Skip to main content
Current Research in Parasitology & Vector-borne Diseases logoLink to Current Research in Parasitology & Vector-borne Diseases
. 2024 Sep 24;6:100217. doi: 10.1016/j.crpvbd.2024.100217

Novel duplex TaqMan-based quantitative PCR for rapid and accurate diagnosis of Leishmania (Mundinia) martiniquensis and Leishmania (Mundinia) orientalis, responsible for autochthonous leishmaniasis in Thailand

Kanok Preativatanyou a,b, Nopporn Songumpai c, Pathamet Khositharattanakool d,e, Rinnara Ampol a,b, Chulaluk Promrangsee f, Chatchapon Sricharoensuk a,b, Kobpat Phadungsaksawasdi a,b, Thanapat Pataradool a,b, Tomas Becvar g, Barbora Vojtkova g, Petr Volf g, Padet Siriyasatien a,b,∗
PMCID: PMC11619792  PMID: 39640917

Abstract

The World Health Organization has recently declared Thailand a leishmaniasis hotspot in Southeast Asia due to the continuous increase in new symptomatic and asymptomatic cases over the years. This emerging parasitic disease is known to be caused by two autochthonous species of Leishmania belonging to the newly described subgenus Mundinia, namely L. martiniquensis and L. orientalis. In Thailand, clinical cases due to L. martiniquensis typically present with visceral leishmaniasis, whereas L. orientalis mainly causes localized cutaneous leishmaniasis. Although Leishmania species confirmation is essential for clinical diagnosis and treatment planning, the availability of highly accurate and rapid diagnostic methods remains limited. In this study, we developed a duplex TaqMan quantitative PCR assay using newly designed species-specific primers and probes based on sequences from the nucleotide and genome databases of Leishmania spp. retrieved from GenBank. The duplex qPCR assay was optimized to specifically amplify the internal transcribed spacer 1 (ITS1) of L. martiniquensis and the heat shock protein 70 (type I) intergenic region (HSP70-I IR) of L. orientalis with high amplification efficiencies. The performance of the optimized duplex qPCR was evaluated by analyzing 46 DNA samples obtained from cultures, and clinical and insect specimens, consistent with the results of the previously validated 18S rRNA-qPCR and ITS1-PCR. The duplex qPCR could detect both species of Leishmania at a limit of detection of one copy per reaction and did not cross-amplify with other pathogen DNA samples. Standard curves of the singleplex and duplex assays showed good linearity with excellent amplification efficiency. Using conventional ITS1-PCR and plasmid sequencing as a reference standard assay, the duplex qPCR showed diagnostic sensitivity and specificity of 100% and positive and negative predictive values of 100% for both Leishmania species with a perfect level of agreement (kappa = 1.0). The novel duplex TaqMan-based qPCR has shown to be a rapid, cost-effective, and highly accurate diagnostic tool for the simultaneous detection and identification of two autochthonous Leishmania spp. in a variety of clinical and entomological samples. This will greatly facilitate early diagnosis, treatment monitoring, and surveillance, especially in leishmaniasis-endemic areas where sequencing-based diagnosis is not routinely available.

Keywords: Leishmania martiniquensis, Leishmania orientalis, Mundinia, Duplex qPCR, ITS1, HSP70-I intergenic region

Graphical abstract

Image 1

Highlights

  • •

    A novel duplex qPCR assay was developed to detect Leishmania martiniquensis and L. orientalis simultaneously.

  • •

    Primers and TaqMan probes were designed to detect L. martiniquensis ITS1 and L. orientalis HSP70-I intergenic region.

  • •

    Duplex qPCR was optimized, showing high analytical sensitivity and specificity, and excellent amplification efficiency.

  • •

    Duplex qPCR was tested with a variety of biological samples, showing diagnostic sensitivity and specificity of 100%.

  • •

    This novel assay can be a valuable diagnostic tool, especially in endemic areas where DNA sequencing is not routine.

1. Introduction

Leishmaniasis is a neglected vector-borne, potentially life-threatening disease caused by an obligate intracellular parasite belonging to the genus Leishmania (Burza et al., 2018). This disease has been known to be transmitted by the bites of phlebotomine sand flies and is widespread in tropical and subtropical countries worldwide (WHO, 2023). According to recent epidemiological data from the World Health Organization, an estimated 600,000 to 1 million new cases of cutaneous leishmaniasis and 50,000–90,000 new cases of visceral leishmaniasis occur each year worldwide (WHO, 2023). More than 50 species of Leishmania have been described, of which more than 20 can infect humans (Akhoundi et al., 2016). The main clinical spectrum of the disease includes cutaneous, mucocutaneous, and visceral leishmaniasis, depending on the infecting species and the host immune status (Aronson et al., 2016; Mann et al., 2021). Species of Leishmania are taxonomically divided into four subgenera, including Leishmania, Viannia, Sauroleishmania, and the newly described Mundinia (Espinosa et al., 2018). The new subgenus Mundinia consists of six member species, namely L. enriettii (Muniz and Medina, 1948), L. martiniquensis (Pothirat et al., 2014), L. orientalis (Jariyapan et al., 2018), L. chancei (Kwakye-Nuako et al., 2015, 2023), L. procaviensis (Kwakye-Nuako et al., 2023), and L. macropodum (Dougall et al., 2011; Rose et al., 2004).

Currently, leishmaniasis is considered an important public health problem in Southeast Asia, with Thailand being an endemic hotspot due to the increasing number of new clinical cases and asymptomatic individuals, particularly in the northern and southern provinces of the country (Leelayoova et al., 2017; Sarasombath, 2018; Srivarasat et al., 2022; Preativatanyou et al., 2023; WHO, 2023). This emerging disease is caused by two autochthonous Leishmania spp. of the new subgenus Mundinia, namely L. martiniquensis (Pothirat et al., 2014; Songumpai et al., 2022; Srivarasat et al., 2022; Preativatanyou et al., 2023) and L. orientalis (Jariyapan et al., 2018; Anugulruengkitt et al., 2022), previously named Leishmania sp. ‘siamensis’ lineages PG and TR, respectively (Mungthin et al., 2021). Most of the autochthonous cases in Thailand have been diagnosed as infections with L. martiniquensis, which typically causes visceral leishmaniasis, with the potential for concomitant cutaneous and mucocutaneous leishmaniasis, particularly in immunosuppressed patients (Srivarasat et al., 2022). In contrast, sporadic cases of infection with L. orientalis with a typical presentation of localized cutaneous leishmaniasis have been reported (Jariyapan et al., 2018; Anugulruengkitt et al., 2022). However, the biology, transmission, and epidemiology of these two common Leishmania spp. in human and animal reservoirs, especially in the endemic areas, remain poorly understood due to limited diagnostic capabilities.

Due to the wide range of clinical manifestations and the diversity of parasite species, leishmaniasis is often difficult to diagnose. Traditionally, suspected cases of leishmaniasis can be diagnosed by direct microscopy, histology, parasite culture, and serology (Aronson et al., 2016; Mann et al., 2021). Nevertheless, these conventional detection methods cannot identify the parasite species due to the morphological similarity between parasite species. In recent years, molecular diagnostics, particularly polymerase chain reaction (PCR)-based assays, have been developed as highly accurate diagnostic tools for several infectious diseases, including leishmaniasis. However, conventional PCR typically requires DNA sequencing for species identification or confirmation. In addition, species identification for mixed infection samples cannot be based on direct Sanger sequencing, which provides a single sequence chromatogram representing only a single species (Ohta et al., 2023; Ampol et al., 2024). This limitation could be overcome by cloning the PCR product into the plasmid vector and collecting multiple recombinant clones for Sanger sequencing. However, this procedure is time-consuming and requires specific equipment, making it unsuitable for rapid diagnosis, particularly in leishmaniasis-endemic areas where sequencing-based diagnostic methods are not commonly accessible.

