Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Nov 11.
Published in final edited form as: J Neurogenet. 2024 Nov 11;38(3):122–133. doi: 10.1080/01677063.2024.2426014

Targeted deletion of olfactory receptors in D. melanogaster via CRISPR/Cas9-mediated LexA knock-in

Runqi Zhang 1, Renny Ng 1, Shiuan-Tze Wu 1, Chih-Ying Su 1,*
PMCID: PMC11617259  NIHMSID: NIHMS2033848  PMID: 39529229

Abstract

The study of olfaction in Drosophila melanogaster has greatly benefited from genetic reagents such as olfactory receptor mutant lines and GAL4 reporter lines. The CRISPR/Cas9 gene-editing system has been increasingly used to create null receptor mutants or replace coding regions with GAL4 reporters. To further expand this toolkit for manipulating fly olfactory receptor neurons (ORNs), we generated null alleles for 11 different olfactory receptors by using CRISPR/Cas9 to knock in LexA drivers, including multiple lines for receptors which have thus far lacked knock-in mutants. The targeted neuronal types represent a broad range of antennal ORNs from all four morphological sensillum classes. Additionally, we confirmed their loss-of-function phenotypes, assessed receptor haploinsufficiency, and evaluated the specificity of the LexA knock-in drivers. These receptor mutant lines have been deposited at the Bloomington Drosophila Stock Center for use by the broader scientific community.

Keywords: Drosophila melanogaster, olfactory receptor neurons, empty neuron, olfactory receptors, single-sensillum recordings, LexA knock-in drivers, haploinsufficiency

Introduction

Animals rely on olfaction to detect and discriminate volatile environmental cues, which in turn guide behaviors such as foraging, mating, and aggression. Across insect species, odors are detected in the sensory dendrites of olfactory receptor neurons (ORNs) encapsulated within sensory hairs, termed sensilla, that cover the surface of antenna and maxillary palp (Su et al., 2009). Nearly all odorants are detected by receptors that belong to one of two gene families: Odorant Receptors (ORs) and Ionotropic Receptors (IRs) (Benton et al., 2009; Clyne et al., 1999; Vosshall et al., 1999). Insect ORs and IRs function as ligand-gated cation channels (Abuin et al., 2011; Butterwick et al., 2018; del Mármol et al., 2021) composed of a tuning receptor that determines ligand specificity, and one or two non-tuning co-receptors required for receptor function (Abuin et al., 2011; Benton et al., 2006; Dobritsa et al., 2003; Hallem, Ho, et al., 2004; Larsson et al., 2004; Rytz et al., 2013).

In D. melanogaster, the majority of ORNs detects odors with ORs that respond to a wide range of volatile chemicals enriched in fruits, plants, or pheromones (Su et al., 2009). These ORNs are primarily housed in the basiconic, intermediate, and trichoid morphological classes of sensilla (Couto et al., 2005; Dweck et al., 2015; Hallem, Ho, et al., 2004; Hallem & Carlson, 2006; C.-C. Lin & Potter, 2015; H.-H. Lin et al., 2016; van der Goes van Naters & Carlson, 2007). In contrast, a subset of ORNs located in the coeloconic sensilla utilizes IRs for odor detection and primarily responds to acids and amines (Abuin et al., 2011; Silbering et al., 2011; Yao et al., 2005). In addition to differences in receptors and neuronal morphologies, fly ORNs housed in different sensilla also vary in their peri-receptor environments. These variations include odorant binding proteins (Kim et al., 1998; Larter et al., 2016; Xiao et al., 2019), SNMP accessory proteins (Benton et al., 2007), and the extracellular membrane protein Osi8 (Scalzotto et al., 2022). Notably, these peri-receptor proteins are required for trichoid ORNs to respond to pheromone ligands with normal sensitivity or response kinetics (Benton et al., 2007; Gomez-Diaz et al., 2013; Li et al., 2014; Scalzotto et al., 2022).

Much of our understanding of insect olfactory receptor response profiles can be attributed to studies using the ‘empty neuron’ in vivo heterologous expression system. In a mutant lacking the endogenous Or22a receptor in the ab3A ORN, the ‘empty’ Δab3A neuron can be used to ectopically express olfactory receptors from diverse insect species, such as fruitflies, mosquitoes, moths, or tsetse flies (Carey et al., 2010; Chahda et al., 2019; de Fouchier et al., 2017; Dobritsa et al., 2003; Hallem, Ho, et al., 2004; Hallem, Nicole Fox, et al., 2004; Hallem & Carlson, 2006; Syed et al., 2006). This enables researchers to assess responses to a wide range of odorants through in vivo electrophysiological recordings, thereby facilitating large-scale high-throughput screens for receptors’ cognate ligands.

Despite its popularity, the Δab3A system has technical limitations. For example, its neighboring ab3B (Or85b) neurons are among the most broadly tuned ORNs, and their strong activation can complicate ab3A spike sorting or cause ephaptic inhibition of ab3A (Su et al., 2012; Zhang et al., 2019), potentially leading to false identification of inhibitory ligands. Additionally, as mentioned earlier, the Δab3A system lacks IR co-receptors and the trichoid peri-receptor environment, making it suboptimal for decoding IRs or pheromone-sensing ORs.

To address these limitations, alternative ‘empty neuron’ systems have been developed in D. melanogaster, notably the ΔT1 (Or67d) system for trichoid or intermediate ORs (Kurtovic et al., 2007; Ronderos et al., 2014) and the Δac4A (Ir84a) system for IRs (Grosjean et al., 2011). Additionally, null mutations for multiple olfactory receptors have been generated using a variety of genetic techniques (Table 1), potentially expanding the ‘empty neuron’ toolkit. However, many olfactory receptors still lack knock-in mutants, and there are currently limited receptor LexA knock-in reagents available for simultaneously expressing distinct effectors in multiple ORN types.

Table 1.

Olfactory receptor deletion mutant lines in D. melanogaster.

