Skip to main content
eLife logoLink to eLife
. 2024 Dec 5;13:RP93004. doi: 10.7554/eLife.93004

A conserved cell-pole determinant organizes proper polar flagellum formation

Erick E Arroyo-Pérez 1,2,†,, John C Hook 3,, Alejandra Alvarado 4, Stephan Wimmi 1,5, Timo Glatter 6, Kai Thormann 3,, Simon Ringgaard 1,2
Editors: Karine A Gibbs7, Dominique Soldati-Favre8
PMCID: PMC11620751  PMID: 39636223

Abstract

The coordination of cell cycle progression and flagellar synthesis is a complex process in motile bacteria. In γ-proteobacteria, the localization of the flagellum to the cell pole is mediated by the SRP-type GTPase FlhF. However, the mechanism of action of FlhF, and its relationship with the cell pole landmark protein HubP remain unclear. In this study, we discovered a novel protein called FipA that is required for normal FlhF activity and function in polar flagellar synthesis. We demonstrated that membrane-localized FipA interacts with FlhF and is required for normal flagellar synthesis in Vibrio parahaemolyticus, Pseudomonas putida, and Shewanella putrefaciens, and it does so independently of the polar localization mediated by HubP. FipA exhibits a dynamic localization pattern and is present at the designated pole before flagellar synthesis begins, suggesting its role in licensing flagellar formation. This discovery provides insight into a new pathway for regulating flagellum synthesis and coordinating cellular organization in bacteria that rely on polar flagellation and FlhF-dependent localization.

Research organism: Other

Introduction

Many cellular processes depend on a specific spatiotemporal organization of its components. The DNA replication machinery, cell division proteins, and motility structures are some examples of elements that need to be positioned at a particular site during the cell cycle in a coordinated manner to ensure adequate cell division or proper function of the structures. To carry out this task, many cellular components of bacteria have a polar organization, that is they are asymmetrically positioned inside the cell, which is particularly apparent in monopolarly flagellated bacteria. In the marine bacteria Vibrio, which constitutively express a single polar flagellum (McCarter, 1995; Kim and McCarter, 2000), it is crucial to coordinate the localization and timing of flagellar components, in order to guarantee that newly born cells only produce a flagellum in timing with cell division. This process is coordinated with the chromosome replication and the chemotaxis clusters through a supramolecular hub that is tethered at the old cell pole (Takekawa et al., 2016; Yamaichi et al., 2012). This organization depends on ATPases of the ParA/MinD family, which regulate the migration of the hub components to the new cell pole as the cell cycle progresses. In this way, the new cell has a copy of the chromosome and a set of chemotaxis clusters positioned next to what will be the site for the new flagellum. Central to this process is the protein HubP, which recruits to the pole the three ATPases responsible for the localization of these organelles: ParA1 for the chromosome (Fogel and Waldor, 2006), ParC for the chemotaxis clusters (Ringgaard et al., 2011) and FlhG for the flagellum (Correa et al., 2005; Arroyo-Pérez and Ringgaard, 2021). Homologs of HubP occur in several species, for example Pseudomonas (where it is called FimV), Shewanella, or Legionella, where they similarly act as organizers (hubs) of the cell pole (Wehbi et al., 2011; Rossmann et al., 2015; Coil and Anné, 2010).

The bacterial flagellum is a highly intricate and complex subcellular structure. It is composed of around 25 different proteins, which have to be assembled in different stoichiometries in a spatiotemporally coordinated manner (Macnab, 2003; Chevance and Hughes, 2008). Although there may be significant differences among species, flagella in general are composed of a motor attached to the cytoplasmic membrane, a rod connecting it to the extracellular space, a hook and a filament. The basal body is composed of a cytoplasmic C-ring or switch complex (Francis et al., 1994), which receives the signal from the chemotaxis proteins via binding to phosphorylated CheY. The C-ring is connected to the MS-ring, which is embedded in the cytoplasmic membrane (Homma et al., 1987; Ueno et al., 1992). Attached to it, on the cytoplasmic side, is the export apparatus, which allows secretion of rod, hook, and filament components (Minamino, 2014). Flagella can also be sheathed, if an extension of the outer membrane covers the filament, as is the case in many Vibrio species (Chen et al., 2017).

The positioning of the flagella and control of flagellar numbers per cell are mediated in many bacteria by the interplay between two flagellar regulators, FlhF and FlhG. Studies in a wide variety of proteobacteria indicate that FlhG is a negative regulator that restricts the number of flagella that are synthesized. In organisms such as strains of Vibrio, Shewanella putrefaciens and Pseudomonas aeruginosa, the absence of MinD-like ATPase FlhG results in hyper-flagellated cells (Kusumoto et al., 2006; Arroyo-Pérez and Ringgaard, 2021; Schuhmacher et al., 2015a; Blagotinsek et al., 2020; Campos-García et al., 2000; Murray and Kazmierczak, 2006). In contrast, in polarly flagellated species such as Campylobacter jejuni, Vibrio cholerae, Vibrio parahaemolyticus, P. aeruginosa, S. putrefaciens and Shewanella oneidensis, the SRP-type GTPase FlhF is a positive regulator of flagellum synthesis and necessary for proper localization. A deletion of flhF results in reduced number and mis-localization of flagella (Hendrixson and DiRita, 2003; Correa et al., 2005; Arroyo-Pérez and Ringgaard, 2021; Pandza et al., 2000; Rossmann et al., 2015; Gao et al., 2015; Navarrete et al., 2019; Zhang et al., 2020).

The current model predicts that GTP-bound dimeric FlhF (Bange et al., 2007; Kondo et al., 2018) localizes to the cell pole to where it recruits the initial flagellar building blocks (Green et al., 2009). A long-standing question is how FlhF recognizes and localizes to the designated cell pole. In P. aeruginosa and V. alginolyticus, it was demonstrated that FlhF localized polarly upon ectopic production in the absence of the flagellar master regulator FlrA (Green et al., 2009; Kondo et al., 2017). It was therefore speculated that FlhF assumes its polar localization in the absence of other flagellar proteins or even without any further additional protein factors. The underlying mechanism, however, remains enigmatic, given that neither in its monomeric nor its dimeric form, FlhF possesses any regions that would indicate a membrane association. In a recent study, it was shown that in the polarly flagellated gammaproteobacterium S. putrefaciens FlhF binds the C-ring protein FliG via a specific region at the very N-terminus of FlhF. The FlhF-FliG complex is then recruited to the designated cell pole by HubP, where FlhF-bound FliG captures the transmembrane protein FliF and promotes formation of the MS-ring. This forms the scaffold from where further flagellar synthesis can occur (Dornes et al., 2024). However, in the absence of HubP, the majority of cells still forms normal polar flagella, indicating that HubP is not the only polarity factor in this process (Rossmann et al., 2015).

Here, we provide evidence demonstrating that FlhF does not localize independently. Instead, we show that FipA, a small integral membrane protein with a domain of unknown function, facilitates the recruitment of FlhF to the membrane at the cell pole and, at least in some species, it acts in concert with the polar landmark protein HubP/FimV. Using V. parahaemolyticus and two additional polarly flagellated γ-proteobacteria, the monopolarly flagellated S. putrefaciens and the lophotrichous Pseudomonas putida, we show that FipA universally mediates recruitment of FlhF to the designated cell pole. The spatiotemporal localization behavior of FipA as well as its relationship to FlhF, support its role as a licensing protein that enables flagellum synthesis.

Results

Identification of an FlhF protein interaction partner: FipA

In order to identify potential factors required for FlhF function and its recruitment to the cell pole, we performed affinity purification of a superfolder green fluorescent protein (sfGFP)-tagged FlhF (FlhF-sfGFP) ectopically expressed in wild-type V. parahaemolyticus cells followed by shotgun proteomics using liquid chromatography-tandem mass spectrometry analysis (LC-MS/MS). Among the proteins that were significantly enriched in FlhF-sfGFP purifications, eight were structural components of the flagellum (Figure 1A; Supplementary file 1a), but also a non-flagellar protein, VP2224, was significantly co-purified with FlhF (Figure 1A; Supplementary file 1a). The homologue of VP2224 in V. cholerae, there named FlrD, was previously shown to exert the same activating role on flagellar gene regulation as FlhF (Moisi et al., 2009), suggesting a function related to FlhF. Notably, FlhF was also significantly co-purified in the reciprocal co-IP-MS/MS experiment using VP2224-sfGFP as bait (Figure 1B), suggesting a direct or indirect interaction of VP2224 and FlhF. To further investigate the co-purification data, bacterial two-hybrid (BACTH) assays in the heterologous host E. coli were carried out and suggested a direct interaction between FlhF and VP2224. FlhF and VP2224 were also found to self-interact (Figure 1E). Additionally, these data indicated that FlhF and VP2224 form an interaction complex in both the native and a heterologous host organism. Thus, we identified VP2224 as a novel interaction partner of FlhF and named it FipA for FlhF interaction partner A.