Quantitative PCR (qPCR) using fluorescent-labeled, target-specific probes provides an alternative means of detection and identification with high sensitivity and accuracy (Arya et al., 2005; Kralik and Ricchi, 2017). Primers and probes can be designed to be species-specific, and the fluorescent signal will be emitted only when they hybridize with the DNA of the target species, allowing detection during amplification. Importantly, probe-based qPCR is also less time-consuming and does not require post-PCR processing steps which can cause the risk of contamination. More importantly, this molecular technique has been successfully developed to simultaneously detect and identify multiple pathogen species in a single reaction without the necessity of sequencing confirmation. Several probe-based qPCR methods have been developed for the detection and identification of other Leishmania spp. (Galluzzi et al., 2018). Most common targets previously described for detection and species differentiation include non-protein coding regions such as kinetoplast DNA minicircles and ribosomal RNA genes (rDNA), as well as protein-coding sequences such as heat shock protein 70 kDa (HSP70), glucose-6-phosphate dehydrogenase, and DNA polymerase (Galluzzi et al., 2018). Accordingly, we speculated that duplex probe-based qPCR will be beneficial for the clinical diagnosis and epidemiological surveillance of autochthonous leishmaniasis caused by these two Leishmania (Mundinia) species. In addition, the probe-based qPCR technique has never been explored for development as a diagnostic platform for leishmaniasis in Thailand.

Therefore, we aimed to develop and validate a rapid and highly sensitive probe-based duplex qPCR assay for the simultaneous detection and identification of two common autochthonous Leishmania species, L. martiniquensis and L. orientalis. The primers and probes were designed to detect these two Leishmania species based on sequence analysis of the internal transcribed spacer 1 (ITS1) and the intergenic region of heat shock protein 70 (type I) gene (HSP70-I IR) retrieved from the GenBank database. The diagnostic performance of the duplex qPCR assay was evaluated by analyzing several biological samples in comparison with the previously developed methods, including conventional ITS1-PCR and 18S rRNA-qPCR. The novel duplex qPCR assay developed in this study will greatly facilitate clinicians in the rapid and accurate diagnosis of leishmaniasis, confirmation of suspected co-infection by these two species of Leishmania, treatment monitoring, and epidemiological surveillance of this neglected disease, especially in leishmaniasis-endemic areas of Thailand.

2. Materials and methods

2.1. Specimen collection and DNA extraction

To evaluate the performance of the L.martiniquensis/L. orientalis duplex qPCR assay, a total of 46 DNA samples from humans, parasite cultures, and insects were tested. The sample collection consisted of 19 samples from 13 patients previously diagnosed with leishmaniasis; 4 samples from 4 uninfected healthy individuals; 4 samples from 4 patients infected with Plasmodium falciparum, P. vivax, P. knowlesi, and Histoplasma capsulatum; 12 samples of Leishmania spp. promastigote cultures; 2 samples of Trypanosoma sp. and Crithidia sp. cultures; and 5 samples of Culicoides biting midges collected from the house of the leishmaniasis patient in Songkhla Province, Southern Thailand.

For formalin-fixed, paraffin-embedded (FFPE) clinical samples, DNA was extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany). For other sample types, DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). The concentration and purity of the extracted DNA were assessed using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and preserved at −20 °C until further analysis.

2.2. 18S rRNA-qPCR

Forty-six previously extracted genomic DNA (gDNA) samples were initially screened for Leishmania spp. by qPCR specific for the conserved region of the 18S ribosomal RNA (18S rRNA) gene, as previously described (van der Meide et al., 2008). The qPCR reactions were performed using the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) in a total volume of 20 μl containing 10 μl of TaqMan™ Fast Advanced Master Mix (Thermo Scientific, Waltham, MA, USA), 1 μl of each 10 μM primer (Le18S-F and Le18S-R), 0.5 μl of 10 μM Le18S probe, 2 μl of gDNA, and 5.5 μl of nuclease-free water. Thermal conditions included initial denaturation at 95 °C for 2 min; 45 cycles of 95 °C for 15 s and 60 °C for 15 s. A Ct-value < 40 was considered positive. The internal control for DNA integrity and the presence of amplification inhibitors in FFPE-derived DNA samples was verified by the detection of a fragment of the human ribonuclease P gene as described elsewhere (Tatti et al., 2011).

2.3. Conventional ITS1-PCR, cloning, and Sanger sequencing

All 46 gDNA samples were further analyzed by conventional PCR targeting the internal transcribed spacer 1 region (ITS1) region of Leishmania species. A set of Leishmania-specific LeF and LeR primers, as listed in Table 1, was used to amplify an amplicon product of approximately 330–379 bp, encompassing the full-length ITS1 and its flanking partial 18S rRNA and 5.8S rRNA regions (Spanakos et al., 2008). ITS1-PCR reactions were performed in a 20 μl mixture containing 2 μl of gDNA, 10 μl of 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland), 0.8 μl of each 10 μM primer, and 6.4 μl of nuclease-free water. The amplification program included initial denaturation at 95 °C for 5 min, followed by 40 cycles of 98 °C for 30 s, 65 °C for 30 s, and 72 °C for 1 min, and final extension at 72 °C for 5 min. Amplicons were verified by 1.5% (w/v) agarose gel electrophoresis stained with RedSafe™ nucleic acid staining solution (iNtRON Biotechnology Inc., Seongnam, Korea), and visualized using the GelDoc Go Imaging System (Bio-Rad, Hercules, CA, USA).

Table 1.

Oligonucleotide primers and fluorescent probes for the detection of Leishmania spp. in this study.

Species/Target Primer and probe Oligonucleotide sequence (5′→3′) Amplicon size (bp) Reference
Leishmania spp.
ITS1 (PCR) LeF TCCGCCCGAAAGTTCACCGATA 330–379 Spanakos et al. (2008)
LeR CCAAGTCATCCATCGCGACACG
18S rRNA (qPCR) Le18S-F CCAAAGTGTGGAGATCGAAG 171 van der Meide et al. (2008)
Le18S-R GGCCGGTAAAGGCCGAATAG
Le18S probe 6FAM-ACCATTGTAGTCCACACTGC-MGB-NFQ
L. martiniquensis
ITS1 (qPCR) LmarITS1-F GCAGCTGGATCATTTTCCGA 116 This study
LmarITS1-R TGTTTGTGTATGTGGGAAAGGC
LmarITS1 probe 6FAM-AGGTAGAGAGTAGTAGAATAC-MGB-NFQ
L. orientalis
HSP70-I IR (qPCR) LoHSP70IR-F AAGCATACGCCTCTCTCTCTATCC 64 This study
LoHSP70IR-R GAAGGAGACGYTCCACAGACA
LoHSP70IR probe VIC-CTCAGCTCTCCTGGAGC-MGB-NFQ

PCR amplicons obtained from the positive samples were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and cloned into pGEM® T-Easy plasmids using the LigaFast™ Rapid DNA Ligation System (Promega Corporation, Madison, WI, USA). The ligations were chemically transformed into Escherichia coli DH5α competent cells and plated on the Luria-Bertani (LB) agar plate supplemented with ampicillin, X-Gal, and IPTG for blue/white colony screening. Positive colonies with inserted plasmids were white and chosen for further inoculation. Five colonies from each positive sample were inoculated into LB broth supplemented with ampicillin and incubated at 37 °C. Plasmids containing the insert were extracted using the Invisorb® Spin Plasmid Mini Kit (STRATEC, Birkenfeld, Germany) and subjected to Sanger DNA sequencing using the T7 promoter sequencing primer. The species of each positive sample was identified by alignment of the ITS1 sequences obtained against the GenBank reference using the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.4. In silico design of primers and probes for L. martiniquensis/L. orientalis duplex qPCR

