. According with your suggestions, we have amended the corresponding part of the article. In the following pages are our point-by-point responses to each of the comments.

1. L26-31. It looks to me that the aim of this study is not well described. Are the authors investigated the mechanical protective role of GLP-1 RA or investigated the cholesterol accumulation and pyroptosis in glomerular endothelial cells (GEnCs)? If it is the latter, then it does not clearly match the title. Please clarify and make it consistent with the main result that drive the title of the manuscript.

Response: We appreciate the valuable advice provided and express regret for the lack of clarity in the abstract. We have thoroughly reviewed and made revisions to this section.

Revised version in line 26-32(Methods):

In this study, we investigated the cholesterol accumulation and pyroptosis in glomerular endothelial cells (GEnCs) and the reno-protective effects of GLP-1RAs using various techniques such as RT-qPCR, oil red O staining，Western blotting, and LDH activity assay. We also employed circRNA microarrays, bioinformatics analysis, gain and loss of function experiments, rescue experiments, and luciferase assay to identify the ceRNA mechanism involved. C57BL/6J, ApoE-/- mice were used for in vivo experiments.

2. L51-53. Please improve the logical flow of the manuscript. I suggest the authors to write the second sentence first, then the first after: "Diabetic microvascular complications including DKD, leads to end stage renal disease [1]. In fact, globally, diabetic kidney disease (DKD) is a serious health and economic problem [2].

Response: Thank you for bringing this to our attention. We sincerely appreciate your careful reading. We have diligently examined and refined the manuscript, encompassing the introduction through to the references.

Revised version in line 52-54(Introduction):

Diabetic microvascular complications include diabetic kidney disease (DKD), which leads to end-stage renal disease [1]. Globally, DKD is a serious health and economic problem [2].

Revised version in line 606-613(References):

1. de Boer IH, Khunti K, Sadusky T et al. (2022) Diabetes management in chronic kidney disease: a consensus report by the American Diabetes Association (ADA) and Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int 102: 974-989. https://doi.org/10.1016/j.kint.2022.08.012

2. Deng Y, Li N, Wu Y et al. (2021) Global, Regional, and National Burden of Diabetes-Related Chronic Kidney Disease From 1990 to 2019.Front Endocrinol (Lausanne) 12: 672350. https://doi.org/10.3389/fendo.2021.672350

3.L53-55. Please rewrite the following "The current approaches to preventing or treating DKD have limited effectiveness, such as controlling blood glucose levels, blood pressure, and urinary protein excretion" as: "The current approaches to prevent or treat DKD, which includes controlling blood glucose levels, blood pressure, and urinary protein excretion, have limited effectiveness. This limited effectiveness can be attributed to the lack of knowledge regarding the pathophysiological mechanism involved.

Response: We sincerely appreciate your careful reading. We think this is an excellent suggestion. We have re-edited the paragraph according to your suggestions.

Revised version in line 54-57(Introduction):

The current approaches to prevent or treat DKD, which includes controlling blood glucose levels, blood pressure, and urinary protein excretion, have limited effectiveness. This limited effectiveness can be attributed to the lack of knowledge regarding the pathophysiological mechanism involved[3].

4.L58-59. hard to understand sentence: not [... and triglyceride and cholesterol accumulated in the kidney of diabetes models is thought possibly contribute to DKD pathogenesis] BUT [... and accumulation of triglyceride and cholesterol in the kidney of diabetes models potentially contribute to DKD pathogenesis] or [... and accumulation of triglyceride and cholesterol in the kidney of diabetes models is thought to contribute to DKD pathogenesis].

Response: Thank you for your valuable input. We have re-edited the paragraph according to your suggestions.

Revised version in line 58-60(Introduction):

Studies have confirmed that abnormal lipid metabolism is strongly associated with DKD, and accumulation of triglyceride and cholesterol in the kidney of diabetes models potentially contribute to DKD pathogenesis[4-6].

5.L69-70. Hard-to-understand sentence [To our knowledge, ATP-binding cassette transporter A1(ABCA1), which serve as transporters that promote cholesterol efflux from cell]. Please, rewrite it simply but accurately, or improve punctuation for a less confusing writing.

Response: Thank you for your valuable input. We apologize for the poor language of our manuscript. We have now worked on both language and readability and have also involved native English speakers for language corrections. We really hope that the flow and language level have been substantially improved. We have re-edited the paragraph according to your suggestions.

Revised version in line 71-73(Introduction):

The ATP-binding cassette transporter A1 (ABCA1) acts as a transporter that facilitates the removal of cholesterol from cells, by promoting cholesterol efflux.

6. "renoprotective or "reno-protective"? Please be consistent.

Response: We feel sorry for our carelessness. In our resubmitted manuscript, the typo is revised. Thanks for your correction.

Revised version in line 23-25(Background):

Furthermore, the mechanisms underlying any potential reno-protective effects of GLP-1 receptor agonists (GLP-1RAs) have not yet been established.

Revised version in line 26-29(Methods):

Revised version in line 89-92(Introduction):

Taken together, we hypothesize that the GLP-1RA could exerts its reno-protective effects by regulating lipotoxicity-induced GEnCs pyroptosis via regulating ABCA1 in DKD and circRNAs may be involved in this procedure.

Revised version in line 554-556(Results):

In our study, we found that liraglutide and loxenatide has reno-protective and lipid-regulating effect in ApoE-/- DM mouse.

Revised version in line 578-581(Discussion)

More importantly, we first identify that liraglutide and loxenatide achieves reno-protection by reducing cholesterol accumulation and pyroptosis at least in part through RXRα/circ8411/miR-23a-5p/ABCA1 pathway under diabetic conditions.

7. L65. no need to repeat " interleukin-18" just right IL-18.

Response: Thank you for your valuable input. We have re-edited the paragraph according to your suggestions.

Revised version in line 65-68(Introduction):

Activating caspase-1 triggers the process of pyroptosis, inherently inducing inflammation and releasing pro-inflammatory factors, such as interleukin-1β (IL-1β), IL-18, lactate dehydrogenase (LDH) and the activation of a stronger inflammatory response[10].

8. It is suggested that the authors provide Ethics numbers or a copy of university ethical approval statement with institutional stamp.

Response: Thank you for your valuable input. We will upload a a copy of university ethical approval statement with institutional stamp.

9. L92. Suggested to change "Cellular experiments" with "Cell culture experiments"

Response: Thank you for your valuable input. We have re-edited the paragraph according to your suggestions.

Revised version in line 94(Materials and methods):

Cell culture experiments

10. L94-97. The cell cultures were divided into different growth conditions, including low glucose (LG, 5.5 mmol/L D-glucose ), high glucose (HG, 25.5 mmol/L D-glucose), high cholesterol (HC, 400 µg/ml watersoluble cholesterol) (Sigma, United States)], and HG combined HC (25.5 mmol/L+400 µg/ml).