Figure 1. FipA constitutes a new family of FlhF interaction partners.

Volcanoplots representing Log-ratios versus significance values of proteins enriched in (A) FlhF-sfGFP or (B) FipA-sfGFP purifications using shotgun proteomics and liquid chromatography-mass spectrometry; sfGFP was used as control. The full list of pulled-down proteins can be found in the Supplementary file 1a. (C) Organization of the flagellar/chemotaxis gene region encoding FlhF and FipA in V. parahaemolyticus. (D) Domain organization of FipA (TM, transmembrane region; DUF, domain of unknown function). (E) Bacterial two-hybrid confirming the interaction between FipA and FlhF from V. parahaemolyticus. The indicated proteins (FipA, FlhF) were fused N- or C-terminally to the T18- or T25-fragment of the Bordetella pertussis adenylate cyclase. In vivo interaction of the fusion proteins in Escherichia coli is indicated by blue color. The corresponding assay in P. putida and S. putrefaciens is displayed in Figure 1—figure supplement 2. (F) Dendrogram of γ-proteobacteria, indicating the presence of FlhF or FipA homologues and the corresponding flagellation pattern. An extended version and sources are available in Supplementary file 1b.

Figure 1.

Figure 1—figure supplement 1. Membrane topology of FipA.

Figure 1—figure supplement 1.

(A) Topology analysis and (B) the corresponding model. A Pho/LacZα cassette was translationally fused to the N- or the C-terminus of FipA and the fusion is expressed in a suitable E. coli strain. Pho is only active in the periplasm, while LacZα can functionally complement β-galactosidase activity within the cytoplasm. The enzyme activities can then be tested using suitable color reactions. Expression of Pho-Lac-FipA resulted in blue colonies whereas expression of FipA-Pho-Lac resulted in red colonies, hence suggesting that the FipA N-terminus is positioned in the periplasm and the C-terminus in the cytoplasm (B). Deletion of the predicted membrane spanning domain in Pho-Lac-FipA (aa 6–28, Pho-Lac-FipAΔMD) resulted in red E. coli colonies (A). This suggests that in the absence of the membrane spanning domain the N-terminus of FipA resides in the cytoplasm, and thus further supports that FipA is a transmembrane protein anchored in the inner membrane via the 6–28 aa N-terminal membrane spanning domain and is oriented with the 1–5 aa N-terminal in the periplasm and the 29–163 aa C-terminal in the cytoplasm (B).
Figure 1—figure supplement 2. FlhF interacts with FipA in a bacterial two-hybrid analysis (BACTH) in P. putida and S. putrefaciens.

Figure 1—figure supplement 2.

FlhF and FipA were produced as N-terminal or as C-terminal fusions to the T18 and T25 fragments of the B. pertussis adenylate cyclase in the given combinations within a single strain. In vivo protein-protein interactions result in active adenylate cyclase activity and high cAMP levels, indicated by blue coloring of the colonies on X-Gal-containing agar.

FipA constitutes a new family of FlhF interaction partners

The gene encoding FipA is located immediately downstream of the flagellar operon that encodes FlhA, FlhF, FlhG, FliA and the chemotaxis proteins (Figure 1C). In V. parahaemolyticus, FipA consists of 163 amino acids with a molecular mass of 18.4 kDa. In silico analysis and membrane topology mapping predicted that FipA consists of a short periplasmic N-terminal part, consisting of amino acids 1–5, followed by a transmembrane region (6-28), a cytoplasmic part harboring a coiled region (amino acids 31–58) and a domain of unknown function, DUF2802, positioned in the C-terminal half of the protein (from amino acids 68–135; Figure 1D; Figure 1—figure supplement 1).

InterPro database analyzes found that FipA homologues (i.e. membrane proteins consisting of a single cytoplasmic DUF2802 repeat) are widespread among γ-proteobacteria. Exceptions are the Enterobacteriaceae, which do not possess any copies of either fipA nor of flhF and flhG. Actually, FipA is only present in genomes that also encode FlhF and FlhG (Figure 1F), which prompted the question of whether FipA is involved in regulating the flagellation pattern in concert with the FlhF-FlhG system. By including in our analysis the flagellation pattern reported in the literature, we found that the species that encode FipA are all polar flagellates, either monotrichous or lophotrichous (Figure 1F). FipA homologues are absent from bacteria that use the FlhF-FlhG system to produce different flagellation patterns, like the peritrichous Bacillus, the amphitrichous ε-Proteobacteria or Spirochetes (Supplementary file 1b). In the α-Proteobacteria, where FlhF homologues are only present in a few species, FipA is absent as well (Figure 1F). Based on these analyzes, we hypothesized that FipA represents a new family of FlhF interaction partners important for the γ-proteobacteria. To test this hypothesis, we decided to analyze FipA-FlhF interaction in addition in the distantly related and lophotrichously flagellated P. putida and the monotrichous S. putrefaciens. BACTH analysis showed that the FipA orthologue from both P. putida (PpFipA, PP_4331) and S. putrefaciens (SpFipA, SputCN32_2550) interact with FlhF of their respective species and that they self-interact (Figure 1—figure supplement 2) – a result similar to that of FipA from V. parahaemolyticus (VpFipA). This supported our hypothesis and indicated that FipA has a general function as an FlhF interaction partner, thus constituting a new class of FlhF interaction partners.

FipA is required for proper swimming motility and flagellum formation

To explore the role of FipA with respect to flagellation, we generated mutant strains with individual deletions of the fipA and flhF genes. Strikingly, absence of FipA in V. parahaemolyticus completely abolished swimming motility in soft-agar medium to the same degree as cells lacking FlhF (Figure 2A). Furthermore, single-cell tracking of planktonic V. parahaemolyticus cells confirmed that cells lacking FipA were completely non-motile and behaved identical to cells lacking FlhF (Figure 2B). Importantly, ectopic expression of FipA in the ΔfipA strain restored the strain’s swimming ability to wild-type levels (Figure 2B), further supporting that it is the deletion of fipA that results in the phenotype and not polar effects resulting from the fipA deletion. The C-terminal FipA-sfGFP fusion used throughout this paper also restored the phenotype (Figure 2B), indicating that the fusion protein is fully functional.

Figure 2. FipA is required for correct flagellum formation.

(A, C) Representative soft-agar swimming assay of V. parahaemolyticus (A) or P. putida (C) strains (left panels) and the corresponding quantification (right panels). For the latter, the halo diameter measurements were normalized to the halo of the wild type on each plate. Data presented are from six (A) or three (C) independent replicates, asterisks represent a p-value < 0.05 (according to ANOVA + Tukey tests). (B) Single-cell tracking of V. parahaemolyticus. Shown are representative swimming trajectories and quantification of swimming speed, total displacement and reversal rate. N indicates number of cells tracked among three biological replicates (ANOVA + Tukey test). (D) Representative electron micrographs of the indicated V. parahaemolyticus strains stained with uranyl acetate. (E) Quantification of flagellation pattern in the populations of the indicated V. parahaemolyticus strains. (F) Flagellum stain of indicated P. putida strains with Alexa Fluor 488-C5-maleimide and (G) quantification of the corresponding flagellation in the population. N indicates the number of cells counted among three biological replicates. For S. putrefaciens, see Figure 2—figure supplement 1.

Figure 2.

Figure 2—figure supplement 1. Deletions of or in FipA and FlhF affect S. putrefaciens flagellation.

Figure 2—figure supplement 1.

(A) Upper panel: Spreading of the indicated strains in soft agar. fipA ΔTM indicates that the transmembrane region of FipA was deleted. The images shown were compiled from a single plate. Lower panel: the corresponding quantification given as diameter; three independent experiments were conducted. The error bar marks the standard deviation. (B) Left: Shown are fluorescent micrographs where the flagellar filament(s) of the indicated strains were fluorescently labeled by maleimide dye. The position of the cell bodies was outlined in the figure. The scale bare equals 5 µm. Right: The corresponding quantification of flagellation. The number of cells (n) for each experiment was >300 from three indepenedent experiments. The error bar between the different populations shows the standard deviation.