The ITS1 and the HSP70-I IR sequences of Leishmania spp. downloaded from the GenBank database were used as specific targets for the development of the L. martiniquensis/L. orientalis duplex qPCR assay, as detailed in Supplementary Tables S1 and S2. Representative sequences of each locus from Leishmania spp. were aligned using ClustalW implemented in BioEdit version 7.2.6 (Hall, 1999) to reveal the regions of high intraspecific conservation, which allowed us to design custom primers and probes for the duplex qPCR assay, as illustrated in Fig. 1, Fig. 2. Primer Express™ software version 3.0.1 (Applied Biosystems, Foster City, CA, USA) was used to calculate melting temperatures and avoid potential primer dimer formation. Two sets of primers (LmarITS1-F/LmarITS1-R and LoHSP70IR-F/LoHSP70IR-R) were newly designed in the present study to amplify ITS1 and HSP70-I IR with products of approximately 116 bp and 64 bp, respectively. The TaqMan probes specific for L. martiniquensis and L. orientalis were LmarITS1 and LoHSP70IR with the 5′-end labeled with fluorochromes 6-carboxyfluorescein (6FAM) and 2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), respectively, and the 3′-end labeled with a minor groove binder-nonfluorescent quencher (MGB-NFQ) (Applied Biosystems, Foster City, CA, USA). Table 1 provides information on the newly designed primers and probes used in this study.

Fig. 1.

Fig. 1

A Schematic representation of the rRNA transcription unit encoding 18S rRNA, ITS1, 5.8S rRNA, ITS2, and 28S rRNA in Leishmania species. B ClustalW alignment of the 5′-end of the ITS1 region shows two highly conserved sequence blocks used to design forward and reverse primers for amplification of L. martiniquensis, generating an amplicon of 116 bp. The LmarITS1 probe was then designed based on the sequence found exclusively in L. martiniquensis.

Fig. 2.

Fig. 2

A Schematic representation of the intergenic region between two Leishmania HSP70-I loci. B ClustalW alignment of the HSP70-I IR revealed the sequence region used to design primers and a probe for amplification of L. orientalis with a product size of 64 bp. Note that the closely related L. chancei could potentially be amplified using primers and a probe designed for L. orientalis in this study.

2.5. Construction of standard plasmid DNA

Standard plasmids were constructed by cloning the target fragment amplified from promastigote cultures using the same primer set designed for the duplex qPCR assay as shown in Table 1. Genomic DNA samples extracted from L. martiniquensis MHOM/TH/2012/CULE1 and L. orientalis MHOM/TH/2021/CULE5 were used as templates for PCR amplification. The PCR components were set up in a volume of 20 μl containing 2 μl of reference gDNA, 10 μl of 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland), 0.8 μl of each 10 μM primer, and 6.4 μl of nuclease-free water. Amplification cycling conditions included initial denaturation at 95 °C for 5 min, followed by 35 cycles of 98 °C for 30 s, 57 °C (LmarITS1-F/LmarITS1-R) for 30 s and 60 °C (LoHSP70IR-F/LoHSP70IR-R) for 30 s, and 72 °C for 30 s, and final extension at 72 °C for 5 min. Amplicons were verified using 2% (w/v) agarose gel electrophoresis with staining and visualization as previously described. Both L. martiniquensis ITS1 and L. orientalis HSP70-I IR fragments were cleaned up using ExoSAP-IT reagent (Thermo Scientific, Waltham, MA, USA) and then cloned into the pGEM® T-Easy vector as previously described. The presence of the insert was confirmed by Sanger sequencing. Standard plasmids (pLmarITS1 and pLoHSP70IR) were extracted from the positive clones and quantified on a Qubit™ 4 fluorometer using the Qubit™ dsDNA High Sensitivity Assay Kit (Thermo Scientific, Waltham, MA, USA).

2.6. Duplex qPCR optimization

The optimization of the duplex qPCR assay was performed by varying the concentrations of primers and probes specific for L. martiniquensis and L. orientalis. The duplex qPCR reactions were determined using the following thermocycling conditions: 95 °C for 2 min followed by 45 cycles of 95 °C for 15 s and 60 °C for 15 s. The duplex qPCR reactions were performed in a 20 μl mixture containing 10 μl of TaqMan™ Fast Advanced Master Mix (Thermo Scientific, Waltham, MA, USA), 1 ng of each standard plasmid (pLmarITS1 and pLoHSP70IR), primers at varying concentrations (0.2–0.8 μM) and probes at varying concentrations (0.1–0.5 μM) and nuclease-free water. The probe concentration was maintained at 0.3 μM to optimize the primer concentration. Similarly, the primer concentration was fixed at 0.5 μM to optimize the probe concentration. The 6FAM and VIC fluorophore channels were chosen to measure the fluorescence signal emitted by each reporter dye at each PCR cycle for subsequent determination of the threshold cycle (Ct).

2.7. Analysis of PCR efficiency, sensitivity, and specificity

The standard plasmids were used to construct a standard curve. The plasmid copy number was calculated from the size and concentration of the standard plasmid DNA using the DNA copy number calculator in Thermo Scientific Web Tools (https://www.thermofisher.com). The standard plasmid template of each species was prepared in a 10-fold serial dilution, ranging from 108 copies to 1 target copy per reaction. The duplex qPCR assay was performed separately for each species using serially diluted plasmids with optimized primer and probe concentrations, and all reactions were spiked with 105 copies of the standard plasmid of the counterpart species. The singleplex assay for each species was also performed using the same optimized conditions. Ct-values at each dilution were determined in triplicate and plotted against the logarithm of the initial template amount. The correlation coefficient (R2) and the slope of each standard curve plot were calculated. The amplification efficiency (E) for both the singleplex and duplex assays was determined from the dilution factor and the slope of each standard curve using the following equation: E = (−1 + 10(−1/slope)) × 100 (Ruijter et al., 2021).

In this study, the sensitivity and specificity of the assay were determined at both analytical and diagnostic levels. Analytical sensitivity was determined based on the limit of detection (LOD), which is the lowest amount of target per reaction that can be reliably detected. Analytical specificity was assessed using the duplex qPCR results of the samples devoid of L. martiniquensis and L. orientalis DNA, including other Leishmania spp., Crithidia sp., Trypanosoma sp., Plasmodium falciparum, P. vivax, P. knowlesi, Histoplasma capsulatum, and Homo sapiens.

Diagnostic sensitivity and specificity were also evaluated by comparing the results of the duplex qPCR with those of ITS1-PCR and plasmid sequencing as a reference standard for Leishmania spp. detection and identification in a two-by-two table. Diagnostic sensitivity for each species was calculated as the number of true positive samples correctly diagnosed by both assays divided by the total number of true positive and false negative samples. Diagnostic specificity for each species was calculated as the number of true negative samples correctly diagnosed by both assays divided by the total number of true negative and false positive samples. A positive predictive value (PPV), or precision, was calculated as the number of true positive samples divided by the total number of true positive and false positive samples. A negative predictive value (NPV) was calculated as the number of true negative samples divided by the total number of true negative and false negative samples (Šimundić, 2009). Additionally, the level of agreement between the duplex qPCR and the reference assay for each species was determined using Cohen's kappa statistic value (Cohen, 1960). Kappa values were interpreted as the degree of agreement as formerly described (Landis and Koch, 1977).

3. Results

3.1. Detection of Leishmania species by 18S rRNA-qPCR and ITS1-PCR coupled with plasmid sequencing

A total of 46 extracted DNA samples were preliminarily screened for Leishmania DNA using 18S rRNA-qPCR. As shown in Table 2, 18S rRNA-qPCR was positive in 37 DNA samples, including 19 from all leishmaniasis patients, 12 from Leishmania spp. cultures, 1 from Crithidia culture, and 5 from Culicoides midge samples. Ct-values of the qPCR assay ranged from 13.38 to 37.87. Conventional ITS1-PCR followed by cloning and plasmid sequencing was also performed to detect and identify Leishmania spp. in all positive samples. Most of the PCR results were in concordance with the qPCR results. Thirty-six samples tested positive except for one sample from a Crithidia culture, which was not detected by ITS1-PCR. Sequence analysis of 19 clinical samples from leishmaniasis patients revealed single infections with L. martiniquensis, L. orientalis, and L. major in 15, 1, and 3 samples, respectively. The species of all 12 Leishmania spp. cultures were consistently confirmed. Among the Culicoides samples, all 5 samples were infected with L. martiniquensis and 3 of them were co-infected with L. orientalis.