Response: Thank you for your valuable input. Based on your comments, we have made the corrections and attached it below.

Revised version in line 96-99(Cell culture experiments):

The cell cultures were divided into different growth conditions, including low glucose (LG, 5.5 mmol/L D-glucose ), high glucose (HG, 25.5 mmol/L D-glucose), high cholesterol (HC, 400 µg/ml watersoluble cholesterol) (Sigma, United States)], and HG combined HC (25.5 mmol/L+400 µg/ml).

11. L198. [Values are shown as "mean + SD"]

Response: Thank you for your valuable input. We have re-edited the paragraph according to your suggestions.

Revised version in line 210(Statistical Analysis):

Values are shown as the "mean + SD".

12. Captions in Figures only described what experiments have been performed, but not what each figure actually tells as information that answers the scientific question (the aim) of the study. Figures are meaningless/speechless. Figures, supported with captions should stand alone and provide enough information in order, such that we do not need to read the main text to get the main idea delivered by a figure.

Response: Thank you for your valuable input. We've re-edited the captions.

Revised version in line 258-260;272-273(Results):

Figure 1. High glucose exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load in GEnCs. (A) CCK-8 assay was used to evaluate the influence of water-soluble cholesterol on GEnCs viability (*P < 0.05 vs. Control; **P < 0.01 vs. Control,***P < 0.001 vs. Control). 25.5 mmol/L glucose and 400 mg/ml cholesterol were found to be the best intervention concentrations for HK-2 cells. (B) Oil red O staining of GEnCs treated with different concentrations of cholesterol (×400, bar=50μm). (C) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. Control; **P < 0.01 vs. Control). (D) Expression of ABCA1 in GEnCs with different cholesterol concentrations (**P < 0.01 vs. Control,***P < 0.001 vs. Control). (E,F) Expression of ABCA1 after intervention with different glucose concentrations without cholesterol and under cholesterol load (*P < 0.05 vs. Control). (G) Oil red O staining of GEnCs treated with different concentrations of cholesterol and glucose (×400, bar=50μm). (H) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. LG,**P < 0.01 vs. LG; ***P < 0.001vs. LG). (I) RT-qPCR analysis to determine ABCA1 mRNA expression (***P < 0.001 vs. LG; #P < 0.05 vs. HC). (J) Western Blot analysis to determine ABCA1 protein expression (***P < 0.001 vs. LG; #P < 0.05 vs. HC). ABCA1 levels decreased in the HG group and increased significantly in the HC group. (K) Immunofluorescence experiment was conducted to determine the expression of ABCA1 (×200, bar=100μm).

Revised version in line 280-281(Results):

Figure 2. HG exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load. (A,B) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs under the condition of high glucose or/and high cholesterol (*P < 0.05 vs. LG,**P < 0.01 vs. LG; #P < 0.05 vs.HC, ##P < 0.01 vs.HC). Significant increase of pyroptosis markers were conserved in HG+HC than in HG or HC. (C) The release of LDH of GEnCs treated with different concentrations of cholesterol and glucose ((*P < 0.05 vs. LG,**P < 0.01 vs. LG; ##P < 0.01 vs.HC). (D,E)RT-qPCR and Western Blot analysis to determine ABCA1 expression of GEnCs treated with different concentrations of DIDS (*P < 0.05 vs. Control,***P < 0.001 vs. Control). (F) Oil red O staining of GEnCs treated with DIDS (×400, bar=50μm). (G) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. Control). (H,I) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with DIDS (*P < 0.05 vs. Control; **P < 0.01 vs. Control, ***P < 0.001 vs. Control). (J) Release of LDH of GEnCs treated with DIDS (****P < 0.001 vs. Control).

Revised version in line 316-317;323-324(Re

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s004.docx^{(54.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0314628.r003

Decision Letter 1

Miquel Vall-llosera Camps

2 Oct 2024

PONE-D-24-13952R1GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathwayPLOS ONE

Dear Dr. Yu,

Please submit your revised manuscript by Nov 16 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Miquel Vall-llosera Camps

Senior Staff Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

6. Review Comments to the Author

Reviewer #1: I think the author had addressed all the comments in a well manner and the paper can be accepted.

Congratulations to the author.

Reviewer #2: (No Response)

Reviewer #3: I appreciate your efforts in revising the manuscript, but several areas still require significant attention. Language and grammar issues persist throughout, and I strongly recommend professional editing to enhance clarity. Additionally, your responses to the reviewers' comments lack specificity. Consistent terminology (e.g reno-protective) and figure caption (too descriptive) are also necessary. A clearer point-by-point response will be beneficial in guiding your revisions (and do not need to cite the tools so many times)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Arnaud John KOMBE KOMBE

Reviewer #3: No

**********

PLoS One. 2024 Dec 2;19(12):e0314628. doi: 10.1371/journal.pone.0314628.r004

Author response to Decision Letter 1

16 Oct 2024

Dear editor and reviewers,

We would like to express our sincere gratitude to you for your efforts in handling our manuscript. We appreciate you give us the opportunity to revise our paper. We thank the editorial boards and the reviewer’s points and suggestions to improve our work. Those comments are all valuable and very helpful for revising and improving our paper.

We have studied comments carefully and have made correction which we hope meet with approval. Based on your comment and request, we attached revised manuscript with the correction sections red marked. The corrections in the paper and the responds to the reviewer’s comments are as following.

Should you have any questions, please contact us without hesitate.

Response: We apologize for the presence of grammatical and typographical errors in our article, as they should have been avoided. We express our gratitude for the corrections provided by the expert. In order to refine the language and rectify any remaining errors, we have submitted them to a professional editing service. We attached revised manuscript with the correction sections red marked. Based on your suggestions, we have simplified the figure caption.

Revised version in line 26,29(Abstract) :

Lipotoxicity has been implicated in diabetic kidney disease (DKD). However, the role of high glucose levels in this process and the underlying mechanisms of renal protective effects of GLP-1 receptor agonists (GLP-1RAs) remain unclear.

To investigate cholesterol accumulation, pyroptosis in glomerular endothelial cells (GEnCs), and the renal protective effects of GLP-1RAs, we employed various techniques, including RT-qPCR, Oil Red O staining, Western blotting, lactate dehydrogenase (LDH) activity assays, circRNA microarrays, bioinformatics analysis, gain- and loss-of-function experiments, rescue experiments, and luciferase assays. Additionally, in vivo experiments were conducted using C57BL/6J and ApoE-/- mice.

Revised version in line 613(Discussion) :

In our study, we observed that liraglutide and loxenatide exhibited renal protective and lipid-regulating effects in ApoE-/-DM mice. These GLP-1RAs decreased cholesterol accumulation in ApoE-/-DM mice and GEnCs treated with high glucose and high cholesterol.