The swimming phenotypes in the absence of FipA could result from defects in either flagellum assembly or in the flagellar motor performance. To differentiate between these possibilities, we examined V. parahaemolyticus by transmission electron microscopy (TEM; Figure 2D and E). Planktonic cells lacking either FlhF or FipA, showed a complete absence of flagella on the bacterial surface, while a single polar flagellum was observed in ~50% of wild-type cells (Figure 2D and E).

Based on this set of experiments, we concluded that FipA and FlhF are essential for normal formation of polar flagella.

FipA and HubP ensure proper localization of FlhF to the cell pole

As our previous results showed an interaction between FipA and FlhF, we analyzed if the intracellular localization of FlhF was influenced by FipA. In this regard, we used functional translational fusions of FlhF to fluorescent proteins expressed from its native site on the chromosome in V. parahaemolyticus (Figure 3—figure supplements 1 and 2; Arroyo-Pérez and Ringgaard, 2021).

We observed that FlhF localized either diffusely in the cytoplasm or to the cell pole as previously reported (Arroyo-Pérez and Ringgaard, 2021). However, a significant delocalization of FlhF from the cell pole occurred in the absence of FipA (Figure 3A–C; Figure 3—figure supplement 2). Particularly, FlhF was diffusely localized in ~37% of cells or localized to the cell pole in a uni- and bi-polar manner in ~45% and~19%, respectively, compared to wild-type cells (Figure 3B). Absence of FipA significantly reduced localization of FlhF to the cell pole with a concomitant increase in diffusely localized FlhF (70%; Figure 3A–C; Figure 3—figure supplement 2). Furthermore, the foci of FlhF at the cell pole in the absence of FipA were significantly dimmer compared to wild-type FlhF foci (Figure 3D), indicating that the amount of FlhF localized to the cell pole is lower in the absence of FipA. Importantly, even though FlhF was still able to localize to the cell pole in a certain number of cells lacking FipA, no flagellum was formed in this background (Figure 2D–E), thus indicating that FipA not only is required for proper polar recruitment of FlhF, but also for the stimulation of flagellum formation.

Figure 3. Localization of FlhF depends on FipA and HubP.

(A) Representative micrographs of the indicated strains of V. parahaemoloyticus expressing FlhF-sfGFP from its native promoter. Upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 2 μm. For an enlargment see Figure 3—figure supplement 3. (B) Demographs displaying FlhF-sfGFP fluorescence intensity along the cell length within the experiments shown in (A). (C) Quantification of localization patterns and (D) foci fluorescence intensity of the fluorescence microscopy experiment presented in (A). The data was combined from the given number (N) of cells combined from three biological replicates. (E) Representative micrographs of the indicated P. putida strains expressing FlhF-sfGFP from its native promoter. The upper panels show the DIC and the lower panels the corresponding fluorescence images. Fluorescent foci are marked by small white arrows. The scale bar equals 5 µm. The low intensity of the foci did not allow a quantitative analysis of foci intensities or the generation of demographs. For an enlargement of the micrographs see Figure 3—figure supplement 4. (F) Quantification of FlhF-sfGFP localization patterns in the corresponding strains of P. putida from the experiments shown in (E). Corresponding data on the localization of FlhF in S. putrefaciens is displayed in Figure 3—figure supplement 5.

Figure 3.

Figure 3—figure supplement 1. Western analysis on the protein levels of FlhF and FipA fusions to fluorescent proteins.

Figure 3—figure supplement 1.

Crude protein extracts from the corresponding (mutant) strains of V. parahaemolyticus (A, D), P. putida (B, E) and S. putrefaciens (C, F) were separated by SDS-PAGE, transferred to membranes and visualized by western blotting using antibodies against GFP (A, C–F) and mCherry (B). The same OD units from the culture were loaded for each sample. The corresponding strain background is indicated above the lanes.
Figure 3—figure supplement 1—source data 1. Scans of the original western blots for Figure 3—figure supplement 1.
Figure 3—figure supplement 1—source data 2. Scans of the original western blots for Figure 3—figure supplement 1 with labels.
Figure 3—figure supplement 2. N-terminal tagging of PpFlhF with mCherry does not negatively affect spreading motility in soft agar.

Figure 3—figure supplement 2.

The upper panel shows the spreading in soft agar, the lower panel shows the corresponding quantification. The images shown are from the same plate, three independent experiments were conducted. The corresponding standard error bar is shown.
Figure 3—figure supplement 3. Localization of FlhF depends on FipA and HubP.

Figure 3—figure supplement 3.

Shown are enlargments of Figure 3A, representative micrographs of the indicated strains of V. parahaemoloyticus expressing FlhF-sfGFP from its native promoter. The upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 2 μm.
Figure 3—figure supplement 4. Localization of FlhF depends on FipA and HubP.

Figure 3—figure supplement 4.

Shown are enlargments of Figure 3E, representative micrographs of the indicated strains of P. putida expressing FlhF-sfGFP from its native promoter. The upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 5 μm.
Figure 3—figure supplement 5. SpFipA and SpHubP concertedly affect polar SpFlhF localization.

Figure 3—figure supplement 5.

A) Fluorescence microscopy on the indicated (mutant) strains each bearing an flhF-mvenus hybrid gene replacing native flhF on the chromosome. The upper panel shows DIC micrographs, the lower panel the corresponding fluorescent images. The scale bar equals 5 µm. (B) Quantification of the FlhF-mVenus localization patterns, using the data from >300 cells (n) from three independent experiments, the corresponding standard error is shown as error bar.

Given the role of HubP in cell pole organization and its reported interaction with FlhF (Yamaichi et al., 2012), we also analyzed the localization of FlhF in the absence of HubP. As for FipA mutants, recruitment of FlhF to the cell pole was reduced in the absence of HubP. Strikingly, in the double deletion strain ΔfipA ΔhubP, FlhF did not localize as foci at the cell pole at all but was instead localized diffusely in the cytoplasm in 100% of cells (Figure 3A–C; Figure 3—figure supplement 3). Immunoblot analysis showed that the difference in localization of FlhF-sfGFP was not due to differences in expression levels or protein stability (Figure 3—figure supplement 1).

Altogether, these data suggest that both FipA and HubP work together to promote normal polar localization of FlhF.

The transmembrane and conserved cytoplasmic domains of FipA is required for its function in regulating flagellum formation and proper FlhF localization

In order to identify the regions of FipA mediating its role in flagellum regulation, we next analyzed the N-terminal transmembrane domain for FipA membrane anchoring and its function in mediating proper flagellum production. When expressed in E. coli, a C-terminally GFP-tagged version of FipA (VpFipA-sfGFP) showed a clear membrane localization, while a FipA variant deleted for the predicted transmembrane (TM) domain between residues 7–27 (FipAΔTM), was diffusely localized in the cytoplasm (Figure 4A). These observations show that FipA is indeed a membrane protein anchored by the predicted transmembrane domain. To then study the function of FipA membrane localization, the native fipA locus was replaced by a gene encoding a FipA variant lacking the N-terminal TM domain, and the resulting strain (fipA ΔTM) was analyzed for flagellum production. The V. parahaemolyticus strain carrying this mutation did not produce any flagella at all (Figure 4B), as did the ΔfipA strain (Figure 2D).

Figure 4. Activity of FipA depends on FlhF and on its transmembrane domain.

Figure 4.

(A) Micrographs of E. coli cells expressing FipA-sfGFP from V. parahaemolyticus, and a truncated version lacking the transmembrane domain (ΔTM). The left panels display the DIC and the right panels the corresponding fluorescence images. The scale bar equals 5 μm. (B) Electron micrographs of V. parahaemolyticus wild-type and mutant cells lacking the transmembrane domain of fipA, respectively. The corresponding quantification of the flagellation pattern is shown to the left of the micrographs. Note that the data for the wild-type cells is the same as in Figure 2D and E. (C) Spreading behavior of the indicated P. putida strains (left) with the corresponding quantification (right). Loss of the FipA TM region phenocopies a complete fipA deletion.