Sensillum/ORN Method Stock # Functional verification
ab1 A (Or42b) Or42bEY14886, P{EPgy2} mediated insertion (donated by the Bellen lab in 2004) (Bellen et al., 2011) BDSC 20956 Behavior (Semmelhack & Wang, 2009)
CRISPR/Cas9 targeted KO (Q. Wang et al., 2021) - ORN response (Q. Wang et al., 2021)
C (Gr21a) CRISPR/Cas9 targeted KO (Kumar et al., 2020) - ORN response (Kumar et al., 2020)
(Gr63a) HR mediated KO (Jones et al., 2007) BDSC 9941 ORN response & behavior (Jones et al., 2007)
D (Or10a) CRISPR/Cas9 targeted KO (Cao et al., 2017) - Behavior (Cao et al., 2017)
ab2 A (Or59b) CRISPR/Cas9 targeted KO (Q. Wang et al., 2021) - ORN response & behavior (Q. Wang et al., 2021)
*CRISPR/Cas9 targeted LexA KI BDSC 605643 ORN response
B (Or85a) CRISPR/Cas9 targeted KO (Cao et al., 2017) - Behavior (Cao et al., 2017)
*CRISPR/Cas9 targeted LexA KI BDSC 605647 ORN response
ab3 A (Or22a) Δhalo; derived from a Df(2L) line; deletion of the Or22a/b locus and the flanking genomic region (Merrill et al., 1988) BDSC 98383 ORN response (Dobritsa et al., 2003)
CRISPR/Cas9 targeted GAL4 KI (Chahda et al., 2019) BDSC 98382 ORN response (Chahda et al., 2019)
*CRISPR/Cas9 targeted LexA KI of Or22a BDSC 605639 ORN response
B (Or85b) *CRISPR/Cas9 targeted LexA KI of Or85b/c BDSC 605648 ORN response
ab4 A (Or7a) HR mediated GAL4 KI (C.-C. Lin et al., 2015) BDSC 91810 ORN response & behavior (C.-C. Lin et al., 2015)
CRISPR/Cas9 targeted KO (Q. Wang et al., 2021) - ORN response & behavior (Q. Wang et al., 2021)
*CRISPR/Cas9 targeted LexA KI BDSC 605638 ORN response
B (Or56a) HR mediated KO (Chin et al., 2018) - ORN response & behavior (Chin et al., 2018)
*CRISPR/Cas9 targeted LexA KI BDSC 605642 ORN response
ab5 A (Or82a) *CRISPR/Cas9 targeted LexA KI BDSC 605646 ORN response
B (Or47a) *CRISPR/Cas9 targeted LexA KI BDSC 605641 ORN response
ab7 A (Or98a) CRISPR/Cas9 targeted KO (Q. Wang et al., 2021) - ORN response & behavior (Q. Wang et al., 2021)
ab8 A (Or43b) HR mediated KO (Elmore et al., 2003) BDSC 97369 ORN response ORN (Elmore et al., 2003)
at1 (Or67d) HR mediated GAL4 KI (Kurtovic et al., 2007) - ORN response & behavior (Kurtovic et al., 2007)
at4 A (Or47b) HR mediated KO (L. Wang et al., 2011) BDSC 51306
BDSC 51307		 Behavior & ORN responses (Dweck et al., 2015; H.-H. Lin et al., 2016; L. Wang et al., 2011)
B (Or65a) FLP/FRT mediated KO, derived from a Df(3L) line, deleting Or65a/b/c (Pitts et al., 2016) BDSC 97372 No available ligand
*CRISPR/Cas9 targeted LexA KI, deleting partial 1st exon of Or65a BDSC 605644 No available ligand
C (Or88a) Imprecise P-element excision (created by the Vosshall and Tully labs) (Dweck et al., 2015) - ORN response & behavior (Dweck et al., 2015)
CRISPR/Cas9 targeted frameshift of the first exon (Pitts et al., 2016) BDSC 97373 ORN response (Pitts et al., 2016)
CRISPR/Cas9 targeted GAL4 KI (Shang et al., 2024) - ORN response (Shang et al., 2024)
*CRISPR/Cas9 targeted LexA KI BDSC 605649 ORN response
ai2 A (Or83c) Or83cMB11142, Minos mediated insertion (Metaxakis et al., 2005) - ORN response & behavior (Ronderos et al., 2014)
ai3 C (Or43a) *CRISPR/Cas9 targeted KO BDSC 605640 ORN response
ac1 B (Ir92a) CRISPR/Cas9 targeted KO (Vulpe et al., 2021) - ORN response (Vulpe et al., 2021)
ac3 I-A (Ir75b) CRISPR/Cas9 targeted KO of Ir75b (Mika et al., 2021) - Ir75b protein expression (Mika et al., 2021)
II-A (Ir75c) Ir75cMB08510, Minos mediated insertion (Bellen et al., 2011) BDSC 26382 Ir75c protein expression (Mika et al., 2021)
A (Ir75b/c) *CRISPR/Cas9 targeted LexA KI BDSC 605645 ORN response
B (Or35a) Or35af02057, piggyBac mediated insertion (Thibault et al., 2004) BDSC 18509 ORN response (Yao et al., 2005)
CRISPR/Cas9 targeted KO (Oh et al., 2021) KDRC 10564 Behavior (Oh et al., 2021)
ac4 A (Ir84a) HR mediated GAL4 KI (Grosjean et al., 2011) BDSC 41750 ORN response & behavior (Grosjean et al., 2011)
Open in a new tab

Antennal ORNs are named according to their relative spike size, labelled as A, B, C, and D in descending orders, and the type of sensilla they are associated with: basiconic (b), coeloconic (c), intermediate (i), and trichoid (t). The tuning receptors are indicated in parentheses. BDSC: Bloomington Drosophila Stock Center; HR: homologous recombination; KDRC: Korea Drosophila Resource Center; KO: knock-out; KI: knock-in.

*

Mutant lines generated and characterized in this study.

To expand the genetic tools available for manipulating fly ORNs, here we utilized CRISPR/Cas9 genome editing technology to generate null alleles for 12 individual olfactory receptors. Of these, 11 include LexA knock-in drivers. The targeted neuronal types broadly represent antennal ORNs from all four morphological classes—basiconic, coeloconic, intermediate, and trichoid (Nava Gonzales et al., 2021; Shanbhag et al., 1999). We also confirmed their loss-of-function phenotypes, assessed receptor haploinsufficiency, and evaluated the specificity of the LexA knock-in drivers. These receptor mutant lines have been deposited at the Bloomington Drosophila Stock Center for use by the broader scientific community.

Methods

Fly husbandry

All flies (D. melanogaster) were raised on standard cornmeal food containing molasses at 25°C, ∼60% humidity in an incubator with a 12-h light/dark cycle. Experimental flies were collected upon eclosion, separated by sex, and co-housed in groups of ten. Female flies aged 5 to 7 days were used for all experiments unless stated otherwise. All experimental flies were backcrossed to the w1118 genetic background for five generations.

Targeted deletion of olfactory receptors

Olfactory receptor mutant lines were generated by Wellgenetics Inc. using CRISPR/Cas9-mediated genome editing (Kondo & Ueda, 2013). The donor, gRNAs, and hs-Cas9 plasmids were injected into embryos of the control strain w1118. F1 flies carrying the selection marker (3xP3-RFP) were validated by genomic PCR and DNA sequencing. The 3xP3-RFP cassette can be excised by the Cre recombinase. Sequence information on the gRNAs and homologous arms for individual olfactory receptors is provided below.

Or7a/CG10759

The upstream and downstream gRNA sequences were CATGGCGGTGAGCAC TCGTG[TGG] and ATCTCGGCGAGCGATTCAAC[AGG], respectively. The upstream homology arm was −960 nt to −7 nt from the start codon of Or7a (forward oligo: 5’- TGTATGTATGCCACGTACACAG; reverse oligo: 5’- TGGACTTTTGACG CCTGGG). The downstream homology arm was +4 nt to +1,033 nt from the stop codon of Or7a (forward oligo: 5’- AGACCATTTATCGTTGATGCAC; reverse oligo: 5’- ATGCGACTTTGCCTCCTTTT). A 1,449-bp fragment of Or7a (−6 nt to +1,443 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or22a/CG12193

The upstream and downstream gRNA sequences were CACCCGATCCAAGTA AATGA[AGG] and GGTAATTAAGCAATTTAACT[TGG], respectively. The upstream homology arm was −1,043 nt to −13 nt from the start codon of Or22a (forward oligo: 5’- ACGAAGGTCCTTTTGTGTGC; reverse oligo: 5’- CCGTGGCTTTGTTTG AATATTTG). The downstream homology arm was +4 nt to +993 nt from the stop codon of Or22a (forward oligo: 5’- GTTGAGAGGGACGAGCTCT; reverse oligo: 5’- CATGTTAACGCCAATCTGGA). A 1,444-bp fragment of Or22a (from −5 nt to +1,439 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or43a/CG1854

The upstream and downstream gRNA sequences were TGCAGTTCGTCTACC TGCTG[CGG] and ACCATGCTGCGTGGCGTCAC[CGG], respectively. The upstream homology arm was +151 nt to +1,186 nt from the start codon of Or43a (forward oligo: 5’-TCATTGGTTGCTGGGAAAA; reverse oligo: 5’-CAGGTAGACG AACTGCATCAGA). The downstream homology arm was +20 nt to +1,013 nt from the stop codon of Or43a (forward oligo: 5’-AACCGGAGTATCCCCTTCC; reverse oligo: 5’-TGCAGTCGTCCTTCTTTGAA). A 1,540-bp fragment of Or43a (+151 nt to +1690 nt from the start codon) was deleted and replaced by the 3xP3-RFP cassette.