Revised version in Results :

Figure 1. High glucose exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load in GEnCs. (A) CCK-8 assay was used to evaluate the influence of water-soluble cholesterol on GEnCs viability (*P < 0.05 vs. Control; **P < 0.01 vs. Control, ***P < 0.001 vs. Control). (B) Oil red O staining of GEnCs treated with different concentrations of cholesterol (×400, bar=50μm). (C) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. Control; **P < 0.01 vs. Control). (D) Expression of ABCA1 in GEnCs with different cholesterol concentrations (**P < 0.01 vs. Control, ***P < 0.001 vs. Control). (E,F) Expression of ABCA1 after intervention with different glucose concentrations without cholesterol and under cholesterol load (*P < 0.05 vs. Control). (G) Oil red O staining of GEnCs treated with different concentrations of cholesterol and glucose (×400, bar=50μm). (H) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. LG, **P < 0.01 vs. LG; ***P < 0.001vs. LG). (I) RT-qPCR analysis to determine ABCA1 mRNA expression (***P < 0.001 vs. LG; #P < 0.05 vs. HC). (J) Western Blot analysis to determine ABCA1 protein expression (***P < 0.001 vs. LG; #P < 0.05 vs. HC). (K) Immunofluorescence experiment was conducted to determine the expression of ABCA1 (×200, bar=100μm).

Figure 2. HG exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load. (A,B) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs under the condition of high glucose or/and high cholesterol (*P < 0.05 vs. LG,**P < 0.01 vs. LG; #P < 0.05 vs. HC, ##P < 0.01 vs. HC). (C) The release of LDH of GEnCs treated with different concentrations of cholesterol and glucose ((*P < 0.05 vs. LG, **P < 0.01 vs. LG; ##P < 0.01 vs. HC). (D,E) RT-qPCR and Western Blot analysis to determine ABCA1 expression of GEnCs treated with different concentrations of DIDS (*P < 0.05 vs. Control,***P < 0.001 vs. Control). (F) Oil red O staining of GEnCs treated with DIDS (×400, bar=50μm). (G) Cholesterol quantification experiment was conducted to determine intracellular cholesterol content (*P < 0.05 vs. Control). (H,I) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with DIDS (*P < 0.05 vs. Control; **P < 0.01 vs. Control, ***P < 0.001 vs. Control). (J) Release of LDH of GEnCs treated with DIDS (****P < 0.001 vs. Control).

Figure 3. Circ8411 is involved in the regulation of ABCA1. (A) The heatmap for the differential expression of circRNAs. (B) RT-qPCR analysis to determine the expression of four candidate lncRNAs (*P < 0.05 vs. HC; **P < 0.01 vs. HC). (C) Circ8411 expression of GEnCs treated with cholesterol and glucose (***P < 0.001 vs. LG, ###P < 0.001 vs. HC). (D) RT-qPCR to determine the knockdown efficiency of circ8411 (*P < 0.05 vs. si-NC). (E,F) Oil red O staining of GEnCs (×400, bar=20μm) and cholesterol quantification experiment to determine the cholesterol accumulation in cells transfected with siRNA. (G-I) RT-qPCR, Western Blot, and immunofluorescence experiment (×200, bar=50μm) were conducted to determine the expression of ABCA1 in cells transfected with siRNA (*P < 0.05 vs. NC-si; **P < 0.01 vs. NC-si). (J.K) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with siRNA (*P < 0.05 vs. NC-si; **P < 0.01 vs. NC-si, ***P < 0.001 vs. NC-si). (L) Release of LDH of GEnCs treated with siRNA (*P < 0.05 vs. NC-si). (M) RT-qPCR analysis to determine the overexpression efficiency of circ8411 (***P < 0.001 vs. vector); (N,O) Oil red O staining of GEnCs (×400, bar=20μm) and cholesterol quantification experiment to determine the cholesterol accumulation in cells transfected with circ8411-pcDNA3.1 plasmid (**P < 0.01 vs. vector). (P,Q,S) RT-qPCR, Western Blot, and immunofluorescence experiment (×200, bar=50μm) were conducted to determine the expression of ABCA1 in cells transfected with the circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. vector, **P < 0.01 vs. vector). (R,S) RT-qPCR and Western Blot analysis to determine the expression of caspase-1, GSDMD, and IL-1β in GEnCs treated with circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. LG; **P < 0.01 vs. LG). (T) Release of LDH of GEnCs treated with circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. vector).

Figure 4. The circ8411 regulates ABCA1 expression by regulating miR-23a-5p

(A) RT-qPCR analysis to determine miR-23a-5p in the GEnCs under conditions of high glucose and high cholesterol. (B,C) RT-qPCR analysis to determine miR-23a-5p expression with the knockdown and overexpression of circ8411. (**P < 0.05 vs. Control). (D,E) RT-qPCR analysis to determine the overexpression efficiency of miR-23a-5p and the expression of ABCA1 in cells transfected with the miR-23a-5p mimic (**P < 0.05 vs. Control). (F,G) Rescue experiments to determine the regulatory effect of circ8411/miR-23a-5p/ABCA1 in GEnCs (*P < 0.05 vs. mimic NC; #P < 0.05 vs. miR-23a-5p mimic with circ8411 vector). (H) Luciferase reporter assay on GEnCs co-transfected with circ8411-3’UTR-WT or circ8411-3’UTR-MUT and miR-23a-5p mimics or NC (**P < 0.01 vs. Circ8411-WT+NC group).

Figure 5. High glucose affects circ8411 down-regulation through RXRs. (A) RT-qPCR analysis to determine the expression of RXRα, CEBP/α, Hif-1a in the GEnCs undering glucose and cholesterol (*P < 0.05 vs. Control, **P < 0.01 vs. Control). (B) Western Blot showed the expression of RXRα GEnCs under different intervention of glucose and cholesterol (*P < 0.05 vs. Control). (C) RXRα expression of GEnCs treated with different concentrations of UVI3003 (*P < 0.05 vs. Control). A marked reduction in RXRα was observed in cells treated with 10umol/L of UVI3003. (D) Circ8411 expression of GEnCs treated with UVI3003. (E) ABCA1 expression of GEnCs treated with UVI3003 (*P < 0.05 vs. Control).

Figure 6. GLP-1RA attenuated cholesterol accumulation and pyroptosis in GEnCs by increasing RXRα-circ8411-miR-23a-5p-ABCA1. (A,B) CCK-8 assay was used to evaluate the influence of liraglutide and loxenatide on GEnC viability (***P < 0.001 vs. Control). (C,D) ABCA1 expression in the GEnCs treated with different concentrations of liraglutide and loxenatide (*P < 0.05 vs. Control; **P < 0.01 vs. Control). (E-H) Oil red O staining of GEnCs (×400, bar=50μm) and cholesterol quantification experiment to determine the cholesterol accumulation in cells treated with liraglutide and loxenatide (*P < 0.05 vs. Control). (I,J,L,M) Expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with liraglutide and loxenatide (*P < 0.05 vs. Control; **P < 0.01 vs. Control). (K,N) Release of LDH of GEnCs treated with liraglutide and loxenatide (**P < 0.01 vs. Control). (O-T) Expressions of RXRα, circ8411, and miR-23a-5p of GEnCs treated with liraglutide and loxenatide (*P < 0.05 vs. Control, **P < 0.01 vs. Control). (U-V) Western Blot was performed to determine the ABCA1 expression in GEnCs treated with siRNAof circ8411 and GLP-1RA (*P < 0.05 vs. Control).