After validating an essential role for membrane anchoring of FipA, we analyzed in more detail the cytoplasmic DUF2802 domain. By aligning various FipA homologs, we identified a motif of conserved amino acids, and three of them (G110, E126 and L129 of VpFipA) were 100% conserved among FipA homologues (Figure 5A). Therefore, we chose these amino acids for mutagenesis. Alanine substitutions of residues G110 and L129 abolished the interaction between VpFipA and VpFlhF in BACTH analysis, while the E126A substitution did not affect the interaction (Figure 5B). All these variants were, however, still able to self-interact with wild-type VpFipA (Figure 5B). Altogether, these results suggest that conserved residues in the DUF2802 domain support the interaction between FipA and FlhF, and that the self-interaction is mediated by a different region.

Figure 5. Conserved residues in the domain of unknown function of FipA are essential for interaction with FlhF.

(A) Weight-based consensus sequence of the conserved region of DUF2802 as obtained from 481 species. The residues targeted in the FipA orthologs of V. parahaemolyticus, P. putida and S. putrefaciens are indicated along with their appropriate residue position. (B, C) Bacterial two-hybrid assay of FipA variants of V. parahaemolyticus (B) or P. putida (C) with an alanine substitution in the conserved residues indicated in (A). The constructs were tested for self-interaction and interaction with FlhF. In vivo interaction of the fusions in E. coli is indicated by blue coloration of the colonies. (D) Quantification from single-cell tracking of swimming V. parahaemolyticus cells expressing FipA bearing the indicated substitution in the DUF2802 domain (see Figure 2B for wild-type behavior). Asterisks indicate a p-value <0.05 (ANOVA + Tukey test) (F) Localization of VpFlhF in the absence of FipA or in cells with substitutions in the DUF2802 domain. Left: Micrographs showing the localization of FipA-sfGFP in the indicated strains; the upper panels display the DIC and the lower panels the corresponding fluorescence images (for an enlargement see Figure 5—figure supplement 1). The scale bar equals 5 µm. Right: the corresponding quantification of the FlhF-sfGFP patterns in the indicated strains. (E) Soft-agar spreading assays of P. putida wild-type and indicated mutant strains, asterisks display a p-value of 0.05 (*) or 0.01 (**) (ANOVA). (G) Localization of P. putida FlhF in strains bearing substitutions in the DUF2802 interaction site. Left: micrographs displaying the localization of FlhF-mCherry in the indicated strains. Upper panels show the DIC and lower panels the corresponding fluorescence images. The scale bar equals 5 µm (for an enlargement see Figure 5—figure supplement 1). Right: Corresponding quantification of the FlhF localization pattern in the indicated strains. Data for S. putrefaciens is displayed in Figure 5—figure supplement 2.

Figure 5.

Figure 5—figure supplement 1. Conserved residues in the domain of unknown function of FipA are essential for interaction with FlhF in P. putida.

Figure 5—figure supplement 1.

(A) Localization of VpFlhF in cells with substitutions in the DUF2802 domain. Micrographs are showing the localization of FipA-sfGFP in the indicated strains; the upper panels display the DIC and the lower panels the corresponding fluorescence images. The scale bar equals 5 µm. (B) The same analysis for P. putida FlhF-mCherry. The images are enlargements of Figure 5F (A) and Figure 5G (B).
Figure 5—figure supplement 2. Targeted residue substitution in FipA affects FlhF positioning and function in S. putrefaciens.

Figure 5—figure supplement 2.

(A) BACTH analysis (see, e.g. Figure 2) suggests that G106A and L125A in SpFipA does not disrupt but maybe weakens (G106A) the interaction between SpFipA and SpFlhF. (B) Spreading of the indicated S. putrefaciens strains in soft agar reveals a small but sigifnificant (asterisk = p < 0.05) and based on three independent experiments. (C) Left: micrographs showing DIC (upper panels) and fluorescent imaging on mVenus-tagged FlhF cells in mutant backgrounds bearing the given substutions in SpFipA with the corresponding quantification (n>300 cells, right). The in vivo analysis suggests that the residue substitutions in SpFipA give rise to phenotypes that are similar to that of a fipA deletion.

Interaction between FipA and FlhF is required for FipA function on regulating flagellum formation and FlhF localization

We proceeded to evaluate the role of these residues in vivo. After introducing the mutations in the fipA gene in its native loci, the effects on motility were almost indistinguishable from a ΔfipA mutation. In V. parahaemolyticus, this resulted in completely non-motile cells in planktonic cultures (Figure 5D).

The localization of FlhF was also affected by the residue substitutions in fipA. Cells of V. parahaemolyticus expressing FlhF-sfGFP natively had reduced polar localization when FipA was substituted with either G110A or L129A (Figure 5F; Figure 5—figure supplement 1), with almost 50% of cells presenting only diffuse FlhF-sfGFP signal. Thus, it seems that the DUF2802 domain of FipA is responsible for the effect of FipA on motility, and that its effects occur primarily through the interaction with FlhF. Furthermore, the interruption of FipA-FlhF impedes the recruitment of FlhF to the cell pole.

Cell cycle-dependent polar localization of FipA

Given FipA’s function in regulating correct recruitment of FlhF to the cell pole, we next analyzed the intracellular localization of FipA. To this end, a hybrid gene bearing a fusion of fipA to sfgfp was used to replace native fipA, resulting in stable and functional production of FipA C-terminally tagged with sfGFP (Figure 6—figure supplement 1). In wild-type strains, FipA localization remained diffuse in half of the population (Figure 6A; Figure 6—figure supplement 1). In the other half of the population, FipA formed distinct foci at the cell pole, either uni- or bi-polarly (Figure 6A; Figure 6—figure supplement 2). No delocalized foci were ever observed. The FipA localization behavior was explored further by following the protein through the cell cycle. We observed that FipA foci disappear frequently (Figure 6C; 14’). A new focus appears at the opposite pole, sometimes before cell division (Figure 6C; 56’), sometimes after (Figure 6C; 42’). On rare cases, the first focus persists until after the second focus appears, resulting in bipolar foci (Figure 6C; 70’). These results are consistent with a protein that is recruited to the cell pole right before the start of the flagellum assembly after cell division, albeit the timing may vary between different species.

Figure 6. The localization pattern of FipA.

(A, B) Localization pattern of fluorescently labeled FipA in V. parahaemolyticus and P. putida. (A) Representative micrographs of V. parahaemolyticus expressing FipA-sfGFP from its native promoter. Scale bar = 2 μm. The upper panel shows the DIC and the lower panel the corresponding fluorescence channel. To the right the localization was quantified accordingly. (B) The same analysis for P. putida. (C, D) Time lapse analysis of FipA-sfGFP localization over a cell cycle in V. parahaemolyticus (C) and P. putida (D). The numbers in the upper DIC micrographs show the minutes after start of the experiment. The scale bars equal 1 µm (C) and 5 µm (D).

Figure 6.

Figure 6—figure supplement 1. Production and function of FipA derivatives.

Figure 6—figure supplement 1.

The three panels show western blotting analysis of PAGE protein separations from V. parahaemolyticus (A), P. putida (B) and S. putrefaciens (C) bearing FipA-sfGFP with substitutions in conserved residues as indicated, using antibodies raised against sfGFP. V. parahaemolyticus also includes a mutant deleted in flhF. The loaded samples are normalized by OD units. (D) The C-terminal fusion of sfGFP has only minor effects on FipA function in S. putrefaciens and P. putida. The upper panels show the spreading in soft agar (taken from the same soft agar plate), the lower the corresponding quantification. The error bars are the standard deviation from three independent experiments.
Figure 6—figure supplement 1—source data 1. Scans of the original western blots for Figure 6—figure supplement 1.
Figure 6—figure supplement 1—source data 2. Scans of the original western blots for Figure 6—figure supplement 1 with labels.
Figure 6—figure supplement 2. The localization pattern of FipA.

Figure 6—figure supplement 2.

Localization pattern of fluorescently labeled FipA in V. parahaemolyticus and P. putida. Left: Representative micrographs of V. parahaemolyticus expressing FipA-sfGFP from its native promoter. Scale bar = 2 μm. The upper panel shows the DIC and the lower panel the corresponding fluorescence channel. Right: The same analysis for P. putida. The images are enlargements of the micrographs in Figure 6A and B.

Polar localization of FipA depends on the FipA-FlhF interaction

Finally, we determined whether FlhF plays a role in FipA localization. To this end, FlhF was deleted in the strains that are expressing FipA-sfGFP from its native promoter. Almost no FipA foci were detected in this background for both V. parahaemolyticus (Figure 7A–C; Figure 7—figure supplement 1) even though the protein levels of FipA were comparable to that in the wild type (Figure 6—figure supplement 1). Furthermore, the FipA variants that do not interact with FlhF (Figure 5B) were also labeled in the native fipA locus with sfGFP. Both VpFipA G110A and VpFipA L129A were incapable of forming polar foci (Figure 7B and C; Figure 7—figure supplement 1).