Or47a/CG13225

The upstream and downstream gRNA sequences were GAAGAGCACCATTG CCCTTC[TGG] and CATGGAGGCCTTCTCATCGG[TGG], respectively. The upstream homology arm was −1,027 nt to −10 nt from the start codon of Or47a (forward oligo: 5’-CAGACATGCCAAGATCGAAA; reverse oligo: 5’-GGTTAATTCGGCCTC ACACTA). The downstream homology arm was +13 nt to +1,019 nt from the stop codon of Or47a (forward oligo: 5’-GACCACAAGGCTTTGGATTGA; reverse oligo: 5’-CCCGATGGCTCCTATCAGTA). A 1,363-bp fragment of Or47a (−9 nt to +1,354 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or56a/CG12501

The upstream and downstream gRNA sequences were ACCATTGGAAGTATCGCAGG[TGG] and GGCTTTCCCTCTAATACAAG[TGG], respectively. The upstream homology arm was −1,010 nt to −9 nt from the start codon of Or56a (forward oligo: 5’-AGCTTGTGGAGCATTTCCAT; reverse oligo: 5’-GTTTAGCGTTAACCAT ATTCAAGG). The downstream homology arm was +4 nt to +1037 nt from the stop codon of Or56a (forward oligo: 5’-AGGGAAAGCCTTTTCTTCAGG; reverse oligo: 5’-AAGTGAACCACCAACCCTTTT). A 1,781-bp fragment of Or56a (from −8 nt to +1,773 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or59b/CG3569

The upstream and downstream gRNA sequences were ACCTTCTCGGTCAACGGAG C[CGG] and TTGCGGGGGCTCATGGGTGC[AGG], respectively. The upstream homology arm was −1,045 nt to −6 nt from the start codon of Or59b (forward oligo: 5’- GACCCATCCTGTCGATCACT; reverse oligo: 5’- CACTGACCGGTGGTCGGT). The downstream homology arm was +45 nt to +1,127 nt from the stop codon of Or59b (forward oligo: 5’- GAGCCCCCGCAAAAAAGAG; reverse oligo: 5’- AGCTGCAATTGTTTAGACAGG). A 1,356-bp fragment of Or59b (−6 nt to +1,350 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or65a/CG32401

The gRNA sequence was TTTCCGCTCACTCCGCAGCT[CGG]. The upstream homology arm was −1,072 nt to +3 nt from the start codon of Or65a (forward oligo: 5’- TGCCACATCCAAGTCCAGTA; reverse oligo: 5’- CATCTTTCAATCCGATCCAA). The downstream homology arm was +45 nt to +1129 nt from the start codon of Or65a (forward oligo: 5’- ATTGTTTGGACCGTTTTTCG; reverse oligo: 5’- CGACTTGGGGATTCTTCTTG). A 41-bp fragment of Or65a (from +4 nt to +44 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette. The insertion also generated a null Or65a allele.

Ir75b/CG42643 & Ir75c/CG42642

The upstream and downstream gRNA sequences were AAGCCGTCAAGATGACTAGT[TGG] and GCATTGAGGTGAGCAGTCCA[AGG], respectively. The upstream homology arm was −1,043 nt to −4 nt from the start codon of Ir75c (forward oligo: 5’-CGTGTTACCCGTTCTTTAAGGT; reverse oligo: 5’-GACGGCTTTCTTCGATTTTG). The downstream homology arm was +33 nt to +1,057 nt from the stop codon of Ir75b (forward oligo: 5’-ACAAGCAATTTCGGCCAAT; reverse oligo: 5’-AGGTGGAACCCGAATCTAGC). A 4,794-bp fragment of Ir75c and Ir75b (−3 nt to +4,791 nt from the start codon of Ir75c) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or82a/CG31519

The upstream and downstream gRNA sequences were TGTTCTAGAAACTGG GGTCA[TGG] and TATGACGAACTGCCCCATAA[CGG], respectively. The upstream homology arm was −506 nt to −12 nt from the start codon of Or82a (forward oligo: 5’-CAGTTAAGAGGTTTTGGTACATC; reverse oligo: 5’-CTAGAACATGAA AGGATTGCGC). The downstream homology arm was −531 nt to +97 from the stop codon of Or82a (forward oligo: 5’-CTCCTTGCAGGTTGGCGT; reverse oligo: 5’-CAGCAACACGTAAACTGTAACC). A 950-bp fragment of Or82a (−11 nt to +939 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or85a/CG7454

The upstream and downstream gRNA sequences were CGAAATAAGGATCCA AGGAC[TGG] and CAAGTCCATCTCATTTACAA[TGG], respectively. The upstream homology arm was −1,043 nt to −13 nt from the start codon of Or85a (forward oligo: 5’- GGGTAGTATGGAGCCCGTTT; reverse oligo: 5’- AGAGGTTTCGATTG ACTTGAAC). The downstream homology arm was +6 nt to +1,006 nt from the stop codon of Or85a (forward oligo: 5’- CGGTTTAGTGCCACAAATTTGA; reverse oligo: 5’- CATAATCCGCATTCCAAACC). A 1,322-bp fragment of Or85a (from −12 nt to +1,310 nt from the start codon) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or85b/CG11735 & Or85c/CG17911

The upstream and downstream gRNA sequences were AGCCGTATACGATTG ACTCG[CGG] and AGGAATTGAGGGATCTTCCC[TGG], respectively. The upstream homology arm was −1,021 nt to −17 nt from the start codon of Or85c (forward oligo: 5’- CATGCGTGATAAATGGCAAA; reverse oligo: 5’- AATCCAATAAGTGA TGGTCGGA). The downstream homology arm was +13 nt to +1,039 nt from the stop codon of Or85b (forward oligo: 5’- GGGAAGATCCCTCAATTCCTA; reverse oligo: 5’- GCACATTGGGAGCTTTGTAA). A 2,971-bp fragment of Or85b and Or85c (−16 nt to +2,955 nt from the start codon of Or85c) was deleted and replaced by the LexA::P65/3xP3-RFP cassette.

Or88a/CG14360

The gRNA sequence was CTTGGATCGGGAGTGTCCGC[GGG]. The upstream homology arm was −656 nt to +327 nt from the start codon of Or88a (forward oligo: 5’-CGCCAACGTGAACTAAAACC; reverse oligo: 5’-GTTAACAAACTCAA CGATTTCCT). The downstream homology arm was +369 nt to +1,347 nt from the start codon of Or88a (forward oligo: 5’-GGACATGCAAATGGATGAGAC; reverse oligo: 5’-AGGCCAGCTGCATTATCTGT). The T2A-LexA::P65/3xP3-RFP cassette was inserted immediately after N109 of Or88a, which created a 41-bp deletion (+328 nt to +368 nt from ATG of Or88a). The insertion also generated a null Or88a allele.

Single-sensillum recording

A fly was wedged into the narrow end of a truncated plastic 200-μl pipette tip to expose the antenna, which was subsequently stabilized between a tapered glass microcapillary and a coverslip covered with double-sided type (Hallem, Ho, et al., 2004; Ng et al., 2017). Single-sensillum recordings were performed as follows. Briefly, electrical activity of ORNs was recorded extracellularly by placing a sharp electrode filled with calcium-free adult hemolymph-like saline (AHL) (J. W. Wang et al., 2003) into a sensillum of interest, while an AHL-filled reference electrode was placed in the eye. No more than three sensilla were recorded from the same animals. Sensillum types were identified based on their characteristic locations on the antenna, morphologies, and odor response profiles of co-housed ORNs (de Bruyne et al., 2001; Grabe et al., 2016; Hallem & Carlson, 2006; Zhang et al., 2019). For the ac3 sensilla, type I and II were distinguished based on their ac3A differential responses to butyric acid (Prieto-Godino et al., 2017). The odorants for each sensillum type are listed in Table S1.