Figure 7. GLP-1RA alleviated kidney damage, cholesterol accumulation, and pyroptosis in the kidneys of ApoE-/-DM mice by increasing circ8411-ABCA1. (A) HE staining of the kidney tissues of mice (×400, bar=50μm). (B) Oil red O staining of the kidney tissues of mice (×400, bar=50μm). (C) Cholesterol quantification experiment to determine the cholesterol accumulation in the kidneys of mice (**P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, #P < 0.05 vs. ApoE-/-DM, ##P < 0.01 vs. ApoE-/-DM).(D,E) Caspase-1, GSDMD, IL-1β expression in the kidneys of mice (*P < 0.05 vs. WT-NC, **P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, #P < 0.05 vs. ApoE-/-DM, ##P < 0.01 vs. ApoE-/-DM). (F) Release of LDH in the kidneys of mice (**P < 0.01 vs. WT-NC, ##P < 0.01 vs. ApoE-/-DM). (G) Circ8411 expression of renal of mice (*P < 0.05 vs. WT-NC, ##P < 0.01 vs. ApoE-/-). (H-J) RT-qPCR, Western Blot, and immunofluorescence experiment (×200, bar=50μm) were conducted to determine ABCA1(red) expression in the kidneys of mice. Nuclei were stained with DAPI (blue). (**P < 0.01 vs. WT-NC, ***P < 0.001 vs. WT-NC, ##P < 0.01 vs. ApoE-/-, ###P < 0.001 vs. ApoE-/-, &P < 0.05 vs. WT-NC).

Once again, thank you very much for your constructive comments and suggestions which would help us both in English and in depth to improve the quality of the paper.

Yours sincerely,

Pei Yu

2024/10/16

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s005.docx^{(26.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0314628.r005

Decision Letter 2

Joel Montané

29 Oct 2024

PONE-D-24-13952R2GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathwayPLOS ONE

Dear Dr. Yu,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. While I appreciate the improvements made I have some concerns regarding its readiness for publication. The language still presents challenges, with several grammatical errors that affect clarity. Some sentences in the manuscript (in particular, in the introduction) are quite short and lead to difficulty in following the overall narrative. I recommend rephrasing them for better flow and coherence. In addition there are also ongoing inconsistencies in terminology and figure captions, which complicate the evaluation of the findings.

I recommend a thorough revision to address these issues before considering acceptance, as the article has interesting potential. For this, authors may seek independent editorial help before submitting the revision. These services can be found on the web using search terms like “scientific editing service” or “manuscript editing service.”

Please submit your revised manuscript by Dec 13 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Joel Montané, PhD

Academic Editor

PLOS ONE

Journal Requirements:

[Note: HTML markup is below. Please do not edit.]

PLoS One. 2024 Dec 2;19(12):e0314628. doi: 10.1371/journal.pone.0314628.r006

Author response to Decision Letter 2

11 Nov 2024

Dear editor and reviewers,

We would like to express our sincere gratitude to you for your efforts in handling our manuscript. We appreciate you give us the opportunity to revise our paper. We thank the editorial boards and the reviewer’s points and suggestions to improve our work. Those comments are all valuable and very helpful for revising and improving our paper.

We have studied comments carefully and have made correction which we hope meet with approval. Based on your comment and request, we attached revised manuscript with the correction sections red marked. The corrections in the paper and the responds to the reviewer’s comments are as following.

Should you have any questions, please contact us without hesitate.

“While I appreciate the improvements made I have some concerns regarding its readiness for publication. The language still presents challenges, with several grammatical errors that affect clarity. Some sentences in the manuscript (in particular, in the introduction) are quite short and lead to difficulty in following the overall narrative. I recommend rephrasing them for better flow and coherence. In addition there are also ongoing inconsistencies in terminology and figure captions, which complicate the evaluation of the findings.

I recommend a thorough revision to address these issues before considering acceptance, as the article has interesting potential. ”

Response: We apologize for the presence of grammatical and typographical errors in our article, as they should have been avoided. In order to refine the language and rectify any remaining errors, we have submitted them to a professional editing service. We attached revised manuscript with the correction sections red marked. Based on your suggestions, we have thoroughly examine and revise the figure captions and the section of introduction.Additionally, we have re-edited the figures with the objective of enhancing clarity and comprehensibility.

Revised version in line 26,29,30,36,38,42,49(Abstract) :

GEnCs exposed to high glucose exhibited reduced cholesterol efflux, which was accompanied by downregulation of ATP-binding cassette transporter A1 (ABCA1) expression, cholesterol accumulation, and pyroptosis. Circ8411 was identified as a regulator of ABCA1, inhibiting miR-23a-5p through its binding to the 3'UTR. Additionally, higher glucose levels decreased circ8411 expression by inhibiting RXRα. GLP-1RAs effectively reduced cholesterol accumulation and cell pyroptosis by targeting the RXRα/circ8411/miR-23a-5p/ABCA1 pathway. In diabetic ApoE-/- mice, renal structure and function were impaired, with resulted in increased cholesterol accumulation and pyroptosis; however, GLP-1RAs treatment reversed these detrimental changes.

Moreover, GLP-1RAs may provide reno-protective effects by activating this pathway.

Revised version in line (Introduction) :

Diabetic kidney disease (DKD) is a leading cause of end-stage renal disease (ESRD) [1],which poses a significant health and economic burden [2]. Current strategies to prevent or treat DKD have limited efficacy, such as the management of blood glucose, blood pressure, and urinary protein excretion. This limitation can be attributed to an insufficient understanding of the underlying pathophysiological mechanisms [3].

Numerous studies have established a strong association between abnormal lipid metabolism and DKD. The accumulation of triglycerides(TG) and cholesterol in the kidneys has been implicated in the pathogenesis of DKD [4-6]. Lipotoxicity, which is characterized by the dysregulation of intracellular homeostasis due to lipid accumulation, leads to metabolic, inflammatory, and oxidative stress [7]. Hyperlipidemia, oxidized low-density lipoprotein (ox-LDL), and cholesterol crystals have been shown to activate caspase-1 in endothelial cells, thereby triggering pyroptosis [8, 9]. Pyroptosis is an inflammatory process that is characterised by the release of pro-inflammatory factors, including interleukin-1β (IL-1β), IL-18, and lactate dehydrogenase (LDH). These factors can contribute to a more pronounced inflammatory response[10]. However, the specific mechanisms underlying pyroptosis in the context of DKD development remain unclear.