Table 2.

Summary of Leishmania detection in clinical, culture, and insect specimens using 18S rRNA-qPCR, L. martiniquensis/L. orientalis duplex qPCR, and conventional ITS1-PCR followed by plasmid DNA sequencing.

Patient ID Sample ID Sample information
Leishmania 18S rRNA qPCR Ct-value (6FAM) Duplex qPCR
ITS1-PCR and plasmid DNA sequencing
Type of original sample Tissue or parasite L. martiniquensis Ct-value (6FAM) L. orientalis Ct-value (VIC)
1 1 FFPE Human skin nodule 22.34 22.12 Negative L. martiniquensis
2 2 FFPE Human skin nodule 27.86 27.67 Negative L. martiniquensis
3 3 FFPE Human skin nodule 26.56 25.34 Negative L. martiniquensis
4 FFPE Human bone marrow 23.98 22.97 Negative L. martiniquensis
5 FFPE Human bone marrow 23.47 22.49 Negative L. martiniquensis
4 6 FFPE Human skin nodule 25.45 25.12 Negative L. martiniquensis
5 7 FFPE Human skin nodule 27.85 Negative 29.32 L. orientalis
6 8 FFPE Human bone marrow 33.65 32.33 Negative L. martiniquensis
7 9 Saliva Human saliva 30.87 31.52 Negative L. martiniquensis
10 Fresh tissue Human bone marrow 24.53 24.14 Negative L. martiniquensis
8 11 FFPE Human bone marrow 32.12 31.49 Negative L. martiniquensis
9 12 Blood Human blood 35.37 35.44 Negative L. martiniquensis
10 13 Fresh tissue Human skin nodule 13.38 13.65 Negative L. martiniquensis
14 Saliva Human saliva 32.47 31.74 Negative L. martiniquensis
15 Blood Human blood 32.51 31.95 Negative L. martiniquensis
16 Body fluid Human ascitic fluid 29.25 28.69 Negative L. martiniquensis
11 17 Swab Human skin ulcer 24.13 Negative Negative L. major
12 18 Saliva Human saliva 31.19 Negative Negative L. major
13 19 Saliva Human saliva 35.10 Negative Negative L. major
NA 20–23 Blood Negative human blood Negative Negative Negative Negative
NA 24 Blood P. falciparum Negative Negative Negative Negative
NA 25 Blood P. vivax Negative Negative Negative Negative
NA 26 Blood P. knowlesi Negative Negative Negative Negative
NA 27 FFPE H. capsulatum Negative Negative Negative Negative
NA 28 Culture L. martiniquensis CULE1 23.24 22.87 Negative L. martiniquensis
NA 29 Culture L. martiniquensis CULE4 24.84 23.96 Negative L. martiniquensis
NA 30 Culture L. martiniquensis CULE6 22.56 23.18 Negative L. martiniquensis
NA 31 Culture L. martiniquensis CULE7.1 24.36 23.89 Negative L. martiniquensis
NA 32 Culture L, martiniquensis CULE8 23.47 23.84 Negative L. martiniquensis
NA 33 Culture L. orientalis CULE5 23.37 Negative 25.46 L. orientalis
NA 34 Culture L. macropodum 25.32 Negative Negative L. macropodum
NA 35 Culture L. mexicana 23.12 Negative Negative L. mexicana
NA 36 Culture L. braziliensis 22.23 Negative Negative L. braziliensis
NA 37 Culture L. infantum 24.63 Negative Negative L. infantum
NA 38 Culture L. major 26.32 Negative Negative L. major
NA 39 Culture L. tarentolae 25.64 Negative Negative L. tarentolae
NA 40 Culture Trypanosoma sp. Negative Negative Negative Negative
NA 41 Culture Crithidia sp. 37.87 Negative Negative Negative
NA 42 Insect C. insignipennis 35.26 34.94 Negative L. martiniquensis
NA 43 Insect C. sumatrae 32.14 31.58 Negative L. martiniquensis
NA 44 Insect C. fulvus 33.26 31.89 34.90 L. martiniquensis and L. orientalis
NA 45 Insect C. shortti 33.98 30.81 37.78 L. martiniquensis and L. orientalis
NA 46 Insect C. sumatrae 34.26 30.19 38.17 L. martiniquensis and L. orientalis

Abbreviations: FFPE, formalin-fixed, paraffin-embedded sample; NA, not applicable; C., Culicoides; H., Histoplasma; P., Plasmodium; L., Leishmania.

3.2. Standardization of duplex qPCR

The duplex assay was optimized using different concentrations of primers and probes. We found that the amplification performance based on delta Rn (ΔRn) and Ct-values was optimal when primer concentrations were between 0.6 and 0.8 μM and probe concentrations were between 0.3 and 0.5 μM as demonstrated in Fig. 3. Therefore, 0.6 μM and 0.3 μM were selected as the optimized primer and probe concentrations for further analysis. The amplification efficiencies of the singleplex and duplex assays for each Leishmania species were compared using standard plasmid templates with varying amounts of target, ranging from 108 copies to 1 copy per reaction. The Ct-values of each dilution were analyzed using linear regression analysis to plot standard curves, which showed good linearity for both the singleplex and duplex assays as shown in Fig. 4. The R2-values of the singleplex and duplex assays for L. martiniquensis were 0.991 and 0.988, whereas amplification efficiencies were 97.14% and 103.89%, respectively. For L. orientalis, the R2-values of the singleplex and duplex assays were 0.997 and 0.994 and the amplification efficiencies were 115.09% and 104.41%, respectively.

Fig. 3.

Fig. 3

Optimization of primer and probe concentrations for the duplex qPCR assay using 1 ng/μl of pLmarITS1 and pLoHSP70IR standard plasmids with different concentrations of primers (0.2–0.8 μM) and probes (0.1–0.5 μM) for L. martiniquensis (A, B) and L. orientalis (C, D). Primer and probe concentrations and their corresponding Ct-values are listed alongside each plot. Abbreviation: NTC, no template control.

Fig. 4.

Fig. 4

Amplification plots and standard curves of singleplex and duplex qPCR assays with 10-fold serially diluted standard plasmid concentrations of L. martiniquensis (A, B) and L. orientalis (D, E). The duplex assay was performed separately for each species, and all reactions were spiked with 105 copies of the standard plasmid of the counterpart species. The standard curve plots (C, F) show the good linearity of the Ct-values for the singleplex and duplex assays. The calculated correlation coefficients (R2) and amplification efficiency (E) of the singleplex and duplex assays for each species are given in the graphs. Abbreviation: NTC, no template control.

3.3. Analytical sensitivity and specificity of duplex qPCR

The analytical sensitivity of the singleplex and duplex qPCR was determined based on the LOD, which represents the ability of the assay to detect the lowest concentrations of a target for each species of Leishmania in a tested sample. The LOD of the singleplex and duplex assays for L. martiniquensis and L. orientalis was similar at approximately one copy per reaction, as shown in Fig. 4.

The analytical specificity of the developed assay was verified by testing with L. martiniquensis and L. orientalis DNA-free samples extracted from healthy human blood, malaria blood, Histoplasma-infected tissue, and cultures of other Leishmania spp., Trypanosoma and Crithidia species. No amplification was observed for these DNA samples, indicating the high analytical specificity of the duplex qPCR developed here. However, analysis of the duplex qPCR with more diverse pathogen species will be useful to further confirm its high analytical specificity.