AC signals (100–20k Hz) and DC signals were simultaneously recorded on an NPI EXT-02F amplifier (ALA Scientific Instruments) and digitized at 5 kHz with Digidata 1550 (Molecular Devices). Spikes were detected and sorted using a custom MATLAB routine (Martelli & Fiala, 2019). Peri-stimulus time histograms were obtained by averaging spike activities in 50-ms bins and smoothing with a moving average window of 5 bins. The adjusted peak spike response frequency was calculated by subtracting the spontaneous firing rate measured one second before stimulus onset.

Odor stimuli

Odorants were acquired from Sigma-Aldrich at the highest available purity unless otherwise specified (see Table S1). The chemicals were diluted in paraffin oil (v/v) except for geosmin, which was diluted in dipropylene glycol; and trans-palmitoleic acid and 11-cis-vaccenyl acetate (cVA), which were diluted in ethanol. For long-range odor delivery, used for most odorants, 100 μl of each odorant dilution was applied to a filter disc, which was placed inside a glass Pasteur pipette and allowed to equilibrate for 20 min before use. Odor stimuli were then delivered via a pulse of air (200 ml/min) into the humidified main air stream (2000 ml/min). For methyl palmitate, the odorant was equilibrated overnight and delivered via a 250 ml/min air pulse. For short-range delivery, both cVA and palmitoleic acid (4.5 μl per filer disc) were delivered via a 500-ms air pulse at 250 ml/min directly to the antenna from close range, as previously described (Ng et al., 2017). The solvent ethanol was allowed to evaporate for 1 hour in a vacuum prior to experiments.

Immunohistochemistry

Female flies expressing mCD8-GFP in the target ORNs were anesthetized on ice, and their brains were dissected in phosphate-buffered saline (PBS). The brains were then fixed in PBS containing 4% paraformaldehyde (MPX00553, Fisher Scientific) at room temperature (RT) for 20 min. After fixation, the samples were washed three times in 0.3% PBT (PBS with 0.3% Triton X-100) and blocked in 0.3% PBT with 10% normal goat serum (NGS) at RT for 2 hours or at 4°C overnight. The brains were then stained with rabbit α–GFP (Life Technologies A11122, 1:400) and counterstained with the nc82 monoclonal antibody (Developmental Studies Hybridoma Bank, 1:50) in a dilution buffer (PBS with 1% NGS and 0.3% Triton X-100) at 4°C for 48 hours. Following staining, the samples were washed three times with 0.3% PBT at RT before being stained with the secondary antibodies Alexa 488 goat α-rabbit (Life Technologies A31628, 1:500) and Alexa 647 goat α-mouse (Life Technologies A21236, 1:500) in the dilution buffer at 4°C for 24–48 h. Finally, after three washes in 1% PBT at RT, the brains were mounted in RapiClear 1.49 (SUNJin LAB) and then imaged using the Zeiss LSM 880 confocal microscope with a C-Apochromat 40x (N.A.1.2) water immersion objective. Images were processed with ZEN (Zeiss) and Fiji in ImageJ (Schindelin et al., 2012).

Results

Olfactory receptor LexA knock-in mutants

In this study, we used CRISPR/Cas9-mediated genome editing technologies (Kondo & Ueda, 2013) to knock in LexA drivers by either disrupting the first exon or replacing the entire coding regions of the targeted olfactory receptors (Figure 1A and Methods). The targeted receptors are expressed in the following ORN types: ab2A (Or59b), ab2B (Or85a), ab3A (Or22a), ab3B (Or85b/c), ab4A (Or7a), ab4B (Or56a), ab5A (Or82a), ab5B (Or47a), at4B (Or65a), at4C (Or88a), and ac3A (Ir75b/c). Additionally, a knock-in deletion mutant was generated for ai3C (Or43a) without the LexA driver. These targeted neuronal types cover a broad range of antennal ORNs from all four morphological classes, and also include five pairs of neighboring ORNs housed in the same sensilla (ab2, ab3, ab4, ab5, and at4). Also included are four neuronal types that previously lacked knock-in receptor mutants (ab3B, ab5A, ab5B, and ai3C; see Table 1). All mutant lines were outcrossed to a standard genetic background (w1118) to minimize off-target effects.

Figure 1. Olfactory receptor knock-in mutants and loss-of-function phenotypes.

Figure 1.

Open in a new tab

A. Schematic of CRISPR/Cas9-mediated deletion of olfactory receptors. Two gRNAs were designed to target the 5’ and 3’ end of the receptor coding region. Homology-directed repair (HDR) replaced the coding region with a LexA driver and a 3xP3-RFP selection marker flanked by LoxP sites.

B. Single-sensillum recordings of target ORNs in wildtype controls (w1118, black traces) and olfactory receptor LexA knock-in mutants (color traces) in response to 0.5-sec odor stimulation (grey bar). The antennal sensillum types (basiconic/ab, intermediate/ai, coeloconic/ac, and trichoid/at), neuronal identities (A, B or C in descending order of relative spike amplitudes), targeted receptors, and tested odorants & dilutions (v/v) are indicated above the sample traces. E3HB: ethyl 3-hydroxybutyrate; cVA: 11-cis-vaccenyl acetate. Of note: A/B spikes for ab5 and ai3 sensilla, and B/C spikes for at4 sensilla could not be reliably distinguished, and so were counted in a combined manner. Basal firing rates were measured from 10-sec recordings without odor stimulation (n=6–18 neurons from 2–6 flies). Bar graphs show mean ± s.e.m. with individual data points overlaid. Statistical significance was determined by one-way ANOVA followed by Dunnett’s test and is indicated by different letters.

C. ORN peak spike activity in response to 0.5-sec odor stimulations, as shown in A. Bar graphs show mean ± s.e.m. with individual data points overlaid (n=6–12 neurons from 3–4 flies).

To confirm loss-of-function phenotypes of the receptor mutant lines, we first conducted single-sensillum recordings to verify that odor-evoked responses are abolished in the target ORNs. Sensilla of interest were identified according to their characteristic morphologies, locations on the antenna, and ORN responses to diagnostic odorants (de Bruyne et al., 2001; Grabe et al., 2016; Hallem & Carlson, 2006; Zhang et al., 2019). The odorants for each neuronal type are indicated in Table S1.

Of the 12 receptor mutants, we successfully confirmed loss-of-function phenotypes in 11 lines (Figures 1B and 1C). However, we were unable to verify ΔOr65aLexA due to the lack of appropriate ligands. Although the at4B neuron expressing the Or65a receptor has been implicated in responding to the pheromone ligand cis-vaccenyl acetate (cVA) based on behavioral studies (Bentzur et al., 2018; Ejima et al., 2007; Lebreton et al., 2014; Liu et al., 2011; Verschut et al., 2023), responses at the ORN level have been documented in only a single report (van der Goes van Naters & Carlson, 2007). Notably, we and others have consistently observed robust cVA-induced spike responses in at1 (Or67d) ORNs (Benton et al., 2007; Dweck et al., 2015; Elmore et al., 2003; Gomez-Diaz et al., 2013; Kurtovic et al., 2007; Zhang et al., 2020). In contrast, no cVA-induced spike responses were detected in at4B (Or65a) neurons, even when cVA was presented from close range (Figure 1B, the at4 panel) (Bentzur et al., 2018; Dweck et al., 2015; Gomez-Diaz et al., 2013; Ng et al., 2017). Taken together, functional recordings and PCR assays (not shown) confirm the effectiveness of the knock-out manipulations.