There is an increasing consensus that glomerular endothelial cells (GEnCs) play a critical role in the development and progression of DKD [11-13]. The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of cholesterol efflux from cells, promoting the removal of cholesterol [14-16]. Previous researches suggest that ABCA1 expression in GEnCs may help to prevent endothelial dysfunction [5, 17].

ABCA1 is a plasma membrane protein that serves as a key regulator of cholesterol efflux from cells[18, 19]. In vitro studies have demonstrated that stimulation of high glucose can downregulate ABCA1 expression in renal cells, and a similar decrease in ABCA1 has been observed in diabetic and nephrotic mouse models [20, 21]. Furthermore, our previous research indicated that the dysregulation of glucose and cholesterol metabolism can impair ABCA1 function [22]. Collectively, these findings suggest that dysregulation of ABCA1 may contribute to cholesterol accumulation in the kidney.

Noncoding RNAs (ncRNAs) are a class of RNAs that do not encode proteins. A specific subset of ncRNAs are known as circular RNAs (circRNAs). CircRNAs are characterized by a covalently closed loop formed through a back-splicing process [23]. CircRNAs can act as microRNA (miRNA) sponges or interact with RNA-binding proteins, thereby regulating gene expression [24]. They have been identified as key regulators in various diseases [25]. However, the potential role of circRNAs in the progression of DKD remains unexplored. The glucose-like peptide-1 receptor (GLP-1R) and its agonists (GLP-1RAs) have shown protective effects against oxidative stress and macrophage activation in DKD [26]. Specifically, Exendin-4, a GLP-1RA, has been shown to ameliorate lipotoxicity-induced injury in GEnCs by enhancing ABCA1-mediated cholesterol efflux [27, 28]. Based on these findings, we hypothesize that GLP-1RAs may exert their renal protective effects in DKD by regulating lipotoxicity-induced pyroptosis in GEnCs through the modulation of ABCA1. Notably, circRNAs may play a significant role in this regulatory process.

Revised version in Results(238-254) :

CCK8 assay and Oil Red O staining were employed to determine the optimal concentration and time for cholesterol. Based on the results, 400 μg/ml cholesterol and 24 hours were identified as optimal intervention concentration and time for GEnCs(Fig 1A-B). The treatment of GEnCs with varying concentrations of glucose and cholesterol demonstrated a gradual elevation in ABCA1 mRNA expression with increasing cholesterol levels(Fig 1D), and the reduction in ABCA1 mRNA was most pronounced when cells were treated with 25.5mmo/L glucose(Fig 1E-F). Accordingly, 400 µM cholesterol and 25 µM glucose were selected as the intervention concentrations for the subsequent cell experiments. When compared to high glucose or high cholesterol individually, intracellular cholesterol accumulation was significantly elevated in cells treated with a combination of high glucose and high cholesterol (Fig 1G, H). Furthermore, the results demonstrated that ABCA1 levels were downregulated in the HG group compared to LG and significantly upregulated in the HC group. ABCA1 expression was significantly downregulated in the HG and HC groups compared to HC (Fig 1I-K). In summary, these findings suggest that high glucose may exacerbate intracellular cholesterol accumulation under conditions of cholesterol overload, the process may be mediated by ABCA1.

Revised version in Results(419-421) :

Among these, CEBP/α and RXRα exhibited significantly decreased expression in GEnCs cultured in HG+HC group compared to those cultured in HC group (Fig 5A). RXRα was selected for further investigation in the subsequent study. To suppress RXRα expression effectively in GEnCs, we employed different concentrations of UVI3003.

Revised version in Captions：

Figure 1. High glucose exacerbates intracellular cholesterol accumulation under cholesterol load in GEnCs. (A) CCK-8 assay was used to evaluate the influence of water-soluble cholesterol on GEnCs viability (*P < 0.05 vs. Cho-0μg/ml group; **P < 0.01 vs. Cho-0μg/ml group, ***P < 0.001 vs. Cho-0μg/ml group). (B)Representative images of Oil red O staining of GEnCs treated with different concentrations of cholesterol and the quantitative assessment(×400, bar=50μm; ***P < 0.001 vs. Cho-0μg/ml group). (C) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. Cho-0μg/ml group; **P < 0.01 vs. Cho-0μg/ml group). (D)The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR with different cholesterol concentrations (**P < 0.01 vs. Cho-0 μg/ml group, ***P < 0.001 vs. Cho-0μg/ml group). (E) The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR after intervention with different glucose concentrations without cholesterol(*P < 0.05 vs. Glu-5.5mmol/L group). (F) The mRNA expression of ABCA1 in GEnCs was detected by RT-qPCR after intervention with different glucose concentrations under cholesterol load (#P < 0.05 vs. Cho-400μg/ml+Glu-5.5mmol/L group). (G) Representative images of Oil red O staining of GEnCs and the quantitative assessment(×400, bar=50μm; ##P < 0.01 vs. HC, ***P < 0.001 vs. LG group). (H) Cholesterol quantification experiment was conducted to determine the content of intracellular cholesterol (*P < 0.05 vs. LG group, **P < 0.01 vs. LG group; ***P < 0.001vs. LG group). (I) RT-qPCR analysis to determine ABCA1 mRNA expression (***P < 0.001 vs. LG group; #P < 0.05 vs. HC group). (J) Western Blot analysis to determine ABCA1 protein expression (***P < 0.001 vs. LG group; #P < 0.05 vs. HC group). (K) Representative images of Immunofluorescence staining of ABCA1(red) in GEnCs(×200, bar=100μm). Nucleus were stained with DAPI (blue).

Figure 2. HG exacerbates GEnCs pyroptosis through ABCA1 under cholesterol load. (A,B) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs under the condition of high glucose or/and high cholesterol (*P < 0.05 vs. LG group,**P < 0.01 vs. LG group; #P < 0.05 vs. HC group, ##P < 0.01 vs. HC group). (C) The release of LDH of GEnCs treated with different conditions(*P < 0.05 vs. LG group, **P < 0.01 vs. LG group; ##P < 0.01 vs. HC group). (D,E) RT-qPCR and Western Blot analysis to determine ABCA1 expression of GEnCs treated with different concentrations of DIDS (*P < 0.05 vs. HG+HC+DIDS-0μmmol/L group,***P < 0.001 vs. HG+HC+DIDS-0μmmol/L group). (F) Representative images of Oil red O staining and analysis of GEnCs treated with 400 μmol/L DIDS (×400, bar=50μm；**P < 0.01 vs. HG+HC group). (G) Cholesterol quantification experiment was conducted to determine intracellular cholesterol content (*P < 0.05 vs. HG+HC group). (H,I) RT-qPCR and Western Blot analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with 400 μmol/L DIDS (*P < 0.05 vs. HG+HC group; **P < 0.01 vs. HG+HC group, ***P < 0.001 vs. HG+HC group). (J) Release of LDH of GEnCs treated with 400 μmol/L DIDS (***P < 0.001 vs. HG+HC group).