3.4. Diagnostic sensitivity and specificity of duplex qPCR

Diagnostic sensitivity and specificity were analyzed by comparing the results of the duplex qPCR with those of ITS1-PCR coupled with plasmid sequencing as a reference assay. For L. martiniquensis, 25 true positive samples were identified by both diagnostic methods, and no false negatives were found. Similarly, L. orientalis was detected in 5 samples by the duplex qPCR and was consistent with the ITS1 sequencing results. Therefore, these results indicate that the duplex qPCR has a diagnostic sensitivity of 100% for these two Leishmania species.

For diagnostic specificity, both the duplex qPCR and ITS1-PCR with plasmid sequencing were negative for L. martiniquensis and L. orientalis in 21 and 41 samples, respectively, and no false positives were found for these two species, indicating that the diagnostic specificity of this assay for L. martiniquensis and L. orientalis was 100%. In addition, the duplex qPCR showed positive and negative predictive values of 100% and perfect agreement (kappa = 1.0) with the reference assay for both Leishmania species as shown in Table 3.

Table 3.

Diagnostic performance of the duplex qPCR for the detection and identification of L. martiniquensis and L. orientalis compared to ITS1-PCR and plasmid sequencing.

Species Duplex qPCR ITS1-PCR and plasmid sequencing
Total
Positive Negative
L. martiniquensis Positive 25 0 25 PPV = 100%
Negative 0 21 21 NPV = 100%
Total 25 21 46 Kappa = 1.0
Diagnostic sensitivity = 100% Diagnostic specificity = 100%
L. orientalis Positive 5 0 5 PPV = 100%
Negative 0 41 41 NPV = 100%
Total 5 41 46 Kappa = 1.0
Diagnostic sensitivity = 100% Diagnostic specificity = 100%

Abbreviations: PPV, positive predictive value; NPV, negative predictive value.

4. Discussion

In recent years, autochthonous cases of leishmaniasis have been increasingly reported in several countries in Southeast Asia, including Thailand (Leelayoova et al., 2017; Anugulruengkitt et al., 2022; Srivarasat et al., 2022), Myanmar (Noppakun et al., 2014), Vietnam (Tien, 2018; Vu et al., 2021), and Cambodia (Lyvannak et al., 2022). The increasing incidence of symptomatic patients has highlighted the importance of early detection, accurate diagnosis, and prompt treatment, which would lead to better treatment outcomes and prevention of disease progression and complications, especially in transmission areas. As previously described, Thailand is now considered the most endemic area for emerging L. martiniquensis and L. orientalis (Leelayoova et al., 2017; Sarasombath, 2018). Of note, L. martiniquensis usually presents with severe visceral leishmaniasis, which is fatal if untreated, and disseminated cutaneous leishmaniasis, particularly in immunosuppressed patients (Srivarasat et al., 2022), whereas L. orientalis mainly causes localized cutaneous leishmaniasis (Jariyapan et al., 2018; Anugulruengkitt et al., 2022). In addition, the drug of choice and treatment regimens for these two species are different (Mathison and Bradley, 2023). Therefore, laboratories in primary healthcare centers in endemic areas need promising diagnostic methods to confirm the causative species and detect co-infections, which would help clinicians to accurately diagnose and treat this emerging disease with precise management decisions.

In this study, we developed a duplex TaqMan probe-based qPCR assay for detecting L. martiniquensis and L. orientalis in different sample types with high diagnostic performance. The primers and probes were designed based on multiple sequence alignments of the ITS1 region and the HSP70-I intergenic region obtained from the GenBank database. Among the most common targets, two regions of rDNA, namely 18S rRNA and ITS1, have been used previously due to the presence of tens to hundreds of rDNA repeat units per cell, which ensures sufficient sensitivity in detection (Schönian et al., 2011; Van der Auwera and Dujardin, 2015; Galluzzi et al., 2018). The 18S rRNA region has been commonly used for detecting Leishmania spp. at the genus level due to its high sequence conservation (Bossolasco et al., 2003; van der Meide et al., 2008; Galluzzi et al., 2018). In contrast, the ITS1 region, which is more variable, has been previously used for detection and species identification (Talmi-Frank et al., 2010; Schönian et al., 2011; Hernández et al., 2014; Hitakarun et al., 2014), as well as characterization of intraspecific genetic diversity and phylogeographic distribution patterns of several Leishmania spp., including the L. donovani/L. infantum complex (Rezaei et al., 2020; Chen et al., 2021), L. major (Spotin et al., 2023), L. tropica (Charyyeva et al., 2021), as well as L. martiniquensis and L. orientalis (Ruang-Areerate et al., 2023; Ampol et al., 2024). Among the Leishmania ITS1 sequences analyzed in this study, a 19-bp sequence was found to be exclusive to those of L. martiniquensis, and this unique sequence was therefore used as the stem part of the 21-bp L. martiniquensis-specific probe in this developed assay.

Apart from ITS1, the HSP70-I gene has been extensively used as a molecular marker for PCR-RFLP and sequence analysis for Leishmania species differentiation and phylogenetic studies (Garcia et al., 2004; da Silva et al., 2010; Fraga et al., 2010; Hoyos et al., 2022). However, the coding regions of the HSP70-I gene are well conserved among closely related Leishmania species (Folgueira and Requena, 2007). It has previously been shown that the 3′-untranslated region (UTR) of the Leishmania HSP70-I gene has better discriminatory power for species typing than the coding region (Requena et al., 2012). This finding could be explained by the fact that the non-coding regions of genes appear to be under less evolutionary constraint, resulting in more sequence variability with higher discriminatory power than the coding regions (Requena et al., 2012). Therefore, we speculated that sequence variability in the intercoding region of the HSP70-I, consisting of the 3′-UTR, intergenic region, and 5′-UTR, would be sufficient for species differentiation across Leishmania spp. Then, we performed multiple sequence alignments of the intercoding region of the HSP70-I using the genome data from several Leishmania spp., revealing that the intergenic region also has a high degree of sequence variability and can be a good target for the design of primers and a probe to detect L. orientalis and differentiate it from L. martiniquensis in this study. However, we found a high sequence similarity between L. orientalis and the closely related L. chancei in the sequence region where primers and a probe were designed. Therefore, it is noteworthy that our LoHSP70IR primers and probe might theoretically amplify L. chancei which has only been reported from Ghana, West Africa (Kwakye-Nuako et al., 2015, 2023) and has never been reported in Thailand since its discovery.

The efficiency and R2 of L. martiniquensis and L. orientalis amplification were evaluated according to the MIQE guidelines (Bustin et al., 2009). Assay performance was determined by comparing duplex qPCR results with those of the singleplex assay. It was found that the performance of the singleplex and duplex qPCR for L. martiniquensis was almost similar. For L. orientalis, the amplification efficiency and R2 of the singleplex assay (R2 = 0.997, E = 115.09%) were better than those of the duplex assay (R2 = 0.994, E = 104.41%), possibly due to competition between primer sets during duplex amplification. In this study, all R2-values were greater than 0.98, and all E-values were within the acceptable range (80–120%), indicating good linearity of the standard curves and efficient amplification performance of this developed assay (Bustin et al., 2009; Kralik and Ricchi, 2017; Ruijter et al., 2021).

In addition, the sensitivity and specificity of the duplex qPCR were evaluated analytically and diagnostically. Analytical sensitivity was determined based on the LOD, which was one target copy per reaction for both L. martiniquensis and L. orientalis. Of note, both ITS1 and HSP70-I IR are multicopy markers (Quijada et al., 1997; Folgueira et al., 2007; Van der Auwera and Dujardin, 2015), resulting in a high analytical sensitivity of the assay. This will be clinically advantageous for detecting Leishmania spp. in the early stages of infection with a low parasite burden or for therapeutic monitoring, thus reducing the likelihood of false negative results (Saah and Hoover, 1997; Leal et al., 2014; Oh et al., 2016). Due to the multicopy nature of these loci, one copy does not represent a single parasite. Therefore, standard curves generated by the amplification of Leishmania DNA from different numbers of parasites are further required for accurate quantification of parasite load. However, the copy number of target sequences may vary between isolates or between parasite stages, probably affecting the quantitative accuracy of the assay. Alternatively, single-copy gene qPCR assays, such as the single-copy DNA polymerase I gene, which do not have these pitfalls but may be less sensitive, are recommended to confirm the infection levels (Galluzzi et al., 2018).