Figure 7. Normal localization of FipA depends on interaction with FlhF.

(A, B) Localization pattern of V. parahaemolyticus FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the middle panel the corresponding fluorescence imaging (scale bar equals 5 µm), and the lower panel the corresponding demograph showing the fluorescence of FipA-sfGFP along the cell length. (C) Quantification of the cell localization pattern from the experiment shown in (A, B) as combined from three biological replicates. (D, E, F) The same analysis for the corresponding P. putida strains as indicated. The scale bar equals 5 µm. The data for S. putrefaciens is displayed in Figure 7—figure supplement 3.

Figure 7.

Figure 7—figure supplement 1. Normal localization of FipA depends on interaction with FlhF.

Figure 7—figure supplement 1.

Localization pattern of V. parahaemolitycus FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the lower panel the corresponding fluorescence imaging (scale bar equals 5 µm). The images are enlargements of the micrographs in Figure 7A (upper) and 7B (lower).
Figure 7—figure supplement 2. Normal localization of FipA depends on interaction with FlhF.

Figure 7—figure supplement 2.

Localization pattern of P. putida FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the lower panel the corresponding fluorescence imaging (scale bar equals 5 µm). The images are enlargements of the micrographs in Figure 7D (upper) and 7E (lower).
Figure 7—figure supplement 3. Localization of SpFipA in different strain backgrounds.

Figure 7—figure supplement 3.

Left: Micrographs showing DIC (left) and fluorescence (right) microscopy on cells with FipA-sfGFP in different background strains as indicated. The scale bar equals 5 µm. The corresponding quantification (N>300, three independent experiments) is shown to the right. FipA loses its polar localization in a mutant lacking HubP and in a mutant with the L125A substitution in FipA.

Altogether, these results suggest that, in V. parahaemolyticus, a direct interaction with FlhF, mediated by the residues in the DUF2802, is responsible for recruiting FipA to the pole.

Functional conservation of FipA in S. putrefaciens and P. putida

Our FipA homology analyses (Figure 1F) indicated that the protein is widely conserved in species also possessing FlhF and FlhG. Accordingly, as in V. parahaemolyticus, FipA interacted with FlhF in the polarly flagellated gammaproteobacteria S. putrefaciens, which is monopolarly flagellated and P. putida, which is lophotrichously flagellated (Figure 1—figure supplement 2). We therefore asked to what extent the role of FipA is conserved for flagellation in these two species. To avoid interference with the secondary non-polar flagellar system of S. putrefaciens, we used a strain that is unable to form the secondary flagella (ΔflaAB2). Determination of the flagellation state was carried out by fluorescence labeling of the flagellar filament(s) in both species.

Spreading

As observed for V. parahaemolyticus, loss of FlhF and FipA negatively affected flagella-mediated spreading in soft agar and flagellation of P. putida and S. putrefaciens. However, for both species, the phenotype was not as severe as in V. parahaemolyticus: We observed about 40% and 50% in soft-agar spreading of ΔflhF mutants and about 25% and 90% spreading of ΔfipA mutants in P. putida and S. putrefaciens, respectively (Figure 2A and C; Figure 2—figure supplement 1). Accordingly, the mutations of flhF or fipA also negatively affected flagella number and localization in both species, with the exception of a fipA deletion in S. putrefaciens, where a dislocalization could not be observed (Figure 2F and G; Figure 2—figure supplement 1). Altogether, these results indicate that FipA is necessary for normal flagellation and swimming motility in all three model species, albeit at a different extent reaching from almost complete loss of swimming in V. parahaemolyticus to only a small effect in S. putrefaciens.

Localization of FlhF

We then determined the localization of FlhF in mutants of FipA and HubP or FimV (the HubP homolog in P. putida) by using translational fusions of FlhF to fluorescent proteins expressed from the native site on the chromosome in P. putida and S. putrefaciens (Figure 3—figure supplements 1 and 2; Rossmann et al., 2015). As observed for V. parahaemolyticus, FipA and FimV were required for normal FlhF-mCherry localization in P. putida (Figure 3E and F; Figure 3—figure supplement 3), and FlhF was completely delocalized in the double mutant ΔfipA ΔfimV. In contrast, FlhF localization was not affected in a ΔhubP background in S. putrefaciens (Figure 3—figure supplement 4; Rossmann et al., 2015). However, in a S. putrefaciens mutant lacking fipA, monopolar localization of FlhF-mVenus decreased significantly (Figure 3—figure supplement 4). When both hubP and fipA were deleted in this species, only weak polar localization remained in a minority of cells. Frequently, polar fluorescence was completely lost and FlhF-mVenus was distributed in the cytoplasm. The differences in localization were not due to differences in abundance of FlhF (Figure 3—figure supplement 1).

The results showed that the function of FipA for flagellation and FlhF localization is generally conserved within the three different species. However, the polar landmark HubP appears to be involved in localizing FlhF, in particular in S. putrefaciens, where both HubP and FipA need to be deleted to delocalize FlhF from the cell pole.

FipA localization pattern

As the next step, we determined the conservation of FipA domains’ function and localization. We found that, as observed in V. parahaemolyticus, loss of the FipA transmembrane region (fipA ΔTM) phenocopied a ΔfipA mutant in P. putida and S. putrefaciens (Figure 4C, Figure 2—figure supplement 1). Furthermore, substitution of the conserved residues within the FipA DUF domain (G104A and L123A in P. putida FipA; G106A and L118A in S. putrefaciens FipA) decreased or abolished the interaction with FlhF but not FipA self-interaction (Figure 5C and G; Figure 5—figure supplement 2).

In P. putida, similar to V. parahaemolyticus, FipA formed distinct foci at the cell pole, either uni- or bi-polarly (Figure 6A and B). A remarkable difference between P. putida and V. parahaemolyticus is that in P. putida, FipA occurred as foci in virtually all cells (Figure 6B), whereas in V. parahaemolyticus, FipA remained diffuse in half of the population (Figure 6A). The ratio of bi-polar to uni-polar foci was also greater in P. putida (~1:2) than in V. parahaemolyticus (~1:5). Furthermore, in P. putida, the FipA foci were more stable, and foci at both poles often persisted until cell division. In fact, appearance of the second focus at the new pole frequently occurred right after cell division (Figure 6D; 50’), explaining the greater bi-polar to uni-polar ratio of FipA foci in this organism.

Finally, in V. parahaemolyticus, the localization but not the stability of FipA is dependent on the interaction with FlhF (Figure 7; Figure 6—figure supplement 1). This was similarly observed for P. putida, as the FipA L123A variant, which is unable to interact with FlhF (Figure 1—figure supplement 2), was also mostly distributed in the cytoplasm, whereas the variant FipA G104A did exhibit some polar localization, although reduced (Figure 7E and F; Figure 7—figure supplement 2). This is the variant that did show some interaction with PpFlhF (Figure 5C). These results suggest that, in V. parahaemolyticus and P. putida, a direct interaction with FlhF, mediated by the residues in the DUF2802, is responsible for recruiting FipA to the pole.

Surprisingly, in S. putrefaciens mutants deleted in flhF, FipA displayed only a slight difference in polar localization (Figure 7—figure supplement 3). However, a SpFipA G106A substitution reduced the protein’s localization (to ~50% cells with foci). It is likely that in S. putrefaciens, HubP is (co-)mediating the localization of FipA, as in the absence of HubP, FipA-sfGFP localization at the cell pole drastically decreases (Figure 7—figure supplement 3). As observed for V. parahaemolyticus and P. putida, the stability of FipA was not dependent on the presence of FlhF or FipA in S. putrefaciens (Figure 3—figure supplement 1).