Figure 3. Circ8411 is involved in the regulation of ABCA1. Figure 3. Circ8411 is involved in the regulation of ABCA1. (A) The heatmap for the differential expression of circRNAs. (B) RT-qPCR analysis to determine the expression of four candidate lncRNAs (*P < 0.05 vs. HC group; **P < 0.01 vs. HC group). (C) Circ8411 expression of GEnCs treated with cholesterol and glucose (***P < 0.001 vs. LG group, ###P < 0.001 vs. HC group). (D) RT-qPCR to determine the knockdown efficiency of circ8411 (*P < 0.05 vs. NC-si group). (E) Representative images of Oil red O staining(×400, bar=20μm) and analysis in GEnCs after knockedown circ8411(***P < 0.001 vs. HG+HC+si-NC group). (F) Cholesterol quantification experiment to determine the cholesterol accumulation in GEnCs transfected with siRNA (*P < 0.05 vs. HG+HC+si-NC group). (G-I) RT-qPCR, Western Blot, and immunofluorescence experiment (×200, bar=50μm) were conducted to determine the expression of ABCA1 in cells transfected with siRNA (*P < 0.05 vs. NC-si group; **P < 0.01 vs. NC-si group). (J) RT-qPCR analysis to determine expressions of caspase-1, GSDMD, IL-1β in GEnCs treated with siRNA (*P < 0.05 vs. NC-si group; **P < 0.01 vs. NC-si group, ***P < 0.001 vs. NC-si group). (K)Representative Western blot images and quantitative data of caspase-1, GSDMD, IL-1β in GEnCs treated with siRNA (*P < 0.05 vs. HG+HC+si-NC group; **P < 0.01 vs. HG+HC+si-NC group, ***P < 0.001 vs. HG+HC+si-NC group). (L) Release of LDH in GEnCs treated with siRNA (*P < 0.05 vs. HG+HC+si-NC group). (M) RT-qPCR analysis to determine the overexpression efficiency of circ8411 (***P < 0.001 vs. cir8411-vector group). (N) Representative images of Oil red O staining(×400, bar=20μm) and analysis in GEnCs transfected with circ8411-pcDNA3.1 plasmid(**P < 0.01 vs. HG+HC+cir8411-vector group). (O) Cholesterol quantification experiment to determine the cholesterol accumulation in GEnCs transfected with circ8411-pcDNA3.1 plasmid (**P < 0.01 vs. HG+HC+cir8411-vector group). (P) RT-qPCR were conducted to determine the expression of ABCA1 mRNA in cells transfected with the circ8411-pcDNA3.1 plasmid (**P < 0.01 vs. HG+HC+cir8411-vector group). (Q)Representative images of the immunofluorescence staining of ABCA1(red) in cells transfected with the circ8411-pcDNA3.1 plasmid (×200, bar=50μm). Nucleus were stained with DAPI (blue). (R) RT-qPCR analysis to determine the expression of caspase-1, GSDMD, and IL-1β in GEnCs treated with circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. cir8411-vector group, **P < 0.01 vs. cir8411-vector group). (S) Representative Western blot images and quantitative data of caspase-1, ABCA1, GSDMD, and IL-1β in GEnCs treated with circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. HG+HC+cir8411-vector group; **P < 0.01 vs. HG+HC+cir8411-vector group). (T) Release of LDH in GEnCs treated with circ8411-pcDNA3.1 plasmid (*P < 0.05 vs. HG+HC+cir8411-vector group).

Figure 4. The circ8411 regulates ABCA1 expression by regulating miR-23a-5p

(A)RT-qPCR analysis to determine miR-23a-5p in the GEnCs under different conditions (**P < 0.01 vs. LG group；###P < 0.001 vs. HG group). (B) RT-qPCR analysis to determine miR-23a-5p expression with the knockdown of circ8411(**P < 0.01 vs. LG+si-NC group, ##P < 0.01 vs. HG+HC+si-NC group). (C) RT-qPCR analysis to determine miR-23a-5p expression with the overexpression of circ8411 (**P < 0.01 vs. LG+circ8411-vector group, ##P < 0.01 vs. HG+HC+circ8411-vector group). (D) RT-qPCR analysis to determine the overexpression efficiency of miR-23a-5p in cells treated with the miR-23a-5p mimic (***P < 0.001 vs. miR-23a-5p mimic-NC group). (E) RT-qPCR analysis to determine the expression of ABCA1 in cells treated with the miR-23a-5p mimic (**P < 0.01 vs. HG+HC+mimic-NC group). (F) Rescue experiments to determine the regulatory effect of circ8411/miR-23a-5p/ABCA1 in GEnCs (*P < 0.05 vs. HG+HC+mimic-NC group, #P < 0.05 vs. HG+HC+mimic-miR-23a-5p+circ8411 vector group). (G) Western blot analysis to determine expression of ABCA1 in rescue experiments(*P < 0.05 vs. HG+HC+mimic-NC group; #P < 0.05 vs. HG+HC+mimic-miR-23a-5p+circ8411 vector group). (H) Luciferase reporter assay on GEnCs co-transfected with circ8411-3’UTR-WT or circ8411-3’UTR-MUT and miR-23a-5p mimic or NC (**P < 0.01 vs. mimic-NC group).

Figure 5. High glucose affects circ8411 down-regulation through RXRα.

(A) RT-qPCR analysis to determine the expression of RXRα, CEBP/α

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s006.docx^{(90.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0314628.r007

Decision Letter 3

Joel Montané

14 Nov 2024

GLP-1 RA improves diabetic renal injury by alleviating Glomerular Endothelial Cells Pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway

PONE-D-24-13952R3

Dear Dr. Yu,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Joel Montané, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The authors have addressed all comments, and the manuscript is now ready for publication.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0314628.r008

Acceptance letter

Joel Montané

19 Nov 2024

PONE-D-24-13952R3

PLOS ONE

Dear Dr. Yu,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Joel Montané

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. ABCA1 expression in the INS group.

(DOCX)

pone.0314628.s001.docx^{(732.2KB, docx)}

S1 Table. The results of circRNA microarray.

(XLSX)

pone.0314628.s002.xlsx^{(270.8KB, xlsx)}

S1 Raw images

(PDF)

pone.0314628.s003.pdf^{(579.2KB, pdf)}

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s004.docx^{(54.6KB, docx)}

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s005.docx^{(26.4KB, docx)}

Attachment

Submitted filename: Response to editor and reviewers.docx

pone.0314628.s006.docx^{(90.4KB, docx)}

Data Availability Statement

ll relevant data are within the manuscript.