The duplex qPCR was tested with other non-Leishmania DNA samples available in our laboratory and showed no cross-amplification, indicating a high analytical specificity. Thus, the high specificity of the primers and probes developed in this study will provide us with reliable results for specific pathogen detection even in samples contaminated with DNA from other pathogen species. However, additional DNA samples from different pathogen species were recommended to confirm the high analytical specificity of the assay (Kim et al., 2024).

By evaluating different sample types, the diagnostic performance of the duplex qPCR for detecting L. martiniquensis was similar to that of the duplex qPCR for detecting L. orientalis, with diagnostic sensitivity and specificity of 100% and positive and negative predictive values of 100%. This was in perfect agreement with the standard species identification assay, i.e. ITS1-PCR and plasmid sequencing. Importantly, these results demonstrated that the duplex qPCR developed in this study is a promising tool with excellent diagnostic performance that can provide accurate species diagnosis and reduce analysis time, compared to genus-specific 18S rRNA-qPCR and ITS1 sequencing-based assay. Furthermore, we demonstrated the applicability of this duplex qPCR to screen for L. martiniquensis and L. orientalis in field-caught Culicoides samples, suggesting the utility of this assay for entomological surveillance to study the infection prevalence of these two Leishmania species in large numbers of insect samples.

Given the continuing increase in new leishmaniasis cases in endemic areas, rapid detection and accurate identification of these two autochthonous Leishmania (Mundinia) species is urgently needed for early diagnosis, prompt treatment, and epidemiological surveillance. Essentially, the TaqMan-based duplex qPCR assay was developed and validated, for the first time, for the simultaneous detection and identification of L. martiniquensis and L. orientalis in different types of biological samples with high amplification efficiency, precision, and cost-effectiveness. The novel diagnostic developed in this study would facilitate clinical diagnosis with accurate and rapid identification of autochthonous Leishmania spp., especially in areas of endemicity where nucleotide sequencing is not routine. It would also potentially contribute to disease management and prevention strategies to effectively reduce the spread of these neglected parasites.

5. Conclusions

The continuing increase in autochthonous leishmaniasis cases in Thailand represents a challenging current public health problem. Despite the increasing medical importance of leishmaniasis, diagnostic capabilities for this emerging disease remain limited. Here, we have successfully developed a novel, highly effective duplex TaqMan qPCR as a valuable tool for rapid and accurate diagnosis of autochthonous leishmaniasis, which will contribute significantly to effective disease management and treatment monitoring. In addition to diagnostic applications, this assay can also be implemented in leishmaniasis surveillance for effective prevention and control of this neglected disease.

Funding

This research was supported by a grant from the Health Systems Research Institute (HSRI), Thailand (Grant No. HSRI 67-118).

Ethical approval

The procedures of specimen collection and research methodology were reviewed and approved by the Institutional Review Board of Hatyai Hospital (HYH EC 077-65-01) and the International Review Board of the Faculty of Medicine, Chulalongkorn University, Bangkok (IRB No. 0286/67, COA No. 0757/2024) and the Animal Research Ethics Committee of the Chulalongkorn University Animal Care and Use Protocol (CU-ACUP), Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand (COA No. 004/2564).

CRediT authorship contribution statement

Kanok Preativatanyou: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing. Nopporn Songumpai: Formal analysis, Investigation, Methodology, Resources. Pathamet Khositharattanakool: Formal analysis, Investigation, Methodology. Rinnara Ampol: Formal analysis, Investigation, Methodology. Chulaluk Promrangsee: Formal analysis, Investigation, Methodology. Chatchapon Sricharoensuk: Formal analysis, Investigation, Validation. Kobpat Phadungsaksawasdi: Investigation, Validation. Thanapat Pataradool: Investigation, Validation. Tomas Becvar: Investigation, Methodology. Barbora Vojtkova: Investigation, Methodology. Petr Volf: Investigation, Methodology, Resources. Padet Siriyasatien: Formal analysis, Funding acquisition, Investigation, Resources, Supervision, Validation.

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

We would like to deeply thank the staff members of the Center of Excellence in Vector Biology and Vector-Borne Disease, Department of Parasitology, Faculty of Medicine, Bangkok, Thailand for providing us with laboratory facilities and technical assistance for specimen collection, molecular investigation, and bioinformatic analysis in this research.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.crpvbd.2024.100217.

Appendix A. Supplementary data

The following is the supplementary data to this article:

Multimedia component 1
mmc1.docx (20.7KB, docx)

Data availability

The data supporting the conclusions of this article are included within the article. Raw data will be made available on request.