Discussion

In bacteria, numerous processes are localized to specific cellular compartments. This is particularly evident in polarly flagellated bacteria, where the intricate flagellar multicomplex needs to be synthesized in a spatiotemporally regulated fashion. Flagellar synthesis is initiated by the assembly of the first flagellar building blocks within the cytoplasmic membrane, which in polar flagellates is targeted to the designated cell pole. In a wide range of bacterial species, the SRP-type GTPase FlhF and its antagonistic counterpart, the MinD-like ATPase FlhG, regulate flagellar positioning and number (Kazmierczak and Hendrixson, 2013; Schuhmacher et al., 2015b). In particular, FlhF has been shown to function as a positive regulator and a major localization factor for the initial flagellar building blocks of polar flagella. Upon production, GTP-bound dimeric FlhF localizes to the cell pole, but the mechanism by which the protein assumes its designated position at the cell pole remained elusive. One candidate protein, the polar landmark HubP (FimV in Pseudomonas sp.) had been identified earlier and was shown to interact with FlhF in V. parahaemolyticus (Yamaichi et al., 2012; Dornes et al., 2024). Accordingly, polar localization of FlhF is decreased in mutants lacking hubP (this study; Rossmann et al., 2015), however, in a number of cells FlhF localized normally and the cells showed normal flagellation. This was indicative that HubP does play a role in functionally recruiting FlhF, but that another factor was still missing. In this study, we identified the protein FipA as a second polarity factor for FlhF.

FipA consists of an N-terminal transmembrane domain and a cytoplasmic region with a conserved domain of unknown function (DUF2802). The corresponding gene is located immediately downstream of the motility operon that includes flhF and flhG. Notably, FipA is highly conserved among bacteria that use the FlhF/FlhG system to position the flagella, strongly suggesting that FipA has evolved together with FlhF and FlhG to regulate the flagellation pattern. In this study, we therefore investigated three distantly related γ-proteobacteria including one lophotrichous species, V. parahaemolyticus, P. putida and S. putrefaciens, in more detail. We found that FipA is conserved as a regulatory factor of FlhF and that its functions rely on similar features in all three species.

FipA is essential for normal flagellum synthesis, however, the severity of a fipA deletion differed among the three species studied. In V. parahaemolyticus, a fipA deletion phenocopies the loss of flhF, and cells no longer synthesize flagella. Notably, in the absence of FipA in V. parahaemolyticus, FlhF is still localized at the pole in about a third of the cells. Despite this, these cells were still unable to form flagella, strongly suggesting that occurrence of FlhF at the pole alone is not sufficient to trigger flagellum synthesis in the absence of FipA.

This strict requirement for FlhF has been reported in the closely related V. alginolyticus (Kusumoto et al., 2009). On the other hand, in V. cholerae, the requirement for FlhF on flagellation is less strict (Green et al., 2009), and in P. putida and S. putrefaciens even less so: mutants deleted in flhF or fipA of both species can generally still produce flagella and swim (this work; Rossmann et al., 2015). In P. putida, a ΔfipA mutant has a phenotype reminiscent of a ΔflhF mutant as both drastically decrease the number of flagella, which may also be delocalized in flhF mutants (Pandza et al., 2000). In S. putrefaciens, deletion of fipA decreases the number of flagella to a similar extent as a flhF mutation, however, while in the latter case the flagella are frequently delocalized, the flagella remain at a polar postion, when fipA is missing. Taken together, these results strongly suggest that FipA does not act as a general polarity factor for the full flagellar machinery, but rather it stimulates the activity of FlhF to initiate polar flagellation.

FipA and HubP affect polarity of FlhF through different mechanisms

In all three species, FipA directly interacts with FlhF as demonstrated by reciprocal co-immuno precipitations and by bacterial two-hybrid assays. These experiments suggest that FipA is able to dimerize (or oligomerize) and that the FlhF-FipA interaction is dependent on conserved residues in the DUF2802 domain. Furthermore, these residues are not required for the ability of FipA to interact with itself, suggesting that the two processes occur independently and at different protein interfaces. Microscopic and physiological assays showed that direct interaction between FlhF and FipA is required for FlhF targeting and function. In addition, a FipA mutant lacking its N-terminal transmembrane domain was non-functional, indicating that interaction of FlhF and FipA has to take place at the membrane.

In the absence of FipA, polar localization of FlhF was significantly decreased in all three species and almost completely diminished when hubP or fimV was deleted together with fipA. Removing HubP/FimV alone had a similar effect as removing FipA on the localization of FlhF, although to a lesser extent, as more cells still had polar FlhF in the ΔhubP/fimV mutant than in the ΔfipA mutant. Furthermore, the unipolar to bipolar ratio of FlhF foci increased in the ΔhubP mutant compared to the wild-type or the ΔfipA background. While the deletion of fipA increases the number of cells with diffuse localization, it does not affect the time frame in the cell cycle at which FlhF shifts from unipolar to bipolar in V. parahaemolyticus. In contrast, deleting hubP delays the time frame in which FlhF assumes a bipolar position. This indicates that HubP and FipA represent two different pathways that stimulate polar localization of FlhF, and that both are required to bring sufficient (active) FlhF molecules to trigger MS-ring formation and start flagellum assembly.

Localization of FipA

A notable feature of FipA is its dynamic localization pattern within the cell over the cell cycle in all three species studied, the nature of which is unclear so far. Foci of FipA may appear mono- or bipolarly and frequently, but not necessarily, disappear once the flagellar apparatus, or the flagellar bundle in the case of P. putida, is established. It remains to be shown whether the FipA protein is actively moving from one pole to another or if newly formed FipA is recruited to the opposite pole while being degraded at the old position. Notably, in V. parahaemolyticus and P. putida FipA does not localize polarly in the absence of interaction with FlhF, suggesting that both proteins are recruited as a complex.

In contrast, in S. putrefaciens, FipA still localizes to the cell pole also in the absence of FlhF as long as the polar landmark HubP is present. This is indicating a more important role for HubP in this species. Accordingly, it has been shown recently that in S. putrefaciens HubP directly interacts with HubP via its NG domain to recruit the initial flagellar building blocks (Dornes et al., 2024). However, also in S. putrefaciens active FlhF localizes to the cell pole and flagella are formed in the absence of HubP. The nature of the polar marker that recruits or guides FipA or a FipA/FlhF to the designated pole is still elusive. The discovery of FipA provides a new point where spatiotemporal organization is coordinated. However, it remains to be explored if the complex is anchored through yet another protein, such as the TonBm-PocA-PocB complex in P. putida (Ainsaar et al., 2019) or through an intrinsic feature of the cell envelope or cytoplasm during cell division.

How does FipA upgrade the current model of polar flagellar synthesis?

Based on the findings in different species, our current model of FlhF/FlhG-mediated polar flagellar synthesis predicts, that upon production, GTP-bound dimeric FlhF is localizing or being recruited to the cell pole to where it recruits the first flagellar components to initiate the assembly. The monomeric form of the ATPase FlhG, the FlhF antagonist, is binding to the flagellar C-ring building block FliM and is transferred to the nascent flagellar structure, where it is released and dimerizes upon ATP binding (Schuhmacher et al., 2015a; Blagotinsek et al., 2020). The ATP-bound FlhG dimer can associate with the membrane and interact with the GTP-bound FlhF dimer, thereby stimulating its GTPase activity. This leads to monomerization of FlhF and loss of polar localization (reviewed in Kojima et al., 2020; Schuhmacher et al., 2015b). Dimeric FlhG does also interact with the master regulator of flagella synthesis, FlrA (or FleQ in Pseudomonas) and prevents the synthesis of further early flagellar building blocks (Dasgupta and Ramphal, 2001; Blagotinsek et al., 2020; Banerjee et al., 2021). By this, FlhG links flagella synthesis with transcription regulation and effectively restricts to number of polar flagella that are formed. Based on this model, FipA may recruit FlhF to the membrane and stimulate or stabilize GTP binding and dimerization of FlhF to promote polar localization and initiation of flagella synthesis. Thus, the role of FipA is to shift the equilibrium to the active state of FlhF in order to start assembly of the MS ring. Accordingly, current studies address the structural basis of the FipA-FlhF interaction, the potential effect of FipA on GTP-binding and dimerization of FlhF, and the role of the polar marker HubP in this process.

In addition, fipA expression is independent of the rest of the flagellar genes in other species of Vibrio (Moisi et al., 2009; Petersen et al., 2021) and S. putrefaciens (Schwan et al., 2022). Thus, fipA transcription could provide another regulatory point to lead to the synthesis of a flagellum. Thus, the discovery of FipA opens several novel open questions in the field of flagellum regulation.

Materials and methods

Growth conditions and media

In all experiments, V. parahaemolyticus and E. coli were grown in LB medium or on LB agar plates at 37 °C containing antibiotics in the following concentrations: 50 μg/mL kanamycin, 100 μg/mL ampicillin and 20 μg/mL chloramphenicol for E. coli and 5 μg/mL for V. parahaemolyticus. S. putrefaciens CN-32 and P. putida KT 2440 were grown in LB medium or LB agar plates at 30 °C. When required, the media were supplemented with 50 µg/mL kanamycin, 300 µM 2,6-diaminopimelic acid and/or 10% (w/v) sucrose.