[pone.0314628.ref001] 1.de Boer IH, Khunti K, Sadusky T et al. (2022) Diabetes management in chronic kidney disease: a consensus report by the American Diabetes Association (ADA) and Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int 102: 974–989. doi: 10.1016/j.kint.2022.08.012 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref002] 2.Deng Y, Li N, Wu Y et al. (2021) Global, Regional, and National Burden of Diabetes-Related Chronic Kidney Disease From 1990 to 2019.Front Endocrinol (Lausanne) 12: 672350. doi: 10.3389/fendo.2021.672350 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref003] 3.Zhou L, Huang W, Xu Y et al. (2018) Sweet Taste Receptors Mediated ROS-NLRP3 Inflammasome Signaling Activation: Implications for Diabetic Nephropathy. J Diabetes Res 2018: 7078214. doi: 10.1155/2018/7078214 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref004] 4.Lu J, Chen PP, Zhang JX et al. (2022) GPR43 activation-mediated lipotoxicity contributes to podocyte injury in diabetic nephropathy by modulating the ERK/EGR1 pathway. Int J Biol Sci 18: 96–111. doi: 10.7150/ijbs.64665 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref005] 5.Zhang J, Wu Y, Zhang J et al. (2023) ABCA1 deficiency-mediated glomerular cholesterol accumulation exacerbates glomerular endothelial injury and dysfunction in diabetic kidney disease. Metabolism 139: 155377. doi: 10.1016/j.metabol.2022.155377 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref006] 6.Opazo-Rios L, Mas S, Marin-Royo G et al. (2020) Lipotoxicity and Diabetic Nephropathy: Novel Mechanistic Insights and Therapeutic Opportunities. Int J Mol Sci 21. doi: 10.3390/ijms21072632 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref007] 7.Thongnak L, Pongchaidecha A, Lungkaphin A (2020) Renal Lipid Metabolism and Lipotoxicity in Diabetes. Am J Med Sci 359: 84–99. doi: 10.1016/j.amjms.2019.11.004 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref008] 8.Ding T, Wang S, Zhang X et al. (2018) Kidney protection effects of dihydroquercetin on diabetic nephropathy through suppressing ROS and NLRP3 inflammasome. Phytomedicine 41: 45–53. doi: 10.1016/j.phymed.2018.01.026 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref009] 9.Luo B, Huang F, Liu Y et al. (2017) NLRP3 Inflammasome as a Molecular Marker in Diabetic Cardiomyopathy. Front Physiol 8: 519. doi: 10.3389/fphys.2017.00519 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref010] 10.Ross C, Chan AH, von Pein JB et al. (2022) Inflammatory Caspases: Toward a Unified Model for Caspase Activation by Inflammasomes. Annu Rev Immunol 40: 249–269. doi: 10.1146/annurev-immunol-101220-030653 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref011] 11.Jiang S, Luo M, Bai X et al. (2022) Cellular crosstalk of glomerular endothelial cells and podocytes in diabetic kidney disease. J Cell Commun Signal 16: 313–331. doi: 10.1007/s12079-021-00664-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref012] 12.Qi H, Casalena G, Shi S et al. (2017) Glomerular Endothelial Mitochondrial Dysfunction Is Essential and Characteristic of Diabetic Kidney Disease Susceptibility. Diabetes 66: 763–778. doi: 10.2337/db16-0695 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref013] 13.Ndisang JF (2018) Glomerular Endothelium and its Impact on Glomerular Filtration Barrier in Diabetes: Are the Gaps Still Illusive? Curr Med Chem 25: 1525–1529. doi: 10.2174/0929867324666170705124647 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref014] 14.Xing SS, Yang XY, Zheng T et al. (2015) Salidroside improves endothelial function and alleviates atherosclerosis by activating a mitochondria-related AMPK/PI3K/Akt/eNOS pathway. Vascul Pharmacol 72: 141–52. doi: 10.1016/j.vph.2015.07.004 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref015] 15.Zhang Y, Zhou H, Wu W et al. (2016) Liraglutide protects cardiac microvascular endothelial cells against hypoxia/reoxygenation injury through the suppression of the SR-Ca(2+)-XO-ROS axis via activation of the GLP-1R/PI3K/Akt/survivin pathways. Free Radic Biol Med 95: 278–92. doi: 10.1016/j.freeradbiomed.2016.03.035 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref016] 16.Schiano C, Benincasa G, Franzese M et al. (2020) Epigenetic-sensitive pathways in personalized therapy of major cardiovascular diseases. Pharmacol Ther 210: 107514. doi: 10.1016/j.pharmthera.2020.107514 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref017] 17.Toma L, Barbalata T, Sanda GM et al. (2021) CRISPR/dCas9 Transcriptional Activation of Endogenous Apolipoprotein AI and Paraoxonase 1 in Enterocytes Alleviates Endothelial Cell Dysfunction. Biomolecules 11. doi: 10.3390/biom11121769 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref018] 18.He Y, Ronsein GE, Tang C et al. (2020) Diabetes Impairs Cellular Cholesterol Efflux From ABCA1 to Small HDL Particles. Circ Res 127: 1198–1210. doi: 10.1161/CIRCRESAHA.120.317178 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref019] 19.Segrest JP, Tang C, Song HD et al. (2022) ABCA1 is an extracellular phospholipid translocase. Nat Commun 13: 4812. doi: 10.1038/s41467-022-32437-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref020] 20.Wright MB, Varona Santos J, Kemmer C et al. (2021) Compounds targeting OSBPL7 increase ABCA1-dependent cholesterol efflux preserving kidney function in two models of kidney disease. Nat Commun 12: 4662. doi: 10.1038/s41467-021-24890-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref021] 21.Liu P, Peng L, Zhang H et al. (2018) Tangshen Formula Attenuates Diabetic Nephropathy by Promoting ABCA1-Mediated Renal Cholesterol Efflux in db/db Mice. Front Physiol 9: 343. doi: 10.3389/fphys.2018.00343 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref022] 22.Wang Y, Xiao S, Zhou S et al. (2020) High Glucose Aggravates Cholesterol Accumulation in Glomerular Endothelial Cells Through the LXRs/LncRNAOR13C9/ABCA1 Regulatory Network. Front Physiol 11: 552483. doi: 10.3389/fphys.2020.552483 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref023] 23.Liu CX, Chen LL (2022) Circular RNAs: Characterization, cellular roles, and applications. Cell 185: 2016–2034. doi: 10.1016/j.cell.2022.04.021 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref024] 24.Huang A, Zheng H, Wu Z et al. (2020) Circular RNA-protein interactions: functions, mechanisms, and identification. Theranostics 10: 3503–3517. doi: 10.7150/thno.42174 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref025] 25.Chen L, Huang C, Shan G (2022) Circular RNAs in physiology and non-immunological diseases. Trends Biochem Sci 47: 250–264. doi: 10.1016/j.tibs.2021.11.004 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref026] 26.Shao S, Zhang X, Xu Q et al. (2022) Emerging roles of Glucagon like peptide-1 in the management of autoimmune diseases and diabetes-associated comorbidities. Pharmacol Ther 239: 108270. doi: 10.1016/j.pharmthera.2022.108270 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref027] 27.Yin QH, Zhang R, Li L et al. (2016) Exendin-4 Ameliorates Lipotoxicity-induced Glomerular Endothelial Cell Injury by Improving ABC Transporter A1-mediated Cholesterol Efflux in Diabetic apoE Knockout Mice. J Biol Chem 291: 26487–26501. doi: 10.1074/jbc.M116.730564 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref028] 28.Pyke C, Heller RS, Kirk RK et al. (2014) GLP-1 receptor localization in monkey and human tissue: novel distribution revealed with extensively validated monoclonal antibody. Endocrinology 155: 1280–90. doi: 10.1210/en.2013-1934 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref029] 29.Khan S, Gaivin R, Abramovich C et al. (2020) Fatty acid transport protein-2 regulates glycemic control and diabetic kidney disease progression. JCI Insight 5. doi: 10.1172/jci.insight.136845 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref030] 30.Xu YJ, Zheng L, Hu YW et al. (2018) Pyroptosis and its relationship to atherosclerosis. Clin Chim Acta 476: 28–37. doi: 10.1016/j.cca.2017.11.005 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref031] 31.Yu G, Yang Z, Peng T et al. (2021) Circular RNAs: Rising stars in lipid metabolism and lipid disorders. J Cell Physiol 236: 4797–4806. doi: 10.1002/jcp.30200 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref032] 32.Hu W, Han Q, Zhao L et al. (2019) Circular RNA circRNA_15698 aggravates the extracellular matrix of diabetic nephropathy mesangial cells via miR-185/TGF-beta1. J Cell Physiol 234: 1469–1476. doi: 10.1002/jcp.26959 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref033] 33.Yang S, Ye ZM, Chen S et al. (2018) MicroRNA-23a-5p promotes atherosclerotic plaque progression and vulnerability by repressing ATP-binding cassette transporter A1/G1 in macrophages. J Mol Cell Cardiol 123: 139–149. doi: 10.1016/j.yjmcc.2018.09.004 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref034] 34.Meng J, Chen S, Han JX et al. (2018) Twist1 Regulates Vimentin through Cul2 Circular RNA to Promote EMT in Hepatocellular Carcinoma. Cancer Res 78: 4150–4162. doi: 10.1158/0008-5472.CAN-17-3009 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref035] 35.Evans RM, Mangelsdorf DJ (2014) Nuclear Receptors, RXR, and the Big Bang. Cell 157: 255–66. doi: 10.1016/j.cell.2014.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0314628.ref036] 36.Fujita H, Morii T, Fujishima H et al. (2014) The protective roles of GLP-1R signaling in diabetic nephropathy: possible mechanism and therapeutic potential. Kidney Int 85: 579–89. doi: 10.1038/ki.2013.427 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref037] 37.Tashiro Y, Sato K, Watanabe T et al. (2014) A glucagon-like peptide-1 analog liraglutide suppresses macrophage foam cell formation and atherosclerosis. Peptides 54: 19–26. doi: 10.1016/j.peptides.2013.12.015 [DOI] [PubMed] [Google Scholar]