Given that tuning receptors play a key role in determining the spontaneous firing rate of ORNs (Hallem, Ho, et al., 2004), we then assessed whether the absence of tuning receptors affects the spontaneous (basal) firing frequency of target ORNs. In all mutant lines except for ΔOr47aLexA and ΔOr65aLexA—which maintained their spontaneous spike activity—the absence of tuning receptors led to a significant reduction in the basal ORN firing rate (Figure 1B). Although the extent of this reduction varied depending on the mutated receptor, we did not observe a complete loss of basal spike activity in any target neurons. This contrasts with the phenotype reported in the obligate OR co-receptor (orco) mutants, which show a loss of basal spikes (Larsson et al., 2004), likely due to activity-dependent neurodegeneration (Chiang et al., 2009; Task & Potter, 2021). Our results suggest that the remaining non-tuning co-receptors (Orco or Ir8a in our target ORNs) (Abuin et al., 2011; Larsson et al., 2004) are sufficient to maintain certain level of spontaneous neural activity.

A systematic survey for receptor haploinsufficiency

Our collection of olfactory receptor mutants allows us to systematically investigate receptor haploinsufficiency—that is, to determine whether the target neuron’s odorant response is sensitive to receptor gene dosage (Roote & Russell, 2012). Additionally, given that expressing various effectors using our LexA knock-in driver lines will require flies with a heterozygous receptor mutant background, it is critical to understand whether receptor haploinsufficiency affects ORN sensitivity. To address this, we compared dose-response curves between wildtype (w1118, +/+) and heterozygous receptor mutant lines (+/−). Our survey included the 11 receptor mutant lines generated in this study with confirmed response phenotypes (Figure 1B), as well as two previously verified pheromone receptor mutant lines (Or47b and Or67d) (Dweck et al., 2015; Kurtovic et al., 2007; H.-H. Lin et al., 2016; L. Wang et al., 2011).

Among the 13 heterozygous receptor mutant lines we examined, only two—Or85a and Or88a—exhibited haploinsufficiency phenotypes (Figure 2A). It is possible that the expression levels of these two receptors are markedly reduced in heterozygous mutants. This result also suggests that olfactory acuity in most ORNs is not sensitive to receptor gene dosage, or that the receptor expression levels are comparable between wildtype and heterozygous mutants. Of note, our observation of reduced at4C responses to the odorant methyl palmitate in ΔOr88aLexA heterozygous mutants aligns with a recent study that examined another Or88a mutant allele (ΔOr88aGAL4) with a different odorant, methyl myristate (Shang et al., 2024). This indicates that the haploinsufficiency phenotype is not ligand-specific and can be observed across multiple mutant alleles.

Figure 2. Analysis for olfactory receptor haploinsufficiency.

Figure 2.

Open in a new tab

Single-sensillum recordings were conducted to compare the dose-response relationships of target ORNs between wildtype controls (+/+) and heterozygous receptor mutants (+/−). Left: Peri-stimulus time histograms showing responses to increasing odorant concentrations (binned at 50 ms). Grey bar: 0.5-sec odor stimulus. Vertical scale bar: 50 Hz unless otherwise noted. Right: Dose-response curves (n=6–10 neurons, from 3–5 flies). Data are presented as mean ± s.e.m. with the fit based on the Hill equation. Odor concentrations are expressed as logarithmic volume-to-volume or weight-to-volume dilutions. Statistical significance was determined by two-way ANOVA with ** p < 0.01 and *** p < 0.001.

We note that Or88a is one of the four pheromone-sensing odorant receptors, which also include Or47b, Or65a, and Or67d (van der Goes van Naters & Carlson, 2007). To determine whether haploinsufficiency is common among pheromone receptors, we also examined Or47b and Or67d, the other receptors with known pheromone ligands (Dweck et al., 2015; Kurtovic et al., 2007; H.-H. Lin et al., 2016; van der Goes van Naters & Carlson, 2007). Interestingly and in contrast to Or88a, heterozygous mutants for Or47b or Or67d exhibited the same pheromone sensitivity as wildtype controls (Figure 2). These observations suggest that haploinsufficiency phenotypes are heterogenous among pheromone-sensing odorant receptors.

Expression of the LexA knock-in drivers

To examine the expression of the 11 new LexA knock-in drivers, we crossed the driver lines—either with or without the RFP selection marker (Figure 3A)—to a lexAop-6xGFP reporter line (Shearin et al., 2014). We then used confocal microscopy to image the ORN axonal projections in the antennal lobe. For most LexA lines containing the RFP selection marker, we observed strong labelling in the expected glomeruli (Couto et al., 2005; Fishilevich & Vosshall, 2005; Prieto-Godino et al., 2017), with the exception of ΔOr85b/cLexA, which only weakly labelled its corresponding VM5d glomerulus (Auer et al., 2020) (Figures 3B and 3C), suggesting low penetrance. Given that we deleted the entire coding region in the genome for this LexA knock-in mutant, the weak labelling in VM5d raises the possibility that in addition to the 5’ promoter, the introns of Or85b/c or the intergenic region between Or85b and Or85c also play a significant role in regulating its robust gene expression.

Figure 3. Expression of the receptor LexA knock-in drivers.

Figure 3.

Open in a new tab

A. Schematic of a receptor-LexA knock-in driver with a 3xP3-RFP selection marker, or with the selection marker excised by Cre recombinase.

B. Antennal lobe images of receptor-LexA knock-in>6xGFP flies are shown as z-projections of multiple adjacent confocal sections. Target ORN axons were labelled with anti-GFP (green) and counterstained with nc82 to visualize the glomerular structure (magenta). Left: LexA drivers with the RFP selection marker; Right: LexA drivers without the selection marker. The targeted receptors and their expected glomerular projections are indicated. Scale bar: 20 μm.

C. As in B, but only with the LexA knock-in drivers containing the RFP selection marker.

On the other hand, in terms of specificity, all knock-in LexA lines labelled only their respective cognate glomeruli, except for the ΔOr85aLexA driver line, which also weakly labelled several additional glomeruli. Of note, no ectopic labelling outside the antennal lobes was observed in the brain. However, among the 10 driver lines that exclusively labelled their cognate glomeruli, we unexpectedly observed in some flies ectopic GFP signal in the projection neurons (PNs) of five lines—ΔOr7aLexA, ΔOr22aLexA, ΔOr47aLexA, ΔOr59bLexA, and ΔOr82aLexA (Figure 3B, left panels). The ectopically labeled cells are mainly postsynaptic PNs as we could trace their neuronal processes only to the cognate antennal lobes (not shown). Notably, for most driver lines, the ectopic labelling in PNs or other glomeruli was markedly reduced or eliminated when the RFP selection marker was removed in the excision lines (Figures 3B, right panels). This observation suggests that the presence of the selection marker may affect the specificity of the knock-in LexA drivers. Lastly, for ΔOr85b/cLexA, the excision of the RFP marker abolished all labelling of ORN soma in the antenna (not shown) and ORN axonal projections in the antennal lobe (Figures 3B, Or85b/c, right panel).

Discussion

In this study, we described the creation of null mutations for 12 different olfactory receptors using CRISPR/Cas9 genome editing technology. Of these, 11 mutant lines also include LexA knock-in drivers. These new genetic reagents are available at the Bloomington Drosophila Stock Center.