Strains and plasmids

The strains and plasmids used in this study are listed in Supplementary file 1c and d, respectively. Primers used are listed in Supplementary file 1e. E. coli strain SM10λpir was used to transfer DNA into V. parahaemolyticus by conjugation (Miller and Mekalanos, 1988). For DNA transfer into S. putrefaciens and P. putida, E. coli WM3064 was used. E. coli strains DH5αλpir and SM10λpir were used for cloning. Construction of V. parahaemolyticus deletion mutants was performed with standard allele exchange techniques using derivatives of plasmid pDM4 (Donnenberg and Kaper, 1991). Chromosomal deletions and integrations in S. putrefaciens and P. putida were carried out by sequential crossover as previously described (Rossmann et al., 2015) using derivatives of plasmid pNPTS138-R6K (Lassak et al., 2010).

Construction of plasmids

Plasmid pSW022: The regions flanking vp2224 (fipA) were cloned with primers VP2224-del-a/ b and VP2224-del-c/ d, using V. parahaemolyticus RIMD 2210633 chromosomal DNA as template. The resulting products were fused in a third PCR using primers VP2224-del-a/ VP2224-del-d. The end product was digested with XbaI and ligated in the equivalent site of vector pDM4, resulting in plasmid pSW022. The mutation in V. parahaemolyticus was confirmed with a PCR using primers VP2224-del-a/VP2224-check. Plasmid pPM123: The regions flanking aa 7–27 of vp2224 (fipA) were cloned with primers VP2224-del-a/ del AA7-27 vp2224-b and del AA7-27 vp2224-c/ VP2224-del-d, using V. parahaemolyticus RIMD 2210633 chromosomal DNA as template. The resulting products were fused in a third PCR using primers VP2224-del-a/ VP2224-del-d. The end product was digested with XbaI and ligated in the equivalent site of vector pDM4, resulting in plasmid pPM123. The mutation in V. parahaemolyticus was confirmed with a PCR using primers VP2224-del-a/VP2224-check. Plasmid pPM178: The gene vp2224 (fipA) was amplified from V. parahaemolyticus RIMD 2210633 chromosomal DNA with primers C-term sfGFP-vp2224-a/-b; the downstream region with primers C-term sfGFP-vp2224-e/f; the gene encoding sfGFP with C-term sfGFP-vp2224-c/d from plasmid pJH036. The three products were fused together in another PCR using primers C-term sfGFP-vp2224-a/f. The obtained product, encoding FipA fused in frame to sfGFP via a 5-residue linker, was digested with SpeI and SphI and ligated in vector pDM4 digested with XbaI and SphI, resulting in plasmid pPM178. The mutation in V. parahaemolyticus was confirmed with a PCR using primers C-term sfGFP-vp2224-f/VP2224-check. Plasmid pPM179 & pPM180: The region upstream of vp2224 (fipA) were amplified as for pSW022. The downstream region was amplified with downstream vp2224-cw/VP2224-del-d from V. parahaemolyticus RIMD 2210633. The gene vp2224 itself was amplified with primers vp2224 cw restore deletion/vp2224 ccw restore deletion, from plasmids pEP005 & pEP006, carrying the mutations G110A and L129A. The products were fused in a third PCR using primers VP2224-del-a/ VP2224-del-d. The end product was digested with XbaI and ligated in the equivalent site of vector pDM4, resulting in plasmids pPM179 & pPM180. The the re-insertion in V. parahaemolyticus SW01 was confirmed with a PCR using primers VP2224-del-a/VP2224-check. Plasmid pPM187 & pPM191: The insertion of sfGFP at the C-terminus of FipA was cloned with the same strategy for pPM178, but using pPM179 & pPM180 as templates for the vp2224 sequence, resulting in plasmids pPM191 & pPM187, respectively. Plasmid pPM146: The gene vp2224 (fipA) was amplified from V. parahaemolyticus RIMD 2210633 chromosomal DNA with primers vp2224-cw-pBAD/vp2224-ccw-pBAD. The product was digested with enzymes XbaI and SphI, and inserted in the corresponding site in plasmid pBAD33. Plasmid pPM159: The gene vp2224 (fipA) was amplified from V. parahaemolyticus RIMD 2210633 chromosomal DNA with primers C-term sfGFP-vp2224-a/-b, and the gene encoding sfGFP with C-term sfGFP-vp2224-c/sfGFP-1-ccw from plasmid pJH036. The resulting products were fused in another reaction with primers C-term sfGFP-vp2224-a/sfGFP-1-ccw, and this final product was digested with XbaI and cloned in pBAD33. Plasmid pPM194: Same as pPM159, but vp2224 ΔTM was amplified from pPM123 using primers vp2224 AA1-6/28-end w/o Stop/sfGFP-1-ccw. Plasmids pSW74 & pSW119: The region of the gene vp2224 (fipA) encoding the cytoplasmic part (residues 28–163) was amplified with primers tr2224 put18C cw/ pUT18C/pKT25-vp2224-ccw from V. parahaemolyticus chromosomal DNA. The product was digested with KpnI and XbaI and ligated in the corresponding site in pKT25, to generate pSW74, and in pUT18C, to generate pSW119. Plasmid pPM118 & pPM119: The cytoplasmic part of the gene vp2224 (fipA) was amplified with primers pUT18/pKNT25-tr-vp2224-cw & pUT18/pKNT25-vp2224ccw from V. parahaemolyticus chromosomal DNA. The product was digested with KpnI and XbaI and ligated in the corresponding site in pUT18, to generate pPM118, and in pKNT25, to generate pPM119. Plasmid pPM124 & pPM128: The gene vp2234 (flhF) was amplified with primers pUT18/pKNT25- vp2234-cw & pUT18/pKNT25-vp2234 -ccw from V. parahaemolyticus chromosomal DNA. The product was digested with KpnI and XbaI and ligated in the corresponding site in pUT18, to generate pPM124, and in pKNT25, to generate pPM128. Plasmid pPM132 & pPM136: The gene vp2234 (flhF) was amplified with primers pUT18C/pKT25- vp2234-cw & pUT18C/pKT25-vp2234 -ccw from V. parahaemolyticus chromosomal DNA. The product was digested with KpnI and XbaI and ligated in the corresponding site in pUT18C, to generate pPM132, and in pKT25, to generate pPM136. Plasmids pPM160, pPM161 & pPM162: Site directed mutagenesis was performed on plasmid pSW74 by the QuickChange method (Zheng et al., 2004), using primers vp2224-Gly-110Ala-cw/ccw, vp2224-Glu 126Ala-cw/ccw or vp2224-Leu 129Ala-cw/ccw. After digesting the template with DpnI, the products were transformed into E. coli and the mutations were confirmed by sequencing. Plasmid pPM106: The gene vp2224 (fipA) was amplified with primers pUT18C/pKT25-vp2224-cw & pUT18C/pKT25-vp2224ccw from V. parahaemolyticus chromosomal DNA. The product was digested with KpnI and XbaI and ligated in the corresponding site in pKTop, to generate pPM106. Plasmid pPM109 & pPM112: The phoA-lacZα fragment of pKTop was amplified with primers vp2224 C-term PhoA-LacZ cw & end -LacZ w/o STOP ccw. The full length vp2224(fipA) gene was amplified from plasmid pPM146 using primers LacZ to vp2224 w/o ATG & end vp2224 ccw. The vp2224 ΔTM allele was amplified from plasmid pPM123 using primers vp2224 AA1-6/28-end w/o Stop & end vp2224 ccw. The PCR products were fused in a second PCR using primers vp2224 C-term PhoA-LacZ cw & end vp2224 ccw. The fusion product was digested with XbaI and HindIII and cloned in the corresponding site of plasmid pBAD33.

Plasmids for genetic manipulation of S. putrefaciens and P. putida: The desired DNA fragments were generated by PCR using appropriate primer pairs (see Supplementary file 1e) that in addition create overhangs suitable for subsequent Gibson assembly into EcoV-digested vector pNTPS138-R6K (Gibson et al., 2009; Lassak et al., 2010). If necessary, primer overhangs were also used to generate base substitutions in the gene fragment to be cloned. Plasmids for Bacterial Two Hybrid (BACTH) analysis were similarly generated by amplification of the desired DNA-fragments, which were then introduced into the suitable vectors by Gibson assembly.