[pone.0314628.ref038] 38.Nagashima M, Watanabe T, Terasaki M et al. (2011) Native incretins prevent the development of atherosclerotic lesions in apolipoprotein E knockout mice. Diabetologia 54: 2649–59. doi: 10.1007/s00125-011-2241-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

GLP-1RA improves diabetic renal injury by alleviating glomerular endothelial cells pyrotosis via RXRα/circ8411/miR-23a-5p/ABCA1 pathway

Weixi Wu

Yao Wang

Xian Shao

Shuai Huang

Jian Wang

Saijun Zhou

Hongyan Liu

Yao Lin

Pei Yu

Roles

Abstract

Background

Methods

Results

Conclusions

Introduction

Materials and methods

Cell culture experiments

Animal experimental design

Quantification of total cholesterol

Immunofluorescence

Cell death assay

Cell transfection

Table 1. The primer sequences for cell transfection.

RNA isolation and quantitative real-time PCR analyses

Table 2. The primer sequences for RT-qPCR.

Western blot analysis

Microarray analysis

Luciferase assay

Biochemical measurements and morphological analysis of kidneys

Hematoxylin and eosin (H&E) staining

Statistical analysis

Results

High glucose exacerbates intracellular cholesterol accumulation and pyroptosis under cholesterol load in GEnCs

Fig 1. High glucose exacerbates intracellular cholesterol accumulation under cholesterol load in GEnCs.

Fig 2. HG exacerbates GEnCs pyroptosis through ABCA1 under cholesterol load.

Circ8411/miR-23a-5p is involved in the regulation of ABCA1

Fig 3. Circ8411 is involved in the regulation of ABCA1.

Fig 4. The circ8411 regulates ABCA1 expression by regulating miR-23a-5p.

Fig 5. High glucose affects circ8411 down-regulation through RXRα.

GLP-1RA attenuated cholesterol accumulation and pyroptosis in GEnCs through RXRα-circ8411-miR-23a-5p-ABCA1

Fig 6. GLP-1RAs attenuated cholesterol accumulation and pyroptosis in GEnCs by increasing RXRα-circ8411-miR-23a-5p-ABCA1.

Renal injury was attenuated in GLP-1RAs-treated mice

Table 3. Biochemical characteristics of plasma and urine of mice.

Fig 7. GLP-1RAs alleviated kidney damage, cholesterol accumulation, and pyroptosis in the kidneys of ApoE-/-DM mice by increasing circ8411-ABCA1.

GLP-1RAs attenuated cholesterol accumulation and pyroptosis in the kidneys of ApoE-/-DM Mice by increasing circ8411-ABCA1 expression

Discussion

Fig 8. Proposed model for the signaling pathway by which high glucose participates in the GEnCs injury via the RXRα/circ8411/miR-23a-5p/ABCA1 pathway.

Supporting information

Acknowledgments

Abbreviations

Data Availability

Funding Statement

References

Decision Letter 0

Ravikanth Nanduri

Roles

Author response to Decision Letter 0

Decision Letter 1

Miquel Vall-llosera Camps

Roles

Author response to Decision Letter 1

Decision Letter 2

Joel Montané

Roles

Author response to Decision Letter 2

Decision Letter 3

Joel Montané

Roles

Acceptance letter

Joel Montané

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Fig 7. GLP-1RAs alleviated kidney damage, cholesterol accumulation, and pyroptosis in the kidneys of ApoE^-/-DM mice by increasing circ8411-ABCA1.

GLP-1RAs attenuated cholesterol accumulation and pyroptosis in the kidneys of ApoE^-/-DM Mice by increasing circ8411-ABCA1 expression