Heretofore, olfactory receptor LexA lines were relatively scarce compared to GAL4 lines. However, our LexA lines, when used in conjunction with existing GAL4 lines, enable the expression of two different effectors in two distinct neuronal populations. These new tools provide valuable opportunities and approaches to address key outstanding questions regarding both olfaction in the sensory periphery and also signalling in the central olfactory circuit. For example, an olfactory receptor LexA line can be used to genetically manipulate a peripheral ORN population, while a GAL4 line labelling central neurons can be used to express an activity reporter to monitor downstream activity. Our reagents thus allow for the simultaneous manipulation and monitoring of different nodes in the neural circuit, thereby significantly expanding and enhancing the capabilities of current genetic toolbox for Drosophila research.

Supplementary Material

Supp 1

Acknowledgments

We thank Carlotta Martelli for sharing the custom MATLAB routine for spike sorting and Yiyi Xiao for assistance with spike analysis. We also acknowledge Stephanie Mauthner at the Bloomington Drosophila Stock Center (NIH P40OD018537) for overseeing the deposition of our fly lines, and the UCSD School of Medicine Microscopy Core (NINDS P30NS047101).

Funding

This work was supported by NIH grants to CYS (R21DC020536, R21AI169343, R01DC016466, and R01DC021551). RZ was supported by the UCSD Curci Foundation Scholars program, and RN by the NIGMS T32 UCSD PiBS Training Program and ARCS Foundation Fellowship Award.

Footnotes

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

Fly lines generated in this study are available at the Bloomington Drosophila Stock Center. For additional information or data requests, please contact the corresponding author, Chih-Ying Su (c8su@ucsd.edu).