References

  1. Akhoundi M., Kuhls K., Cannet A., Votýpka J., Marty P., Delaunay P., et al. A Historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Negl. Trop. Dis. 2016;10 doi: 10.1371/journal.pntd.0004349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ampol R., Somwang P., Khositharattanakool P., Promrangsee C., Pataradool T., Tepboonreung P., et al. Nanopore-based surveillance of Leishmania parasites in Culicoides Latrielle (Diptera: Ceratopogonidae) caught from the affected community and Tham Phra Cave in Chiang Rai Province, the endemic area of leishmaniasis in Northern Thailand. Insects. 2024;15:327. doi: 10.3390/insects15050327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anugulruengkitt S., Songtaweesin W.N., Thepnarong N., Tangthanapalakul A., Sitthisan M., Chatproedprai S., et al. Case report: Simple nodular cutaneous leishmaniasis caused by autochthonous Leishmania (Mundinia) orientalis in an 18-month-old girl: the first pediatric case in Thailand and literature review. Am. J. Trop. Med. Hyg. 2022;108:44–50. doi: 10.4269/ajtmh.22-0385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aronson N., Herwaldt B.L., Libman M., Pearson R., Lopez-Velez R., Weina P., et al. Diagnosis and treatment of leishmaniasis: Clinical practice guidelines by the infectious diseases society of America (IDSA) and the American society of tropical medicine and hygiene (ASTMH) Clin. Infect. Dis. 2016;63:1539–1557. doi: 10.1093/cid/ciw742. [DOI] [PubMed] [Google Scholar]
  5. Arya M., Shergill I.S., Williamson M., Gommersall L., Arya N., Patel H.R. Basic principles of real-time quantitative PCR. Expert Rev. Mol. Diagn. 2005;5:209–219. doi: 10.1586/14737159.5.2.209. [DOI] [PubMed] [Google Scholar]
  6. Bossolasco S., Gaiera G., Olchini D., Gulletta M., Martello L., Bestetti A., et al. Real-time PCR assay for clinical management of human immunodeficiency virus-infected patients with visceral leishmaniasis. J. Clin. Microbiol. 2003;41:5080–5084. doi: 10.1128/JCM.41.11.5080-5084.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Burza S., Croft S.L., Boelaert M. Leishmaniasis. Lancet. 2018;392:951–970. doi: 10.1016/S0140-6736(18)31204-2. [DOI] [PubMed] [Google Scholar]
  8. Bustin S.A., Benes V., Garson J.A., Hellemans J., Huggett J., Kubista M., et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  9. Charyyeva A., Çetinkaya Ü., Özkan B., Şahin S., Yaprak N., Şahin I., et al. Genetic diversity of Leishmania tropica: Unexpectedly complex distribution pattern. Acta Trop. 2021;218 doi: 10.1016/j.actatropica.2021.105888. [DOI] [PubMed] [Google Scholar]
  10. Chen Y.F., Liao L.F., Wu N., Gao J.M., Zhang P., Wen Y.Z., et al. Species identification and phylogenetic analysis of Leishmania isolated from patients, vectors and hares in the Xinjiang Autonomous Region, the Peopleʼs Republic of China. PLoS Negl. Trop. Dis. 2021;15 doi: 10.1371/journal.pntd.0010055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cohen J. A coefficient of agreement for nominal scales. Educ. Psychol. Meas. 1960;20:37–46. [Google Scholar]
  12. da Silva L.A., de Sousa C.dosS., da Graça G.C., Porrozzi R., Cupolillo E. Sequence analysis and PCR-RFLP profiling of the hsp70 gene as a valuable tool for identifying Leishmania species associated with human leishmaniasis in Brazil. Infect. Genet. Evol. 2010;10:77–83. doi: 10.1016/j.meegid.2009.11.001. [DOI] [PubMed] [Google Scholar]
  13. Dougall A.M., Alexander B., Holt D.C., Harris T., Sultan A.H., Bates P.A., et al. Evidence incriminating midges (Diptera: Ceratopogonidae) as potential vectors of Leishmania in Australia. Int. J. Parasitol. 2011;41:571–579. doi: 10.1016/j.ijpara.2010.12.008. [DOI] [PubMed] [Google Scholar]
  14. Espinosa O.A., Serrano M.G., Camargo E.P., Teixeira M.M.G., Shaw J.J. An appraisal of the taxonomy and nomenclature of trypanosomatids presently classified as Leishmania and Endotrypanum. Parasitology. 2018;145:430–442. doi: 10.1017/S0031182016002092. [DOI] [PubMed] [Google Scholar]
  15. Folgueira C., Cañavate C., Chicharro C., Requena J.M. Genomic organization and expression of the HSP70 locus in New and Old World Leishmania species. Parasitology. 2007;134:369–377. doi: 10.1017/S0031182006001570. [DOI] [PubMed] [Google Scholar]
  16. Folgueira C., Requena J.M. A postgenomic view of the heat shock proteins in kinetoplastids. FEMS Microbiol. Rev. 2007;31:359–377. doi: 10.1111/j.1574-6976.2007.00069.x. [DOI] [PubMed] [Google Scholar]
  17. Fraga J., Montalvo A.M., De Doncker S., Dujardin J.C., Van der Auwera G. Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infect. Genet. Evol. 2010;10:238–245. doi: 10.1016/j.meegid.2009.11.007. [DOI] [PubMed] [Google Scholar]
  18. Galluzzi L., Ceccarelli M., Diotallevi A., Menotta M., Magnani M. Real-time PCR applications for diagnosis of leishmaniasis. Parasites Vectors. 2018;11:273. doi: 10.1186/s13071-018-2859-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Garcia L., Kindt A., Bermudez H., Llanos-Cuentas A., De Doncker S., Arevalo J., et al. Culture-independent species typing of neotropical Leishmania for clinical validation of a PCR-based assay targeting heat shock protein 70 genes. J. Clin. Microbiol. 2004;42:2294–2297. doi: 10.1128/JCM.42.5.2294-2297.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hall T.A. BioEdit: A user-friendly biological sequence alignment editor analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999;41:95–98. [Google Scholar]
  21. Hernández C., Alvarez C., González C., Ayala M.S., León C.M., Ramírez J.D. Identification of six New World Leishmania species through the implementation of a high-resolution melting (HRM) genotyping assay. Parasites Vectors. 2014;7:501. doi: 10.1186/s13071-014-0501-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hitakarun A., Tan-ariya P., Siripattanapipong S., Mungthin M., Piyaraj P., Naaglor T., et al. Comparison of PCR methods for detection of Leishmania siamensis infection. Parasites Vectors. 2014;7:458. doi: 10.1186/s13071-014-0458-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hoyos J., Rosales-Chilama M., León C., González C., Gómez M.A. Sequencing of hsp70 for discernment of species from the Leishmania (Viannia) guyanensis complex from endemic areas in Colombia. Parasites Vectors. 2022;15:406. doi: 10.1186/s13071-022-05438-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jariyapan N., Daroontum T., Jaiwong K., Chanmol W., Intakan N., Sor-suwan S., et al. Leishmania (Mundinia) orientalis n. sp. (Trypanosomatidae), a parasite from Thailand responsible for localized cutaneous leishmaniasis. Parasites Vectors. 2018;11:351. doi: 10.1186/s13071-018-2908-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kim H.J., Bathige S.D.N.K., Jeon H.B., Kim S.H., Yu C., Kang W., et al. Development of a duplex qPCR assay for the detection of coinfection in eels by Japanese eel endothelial cell-infecting virus and Anguillid herpesvirus-1. Aquaculture. 2024;578 [Google Scholar]
  26. Kralik P., Ricchi M. A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything. Front. Microbiol. 2017;8:108. doi: 10.3389/fmicb.2017.00108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kwakye-Nuako G., Mosore M.T., Boakye D., Bates P.A. Description, biology, and medical significance of Leishmania (Mundinia) chancei n. sp. (Kinetoplastea: Trypanosomatidae) from Ghana and Leishmania (Mundinia) procaviensis n. sp. (Kinetoplastea: Trypanosomatidae) from Namibia. J. Parasitol. 2023;109:43–50. doi: 10.1645/22-53. [DOI] [PubMed] [Google Scholar]
  28. Kwakye-Nuako G., Mosore M.T., Duplessis C., Bates M.D., Puplampu N., Mensah-Attipoe I., et al. First isolation of a new species of Leishmania responsible for human cutaneous leishmaniasis in Ghana and classification in the Leishmania enriettii complex. Int. J. Parasitol. 2015;45:679–684. doi: 10.1016/j.ijpara.2015.05.001. [DOI] [PubMed] [Google Scholar]
  29. Landis J.R., Koch G.G. An application of hierarchical kappa-type statistics in the assessment of majority agreement among multiple observers. Biometrics. 1977;33:363–374. [PubMed] [Google Scholar]