References

  1. Abuin L, Bargeton B, Ulbrich MH, Isacoff EY, Kellenberger S, & Benton R (2011). Functional architecture of olfactory ionotropic glutamate receptors. Neuron, 69(1), 44–60. 10.1016/j.neuron.2010.11.042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Auer TO, Khallaf MA, Silbering AF, Zappia G, Ellis K, Álvarez-Ocaña R, Arguello JR, Hansson BS, Jefferis GSXE, Caron SJC, Knaden M, & Benton R (2020). Olfactory receptor and circuit evolution promote host specialization. Nature, 579(7799), 402–408. 10.1038/s41586-020-2073-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bellen HJ, Levis RW, He Y, Carlson JW, Evans-Holm M, Bae E, Kim J, Metaxakis A, Savakis C, Schulze KL, Hoskins RA, & Spradling AC (2011). The Drosophila gene disruption project: Progress using transposons with distinctive site specificities. Genetics, 188(3), 731–743. 10.1534/genetics.111.126995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Benton R, Sachse S, Michnick SW, & Vosshall LB (2006). Atypical membrane topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS Biology, 4(2), e20. 10.1371/journal.pbio.0040020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Benton R, Vannice KS, Gomez-Diaz C, & Vosshall LB (2009). Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila. Cell, 136(1), 149–162. 10.1016/j.cell.2008.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Benton R, Vannice KS, & Vosshall LB (2007). An essential role for a CD36-related receptor in pheromone detection in Drosophila. Nature, 450(7167), 289–293. 10.1038/nature06328 [DOI] [PubMed] [Google Scholar]
  7. Bentzur A, Shmueli A, Omesi L, Ryvkin J, Knapp J, Parnas M, Davis FP, & Shohat-Ophir G (2018). Odorant binding protein 69a connects social interaction to modulation of social responsiveness in Drosophila. PLoS Genetics, 14(4), e1007328. 10.1371/journal.pgen.1007328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Butterwick JA, del Mármol J, Kim KH, Kahlson MA, Rogow JA, Walz T, & Ruta V (2018). Cryo-EM structure of the insect olfactory receptor Orco. Nature, 560(7719), 447–452. 10.1038/s41586-018-0420-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cao LH, Yang D, Wu W, Zeng X, Jing BY, Li MT, Qin S, Tang C, Tu Y, & Luo DG (2017). Odor-evoked inhibition of olfactory sensory neurons drives olfactory perception in Drosophila. Nature Communications, 8(1), 1–13. 10.1038/s41467-017-01185-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Carey AF, Wang G, Su C-Y, Zwiebel LJ, & Carlson JR (2010). Odorant reception in the malaria mosquito Anopheles gambiae. Nature, 464(7285), 66–71. 10.1038/nature08834 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chahda JS, Soni N, Sun JS, Ebrahim SAM, Weiss BL, & Carlson JR (2019). The molecular and cellular basis of olfactory response to tsetse fly attractants. PLoS Genetics, 15(3), 1–22. 10.1371/journal.pgen.1008005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chiang A, Priya R, Ramaswami M, VijayRaghavan K, & Rodrigues V (2009). Neuronal activity and Wnt signaling act through Gsk3-β to regulate axonal integrity in mature Drosophila olfactory sensory neurons. Development, 136(8), 1273–1282. 10.1242/dev.031377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chin SG, Maguire SE, Huoviala P, Jefferis GSXE, & Potter CJ (2018). Olfactory Neurons and Brain Centers Directing Oviposition Decisions in Drosophila. Cell Reports, 24(6), 1667–1678. 10.1016/j.celrep.2018.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Clyne PJ, Warr CG, Freeman MR, Lessing D, Kim J, & Carlson JR (1999). A novel family of divergent seven-transmembrane proteins: candidate odorant receptors in Drosophila. Neuron, 22(2), 327–338. http://www.ncbi.nlm.nih.gov/pubmed/10069338 [DOI] [PubMed] [Google Scholar]
  15. Couto A, Alenius M, & Dickson BJ (2005). Molecular, anatomical, and functional organization of the Drosophila olfactory system. Current Biology, 15(17), 1535–1547. 10.1016/j.cub.2005.07.034 [DOI] [PubMed] [Google Scholar]
  16. de Bruyne M, Foster K, & Carlson JR (2001). Odor Coding in the Drosophila Antenna. Neuron, 30(2), 537–552. 10.1016/S0896-6273(01)00289-6 [DOI] [PubMed] [Google Scholar]
  17. de Fouchier A, Walker WB, Montagné N, Steiner C, Binyameen M, Schlyter F, Chertemps T, Maria A, François MC, Monsempes C, Anderson P, Hansson BS, Larsson MC, & Jacquin-Joly E (2017). Functional evolution of Lepidoptera olfactory receptors revealed by deorphanization of a moth repertoire. Nature Communications, 8. 10.1038/ncomms15709 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. del Mármol J, Yedlin MA, & Ruta V (2021). The structural basis of odorant recognition in insect olfactory receptors. Nature, 597(7874), 126–131. 10.1038/s41586-021-03794-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dobritsa AA, Van Der Goes Van Naters W, Warr CG, Steinbrecht RA, & Carlson JR (2003). Integrating the molecular and cellular basis of odor coding in the Drosophila antenna. Neuron, 37(5), 827–841. 10.1016/S0896-6273(03)00094-1 [DOI] [PubMed] [Google Scholar]
  20. Dweck HKM, Ebrahim SAM, Thoma M, Mohamed AAM, Keesey IW, Trona F, Lavista-Llanos S, Svatoš A, Sachse S, Knaden M, & Hansson BS (2015). Pheromones mediating copulation and attraction in Drosophila. Proceedings of the National Academy of Sciences, 112, 2829–2835. 10.1073/pnas.1504527112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ejima A, Smith BPC, Lucas C, van der Goes van Naters W, Miller CJ, Carlson JR, Levine JD, & Griffith LC (2007). Generalization of Courtship Learning in Drosophila Is Mediated by cis-Vaccenyl Acetate. Current Biology, 17(7), 599–605. 10.1016/j.cub.2007.01.053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Elmore T, Ignell R, Carlson JR, & Smith DP (2003). Targeted Mutation of a Drosophila Odor Receptor Defines Receptor Requirement in a Novel Class of Sensillum. Journal of Neuroscience, 23(30), 9906–9912. 10.1523/jneurosci.23-30-09906.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fishilevich E, & Vosshall LB (2005). Genetic and functional subdivision of the Drosophila antennal lobe. Current Biology, 15(17), 1548–1553. 10.1016/j.cub.2005.07.066 [DOI] [PubMed] [Google Scholar]
  24. Gomez-Diaz C, Reina JH, Cambillau C, & Benton R (2013). Ligands for Pheromone-Sensing Neurons Are Not Conformationally Activated Odorant Binding Proteins. PLoS Biology, 11(4), e1001546. 10.1371/journal.pbio.1001546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Grabe V, Baschwitz A, Dweck HKM, Lavista-Llanos S, Hansson BS, & Sachse S (2016). Elucidating the neuronal architecture of olfactory glomeruli in the Drosophila antennal lobe. Cell Reports, 16(12), 3401–3413. 10.1016/j.celrep.2016.08.063 [DOI] [PubMed] [Google Scholar]
  26. Grosjean Y, Rytz R, Farine JP, Abuin L, Cortot J, Jefferis GSXE, & Benton R (2011). An olfactory receptor for food-derived odours promotes male courtship in Drosophila. Nature, 478(7368), 236–240. 10.1038/nature10428 [DOI] [PubMed] [Google Scholar]
  27. Hallem EA, & Carlson JR (2006). Coding of odors by a receptor repertoire. Cell, 125(1), 143–160. 10.1016/j.cell.2006.01.050 [DOI] [PubMed] [Google Scholar]
  28. Hallem EA, Ho MG, & Carlson JR (2004). The molecular basis of odor coding in the Drosophila antenna. Cell, 117(7), 965–979. 10.1016/j.cell.2004.05.012 [DOI] [PubMed] [Google Scholar]
  29. Hallem EA, Nicole Fox A, Zwiebel LJ, & Carlson JR (2004). Mosquito receptor for human-sweat odorant. Nature, 427(6971), 212–213. 10.1038/427212a [DOI] [PubMed] [Google Scholar]
  30. Jones WD, Cayirlioglu P, Kadow IG, & Vosshall LB (2007). Two chemosensory receptors together mediate carbon dioxide detection in Drosophila. Nature, 445(7123), 86–90. 10.1038/nature05466 [DOI] [PubMed] [Google Scholar]
  31. Kim MS, Repp A, & Smith DP (1998). LUSH odorant-binding protein mediates chemosensory responses to alcohols in Drosophila melanogaster. Genetics, 150(2), 711–721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kondo S, & Ueda R (2013). Highly Improved gene targeting by germline-specific Cas9 expression in Drosophila. Genetics, 195(3), 715–721. 10.1534/genetics.113.156737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kumar A, Tauxe GM, Perry S, Scott CA, Dahanukar A, & Ray A (2020). Contributions of the Conserved Insect Carbon Dioxide Receptor Subunits to Odor Detection. Cell Reports, 31(2). 10.1016/j.celrep.2020.03.074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kurtovic A, Widmer A, & Dickson BJ (2007). A single class of olfactory neurons mediates behavioural responses to a Drosophila sex pheromone. Nature, 446(7135), 542–546. 10.1038/nature05672 [DOI] [PubMed] [Google Scholar]
  35. Larsson MC, Domingos AI, Jones WD, Chiappe ME, Amrein H, & Vosshall LB (2004). Or83b encodes a broadly expressed odorant receptor essential for Drosophila olfaction. Neuron, 43(5), 703–714. 10.1016/j.neuron.2004.08.019 [DOI] [PubMed] [Google Scholar]
  36. Larter NK, Sun JS, & Carlson JR (2016). Organization and function of Drosophila odorant binding proteins. ELife, 5(NOVEMBER2016), e20242. 10.7554/eLife.20242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lebreton S, Grabe V, Omondi AB, Ignell R, Becher PG, Hansson BS, Sachse S, & Witzgall P (2014). Love makes smell blind: Mating suppresses pheromone attraction in Drosophila females via Or65a olfactory neurons. Scientific Reports, 4, 1–6. 10.1038/srep07119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li Z, Ni JD, Huang J, & Montell C (2014). Requirement for Drosophila SNMP1 for Rapid Activation and Termination of Pheromone-Induced Activity. PLoS Genetics, 10(9). 10.1371/journal.pgen.1004600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lin C-C, & Potter CJ (2015). Re-classification of Drosophila melanogaster trichoid and intermediate sensilla using fluorescence-guided single sensillum recording. PLoS ONE, 10(10), e0139675. 10.1371/journal.pone.0139675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lin C-C, Prokop-Prigge KA, Preti G, & Potter CJ (2015). Food odors trigger Drosophila males to deposit a pheromone that guides aggregation and female oviposition decisions. ELife, 4, 1–26. 10.7554/elife.08688 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Lin H-H, Cao D-S, Sethi S, Zeng Z, Chin JSR, Chakraborty TS, Shepherd AK, Nguyen CA, Yew JY, Su C-Y, & Wang JW (2016). Hormonal modulation of pheromone detection enhances male courtship success. Neuron, 90(6), 1272–1285. 10.1016/j.neuron.2016.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Liu W, Liang X, Gong J, Yang Z, Zhang Y-H, Zhang J-X, & Rao Y (2011). Social regulation of aggression by pheromonal activation of Or65a olfactory neurons in Drosophila. Nature Neuroscience, 14(7), 896–902. 10.1038/nn.2836 [DOI] [PubMed] [Google Scholar]
  43. Martelli C, & Fiala A (2019). Slow presynaptic mechanisms that mediate adaptation in the olfactory pathway of Drosophila. ELife, 8, 1–26. 10.7554/eLife.43735 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Merrill PT, Sweeton D, & Wieschaus E (1988). Requirements for autosomal gene activity during precellular stages of Drosophila melanogaster. Development, 104(3), 495–509. 10.1242/dev.104.3.495 [DOI] [PubMed] [Google Scholar]
  45. Metaxakis A, Oehler S, Klinakis A, & Savakis C (2005). Minos as a genetic and genomic tool in Drosophila melanogaster. Genetics, 171(2), 571–581. 10.1534/genetics.105.041848 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mika K, Cruchet S, Chai PC, Prieto-Godino LL, Auer TO, Pradervand S, & Benton R (2021). Olfactory receptor–dependent receptor repression in Drosophila. Science Advances, 7(32), eabe3745. 10.1126/sciadv.abe3745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Nava Gonzales C, McKaughan Q, Bushong EA, Cauwenberghs K, Ng R, Madany M, Ellisman MH, & Su CY (2021). Systematic morphological and morphometric analysis of identified olfactory receptor neurons in drosophila melanogaster. ELife, 10, 2021.04.28.441861. 10.7554/eLife.69896 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ng R, Lin HH, Wang JW, & Su CY (2017). Electrophysiological Recording from Drosophila Trichoid Sensilla in Response to Odorants of Low Volatility. Journal of Visualized Experiments : JoVE, 125, e56147. 10.3791/56147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Oh SM, Jeong K, Seo JT, & Moon SJ (2021). Multisensory interactions regulate feeding behavior in Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 118(7). 10.1073/pnas.2004523118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Pitts S, Pelser E, Meeks J, & Smith D (2016). Odorant responses and courtship behaviors influenced by at4 neurons in Drosophila. PLoS ONE, 11(9), 1–15. 10.1371/journal.pone.0162761 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Prieto-Godino LL, Rytz R, Cruchet S, Bargeton B, Abuin L, Silbering AF, Ruta V, Dal Peraro M, & Benton R (2017). Evolution of Acid-Sensing Olfactory Circuits in Drosophilids. Neuron, 93(3), 661–676.e6. 10.1016/j.neuron.2016.12.024 [DOI] [PubMed] [Google Scholar]
  52. Ronderos DS, Lin CC, Potter CJ, & Smith DP (2014). Farnesol-detecting olfactory neurons in drosophila. Journal of Neuroscience, 34(11), 3959–3968. 10.1523/JNEUROSCI.4582-13.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Roote J, & Russell S (2012). Toward a complete Drosophila deficiency kit. Genome Biology, 13(3), 6–8. 10.1186/gb-2012-13-3-149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Rytz R, Croset V, & Benton R (2013). Ionotropic Receptors (IRs): Chemosensory ionotropic glutamate receptors in Drosophila and beyond. Insect Biochemistry and Molecular Biology, 43(9), 888–897. 10.1016/j.ibmb.2013.02.007 [DOI] [PubMed] [Google Scholar]
  55. Scalzotto M, Ng R, Cruchet S, Saina M, Armida J, Su CY, & Benton R (2022). Pheromone sensing in Drosophila requires support cell-expressed Osiris 8. BMC Biology, 20(1), 230. 10.1186/s12915-022-01425-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, & Cardona A (2012). Fiji: An open-source platform for biological-image analysis. Nature Methods, 9(7), 676–682. 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Semmelhack JL, & Wang JW (2009). Select Drosophila glomeruli mediate innate olfactory attraction and aversion. Nature, 459(7244), 218–223. 10.1038/nature07983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Shanbhag SR, Muller B, & Steinbrecht RA (1999). Atlas of olfactory organs of Drosophila melanogaster 1. Types, external organization, innervation and distribution of olfactory sensilla. In International Journal of Insect Morphology and Embryology (pp. 377–397). 10.1016/S1467-8039(00)00028-1 [DOI] [Google Scholar]
  59. Shang X, Talross GJS, & Carlson JR (2024). Exitron splicing of odor receptor genes in Drosophila. Proceedings of the National Academy of Sciences, 121(13), 2017. 10.1073/pnas.2320277121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Shearin HK, Macdonald IS, Spector LP, & Stowers RS (2014). Hexameric GFP and mCherry reporters for the Drosophila GAL4, Q, and LexA transcription systems. Genetics, 196(4), 951–960. 10.1534/genetics.113.161141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Silbering AF, Rytz R, Grosjean Y, Abuin L, Ramdya P, Jefferis GSXE, & Benton R (2011). Complementary function and integrated wiring of the evolutionarily distinct Drosophila olfactory subsystems. Journal of Neuroscience, 31(38), 13357–13375. 10.1523/JNEUROSCI.2360-11.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Su C-Y, Menuz K, & Carlson JR (2009). Olfactory perception: receptors, cells, and circuits. Cell, 139(1), 45–59. 10.1016/j.cell.2009.09.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Su C-Y, Menuz K, Reisert J, & Carlson JR (2012). Non-synaptic inhibition between grouped neurons in an olfactory circuit. Nature, 492(7427), 66–71. 10.1038/nature11712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Syed Z, Ishida Y, Taylor K, Kimbrell DA, & Leal WS (2006). Pheromone reception in fruit flies expressing a moth’s odorant receptor. Proceedings of the National Academy of Sciences of the United States of America, 103(44), 16538–16543. 10.1073/pnas.0607874103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Task D, & Potter CJ (2021). Rapid degeneration of Drosophila olfactory neurons in Orco mutant maxillary palps. MicroPublication Biology, 2021, 2–7. 10.17912/micropub.biology.000398 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, Buchholz R, Demsky M, Fawcett R, Francis-Lang HL, Ryner L, Cheung LM, Chong A, Erickson C, Fisher WW, Greer K, Hartouni SR, Howie E, Jakkula L, … Margolis J (2004). A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nature Genetics, 36(3), 283–287. 10.1038/ng1314 [DOI] [PubMed] [Google Scholar]
  67. van der Goes van Naters W, & Carlson JR (2007). Receptors and Neurons for Fly Odors in Drosophila. Current Biology, 17(7), 606–612. 10.1016/j.cub.2007.02.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Verschut TA, Ng R, Doubovetzky NP, Le Calvez G, Sneep JL, Minnaard AJ, Su CY, Carlsson MA, Wertheim B, & Billeter JC (2023). Aggregation pheromones have a non-linear effect on oviposition behavior in Drosophila melanogaster. Nature Communications, 14(1), 1544. 10.1038/s41467-023-37046-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Vosshall LB, Amrein H, Morozov PS, Rzhetsky A, & Axel R (1999). A spatial map of olfactory receptor expression in the Drosophila antenna. Cell, 96(5), 725–736. 10.1016/S0092-8674(00)80582-6 [DOI] [PubMed] [Google Scholar]
  70. Vulpe A, Kim HS, Ballou S, Wu ST, Grabe V, Nava Gonzales C, Liang T, Sachse S, Jeanne JM, Su CY, & Menuz K (2021). An ammonium transporter is a non-canonical olfactory receptor for ammonia. Current Biology, 31(15), 3382–3390.e7. 10.1016/j.cub.2021.05.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wang JW, Wong AM, Flores J, Vosshall LB, & Axel R (2003). Two-photon calcium imaging reveals an odor-evoked map of activity in the fly brain. Cell, 112(2), 271–282. 10.1016/S0092-8674(03)00004-7 [DOI] [PubMed] [Google Scholar]
  72. Wang L, Han X, Mehren J, Hiroi M, Billeter J-C, Miyamoto T, Amrein H, Levine JD, & Anderson DJ (2011). Hierarchical chemosensory regulation of male-male social interactions in Drosophila. Nature Neuroscience, 14(6), 757–762. 10.1038/nn.2800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wang Q, Xu P, Andreazza F, Liu Y, Nomura Y, Duran P, Jiang L, Chen M, Takamatsu G, Ihara M, Matsuda K, Isaacs R, Oliveira EE, Du Y, & Dong K (2021). Identification of multiple odorant receptors essential for pyrethrum repellency in Drosophila melanogaster. PLoS Genetics, 17(7), 1–17. 10.1371/journal.pgen.1009677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Xiao S, Sun JS, & Carlson JR (2019). Robust olfactory responses in the absence of odorant binding proteins. ELife, 8, 1–17. 10.7554/eLife.51040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Yao CA, Ignell R, & Carlson JR (2005). Chemosensory coding by neurons in the coeloconic sensilla of the Drosophila antenna. The Journal of Neuroscience, 25(37), 8359–8367. 10.1523/JNEUROSCI.2432-05.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zhang Y, Ng R, Neville MC, Goodwin SF, & Su CY (2020). Distinct Roles and Synergistic Function of FruM Isoforms in Drosophila Olfactory Receptor Neurons. Cell Reports, 33(11), 108516. 10.1016/j.celrep.2020.108516 [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Zhang Y, Tsang TK, Bushong EA, Chu LA, Chiang AS, Ellisman MH, Reingruber J, & Su CY (2019). Asymmetric ephaptic inhibition between compartmentalized olfactory receptor neurons. Nature Communications, 10(1), 1560. 10.1038/s41467-019-09346-z [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp 1
NIHMS2033848-supplement-Supp_1.pdf (60KB, pdf)

Data Availability Statement

Fly lines generated in this study are available at the Bloomington Drosophila Stock Center. For additional information or data requests, please contact the corresponding author, Chih-Ying Su (c8su@ucsd.edu).

RESOURCES