  30. Leal C.A., Carvalho A.F., Leite R.C., Figueiredo H.C. Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp. BMC Vet. Res. 2014;10:150. doi: 10.1186/1746-6148-10-150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Leelayoova S., Siripattanapipong S., Manomat J., Piyaraj P., Tan-ariya P., Bualert L., et al. Leishmaniasis in Thailand: A review of causative agents and situations. Am. J. Trop. Med. Hyg. 2017;96:534–542. doi: 10.4269/ajtmh.16-0604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lyvannak S., Sreynich K., Heng S., Thyl M., Chandna A., Chanpheaktra N., et al. Case report: The first case report of visceral leishmaniasis in Cambodia. Am. J. Trop. Med. Hyg. 2022;107:336–338. doi: 10.4269/ajtmh.22-0085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mann S., Frasca K., Scherrer S., Henao-Martínez A.F., Newman S., Ramanan P., et al. A review of leishmaniasis: Current knowledge and future directions. Curr. Trop. Med. Rep. 2021;8:121–132. doi: 10.1007/s40475-021-00232-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mathison B.A., Bradley B.T. Review of the clinical presentation, pathology, diagnosis, and treatment of leishmaniasis. Lab. Med. 2023;54:363–371. doi: 10.1093/labmed/lmac134. [DOI] [PubMed] [Google Scholar]
  35. Mungthin M., Leelayoova S., Siripattanapipong S. Taxonomy revision of Leishmania spp. in Thailand. J. Clin. Microbiol. 2021;59 doi: 10.1128/JCM.00217-21. 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Muniz J., Medina H. [Cutaneous leishmaniasis of the Guinea pig, Leishmania enriettii n. sp.] Hospital. 1948;33:7–25. In Portuguese. [PubMed] [Google Scholar]
  37. Noppakun N., Kraivichian K., Siriyasatien P. Disseminated dermal leishmaniasis caused by Leishmania siamensis in a systemic steroid therapy patient. Am. J. Trop. Med. Hyg. 2014;91:869–870. doi: 10.4269/ajtmh.13-0711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Oh I.Y., Kim K.T., Jun J.H., Shin J.H., Sung H.J. Development of real-time PCR assays for detection of Dirofilaria immitis from infected dog blood. Korean J. Clin. Lab. Sci. 2016;48:88–93. [Google Scholar]
  39. Ohta A., Nishi K., Hirota K., Matsuo Y. Using nanopore sequencing to identify fungi from clinical samples with high phylogenetic resolution. Sci. Rep. 2023;13:9785. doi: 10.1038/s41598-023-37016-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pothirat T., Tantiworawit A., Chaiwarith R., Jariyapan N., Wannasan A., Siriyasatien P., et al. First isolation of Leishmania from Northern Thailand: Case report, identification as Leishmania martiniquensis and phylogenetic position within the Leishmania enriettii complex. PLoS Negl. Trop. Dis. 2014;8 doi: 10.1371/journal.pntd.0003339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Preativatanyou K., Chinwirunsirisup K., Phumee A., Khositharattanakool P., Sunantaraporn S., Depaquit J., et al. Species diversity of phlebotomine sand flies and sympatric occurrence of Leishmania (Mundinia) martiniquensis, Leishmania (Leishmania) donovani complex, and Trypanosoma spp. in the visceral leishmaniasis focus of southern Thailand. Acta Trop. 2023;244 doi: 10.1016/j.actatropica.2023.106949. [DOI] [PubMed] [Google Scholar]
  42. Quijada L., Soto M., Alonso C., Requena J.M. Analysis of post-transcriptional regulation operating on transcription products of the tandemly linked Leishmania infantum hsp70 genes. J. Biol. Chem. 1997;272:4493–4499. doi: 10.1074/jbc.272.7.4493. [DOI] [PubMed] [Google Scholar]
  43. Requena J.M., Chicharro C., García L., Parrado R., Puerta C.J., Cañavate C. Sequence analysis of the 3’-untranslated region of HSP70 (type I) genes in the genus Leishmania: Its usefulness as a molecular marker for species identification. Parasites Vectors. 2012;5:87. doi: 10.1186/1756-3305-5-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rezaei Z., Azarang E., Shahabi S., Omidian M., Pourabbas B., Sarkari B. Leishmania ITS1 is genetically divergent in asymptomatic and symptomatic visceral leishmaniasis: Results of a study in southern Iran. J. Trop. Med. 2020;2020 doi: 10.1155/2020/5351098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Rose K., Curtis J., Baldwin T., Mathis A., Kumar B., Sakthianandeswaren A., et al. Cutaneous leishmaniasis in red kangaroos: Isolation and characterisation of the causative organisms. Int. J. Parasitol. 2004;34:655–664. doi: 10.1016/j.ijpara.2004.03.001. [DOI] [PubMed] [Google Scholar]
  46. Ruang-Areerate T., Ruang-Areerate P., Manomat J., Naaglor T., Piyaraj P., Mungthin M., et al. Genetic variation and geographic distribution of Leishmania orientalis and Leishmania martiniquensis among Leishmania/HIV co-infection in Thailand. Sci. Rep. 2023;13 doi: 10.1038/s41598-023-50604-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ruijter J.M., Barnewall R.J., Marsh I.B., Szentirmay A.N., Quinn J.C., van Houdt R., et al. Efficiency correction is required for accurate quantitative PCR analysis and reporting. Clin. Chem. 2021;67:829–842. doi: 10.1093/clinchem/hvab052. [DOI] [PubMed] [Google Scholar]
  48. Saah A.J., Hoover D.R. “Sensitivity” and “specificity” reconsidered: The meaning of these terms in analytical and diagnostic settings. Ann. Intern. Med. 1997;126:91–94. doi: 10.7326/0003-4819-126-1-199701010-00026. [DOI] [PubMed] [Google Scholar]
  49. Sarasombath P.T. Leishmaniasis: An evolving public health concern in Thailand. Siriraj. Med. J. 2018;70:363–376. [Google Scholar]
  50. Schönian G., Kuhls K., Mauricio I.L. Molecular approaches for a better understanding of the epidemiology and population genetics of Leishmania. Parasitology. 2011;138:405–425. doi: 10.1017/S0031182010001538. [DOI] [PubMed] [Google Scholar]
  51. Šimundić A.M. Measures of diagnostic accuracy: Basic definitions. EJIFCC. 2009;19:203–211. [PMC free article] [PubMed] [Google Scholar]
  52. Songumpai N., Promrangsee C., Noopetch P., Siriyasatien P., Preativatanyou K. First evidence of co-circulation of emerging Leishmania martiniquensis, Leishmania orientalis, and Crithidia sp. in Culicoides biting midges (Diptera: Ceratopogonidae), the putative vectors for autochthonous transmission in Southern Thailand. Trop. Med. Infect. Dis. 2022;7:379. doi: 10.3390/tropicalmed7110379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Spanakos G., Piperaki E.T., Menounos P.G., Tegos N., Flemetakis A., Vakalis N.C. Detection and species identification of Old World Leishmania in clinical samples using a PCR-based method. Trans. R. Soc. Trop. Med. Hyg. 2008;102:46–53. doi: 10.1016/j.trstmh.2007.05.019. [DOI] [PubMed] [Google Scholar]
  54. Spotin A., Rouhani S., Haghighi A., Parvizi P. Low genetic heterogeneity of Leishmania major in different geographical regions of Iran. PLoS One. 2023;18 doi: 10.1371/journal.pone.0285520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Srivarasat S., Brownell N., Siriyasatien P., Noppakun N., Asawanonda P., Rattanakorn K., et al. Case report: Autochthonous disseminated cutaneous, mucocutaneous, and visceral leishmaniasis caused by Leishmania martiniquensis in a patient with HIV/AIDS from Northern Thailand and literature review. Am. J. Trop. Med. Hyg. 2022;107:1196–1202. doi: 10.4269/ajtmh.22-0108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Talmi-Frank D., Nasereddin A., Schnur L.F., Schönian G., Töz S.O., Jaffe C.L., et al. Detection and identification of Old World Leishmania by high resolution melt analysis. PLoS Negl. Trop. Dis. 2010;4:e581. doi: 10.1371/journal.pntd.0000581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Tatti K.M., Sparks K.N., Boney K.O., Tondella M.L. Novel multitarget real-time PCR assay for rapid detection of Bordetella species in clinical specimens. J. Clin. Microbiol. 2011;49:4059–4066. doi: 10.1128/JCM.00601-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tien P. The 8th ASEAN Conference of Tropical Medicine and Parasitology (ACTMP) 2018. A case report of leishmaniasis and HIV coinfection in Hue Central Hospital. [Google Scholar]
  59. Van der Auwera G., Dujardin J.C. Species typing in dermal leishmaniasis. Clin. Microbiol. Rev. 2015;28:265–294. doi: 10.1128/CMR.00104-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. van der Meide W., Guerra J., Schoone G., Farenhorst M., Coelho L., Faber W., et al. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites. J. Clin. Microbiol. 2008;46:73–78. doi: 10.1128/JCM.01416-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Vu S.N., Tran H.S., Tran V.P., Tran C.T., Tran N.D., Dang D.A., et al. Taxonomical insights and ecology of sandfly (Diptera, Psychodidae) species in six provinces of Northern Vietnam. Parasite. 2021;28:85. doi: 10.1051/parasite/2021080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. WHO . World Health Organization; Geneva, Switzerland: 2023. Leishmaniasis.https://www.who.int/news-room/fact-sheets/detail/leishmaniasis [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (20.7KB, docx)

Data Availability Statement

The data supporting the conclusions of this article are included within the article. Raw data will be made available on request.


Articles from Current Research in Parasitology & Vector-borne Diseases are provided here courtesy of Elsevier

RESOURCES