Soft-agar swimming assays

V. parahaemolyticus soft-agar swimming assays were essentially performed as described in Ringgaard et al., 2014 with the following modifications. Late exponential cultures of the required strains were used to prick LB plates with 0.3% agar, and incubated for 30 hr at 30 ° C. For S. putrefaciens and P. putida soft-agar swimming assays, 2 µl of an exponentially growing culture of the appropriate strains were spotted onto 0.25% LB agar plates and incubated at 30 °C (S. putrefaciens) or room temperature (P. putida) for about 18 hrs. Strains to be directly compared were always spotted onto the same plate. For the swimming assays in soft agar, strains of V. parahaemolyticus and S. putrefaciens, which are lacking lateral flagellin gene(s) (ΔlafA; ΔflaAB2) were used.

Bacterial-two-hybrid experiments, BACTH

BTH101 cells were made competent with calcium chloride. 15 μL aliquots were spotted in a 96 well plate, to which 2.5 μL of the corresponding pUT18(C) and pK(N)T25 derivative plasmids were added. After 30 min on ice, a heat shock at 42 ° C was applied for 30 s. The transformed cells were allowed to recover for 1 hr, after which the were grown in selective LB broth for another 3 hr. The resulting cultures were spotted on plates containing kanamycin, ampicillin, IPTG (0.25 mM) and X-Gal (80 μg/mL). The plates were photographed after 48–72 hr at 30 ° C.

Video tracking of swimming cells

Video tracking of swimming cells was performed essentially as described previously (Ringgaard et al., 2014). Swimming cells were recorded using the streaming acquisition function in the Metamorph software and the swimming paths of individual cells were tracked using the MTrackJ plug-in for ImageJ. The swimming speed, displacement, and number of reversals of individual cells were then measured and the average plotted with error bars indicating the standard deviation. Video tracking was performed using a Zeiss Axio Imager M1 fluorescence microscope. Images were collected with a Cascade:1 K CCD camera (Photometrics), using a Zeiss αPlan-Fluar 40 x/1.45 Oil phase contrast objective.

Transmission-electron-microscopy (TEM) analysis

Cell cultures grown to an OD600=0.5–0.6 were spotted on a plasma-discharged carbon-coated copper grid (Plano, Cat#S162-3) and rinsed with 0.002% uranyl acetate. Afterwards they were rinsed with water and blotted dry with Whatman filter paper. TEM images were obtained with a JEOL JEM-1400 Plus 120 KV transmission electron microscope at 80 kV.

Flagellum labeling

To fluorescently label flagellar filaments, maleimide-ligates dyes (Alexa Fluor 488 C5 maleimide fluorescent dye; Thermo Fisher Scientific) were coupled to surface-exposed cysteine residues, which were introduced into the flagellins (FlaA and FlaB) of the polar flagellar system in S. putrefaciens and P. putida as described (Kühn et al., 2017; Hintsche et al., 2017). Images were recorded as described in the microscopy section.

Fluorescence microscopy

Florescence microscopy on V. parahaemolyticus was carried out essentially as previously described (Muraleedharan et al., 2018), using a Nikon eclipse Ti inverted Andor spinning-disc confocal microscope equipped with a 100 x lens, an Andor Zyla sCMOS cooled camera, and an Andor FRAPPA system. Fluorescence microscopy on S. putrefaciens and P. putida was carried out as previously described (Kühn et al., 2017) using a custom microscope set-up (Visitron Systems, Puchheim, Germany) based on a Leica DMI 6000 B inverse microscope (Leica) equipped with a pco.edge sCMOS camera (PCO), a SPECTRA light engine (lumencor), and an HCPL APO 63×/1.4–0.6 objective (Leica) using a custom filter set (T495lpxr, ET525/50 m; Chroma Technology) using the VisiView software (Visitron Systems, Puchheim, Germany). Microscopy images were analyzed using ImageJ imaging software (http://rsbweb.nih.gov/ij) and Metamorph Offline (version 7.7.5.0, Molecular Devices). DIC (Vibrio) and phase contrast (Shewanella, Pseudomonas) were used according to the preferred settings for the corresponding species in the labs. Demographs were generated as described by Cameron et al., 2014 modified in Heering and Ringgaard, 2016 and Heering et al., 2017.

Mapping interaction partners using co-immunoaffinity purification and mass spectrometry (co-IP-MS)

For sample preparation of the IP-MS experiments we were using a modified version of the protocol presented by Turriziani et al., 2014. Cells were centrifuged and cell pellets were washed with cold PBS. Cell pellets were resuspended in lysis buffer (50 mM HEPES (pH 7.5), 150 mM NaCl, 0.5 % NP50, 5 mM EDTA, compete mini protease inhibitors (Complete Mini (Roche)). Cell lysis was performed by repetitive sonication. After removing cell debris by centrifugation 10 µl GFP-trap Sepharose (Chromotek) slurry was added to the lysate and incubation was carried out for 1.5 hr on a rotating shaker at 4 °C. Then the beads were pelleted, the supernatant removed and the beads washed 4 x with 100 mM NH4CO3 to remove remaining protease inhibitors and detergents. 200 µl elution buffer (1 M urea, 100 mM NH4CO3, 1 µg Trypsin (Promega)) was added to the beads and incubated at 1000 rpm on a thermomixer at 27 °C for 45 min. Beads were centrifuged and supernatant was collected. In order to increase peptide recovery 2 washing steps with 100 µL elution buffer 2 (1 M urea, 100 mM NH4CO3, 5 mM Tris(2-caboxyethyl)phosphine)) was performed and the individual bead supernatants were collected into one tube. Tryptic digestion was carried out overnight at 30 °C. After digest alkylation was performed with 10 mM iodoacetamide at 25 °C (in the dark). Then the samples were acidified (1% trifluoroacetic acid [TFA]) and C18 Microspin column (Harvard Apparatus) was carried out according to the manufacturer´s instruction. The samples were dried and recovered in 0.1% TFA and applied to liquid chromatography-mass spectrometry (LC-MS) analysis.

LC-MS analysis of digested lysates was performed on a Thermo QExactive Plus mass spectrometer (Thermo Scientific), which was connected to an electrospray ionsource (Thermo Scientific). Peptide separation was carried out using an Ultimate 3000 RSLCnano with Proflow upgrade (Thermo Scientific) equipped with a RP-HPLC column (75 μm x 42 cm) packed in-house with C18 resin (2.4 μm; Dr. Maisch) on an in-house designed column heater. The following separating gradient was used: 98% solvent A (0.15% formic acid) and 2% solvent B (99.85% acetonitrile, 0.15% formic acid) to 35% solvent B over 90 at a flow rate of 300 nl/min. The data acquisition mode was set to obtain one high resolution MS scan at a resolution of 70,000 full width at half maximum (at m/z 200) followed by MS/MS scans of the 10 most intense ions. To increase the efficiency of MS/MS attempts, the charged state screening modus was enabled to exclude unassigned and singly charged ions. The dynamic exclusion duration was set to 30 s. The ion accumulation time was set to 50ms (MS) and 50ms at 17,500 resolution (MS/MS). The automatic gain control (AGC) was set to 3x106 for MS survey scan and 1x105 for MS/MS scans.

MS raw data was then analyzed with MaxQuant (Version 1.6.3.4; https://www.nature.com/articles/nbt.1511) using a V.parahaemolyticus RIMD 2210633 uniprot database (https://www.uniprot.org/). MaxQuant was executed in standard settings with activated ‘match between runs’ option. The search criteria were set as follows: full tryptic specificity was required (cleavage after lysine or arginine residues); two missed cleavages were allowed; carbamidomethylation (C) was set as fixed modification; oxidation (M) and deamidation (N,Q) as variable modification. For further data analysis the MaxQuant LFQ values were loaded into Perseus (https://www.nature.com/articles/nmeth.3901) and a Student’s T-test was performed on LFQ values with false discovery rate 0.01 and S0: 0.1 as significance cut-off. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (PubMed ID: 34723319) partner repository with the dataset identifier PXD045379 (http://www.ebi.ac.uk/pride).

Membrane topology mapping of FipA

We experimentally determined the membrane orientation of FipA in the membrane using the dual pho-lac reporter system (Karimova et al., 2009), which consists of a translational fusion of the E. coli alkaline phosphatase fragment PhoA22-472 and the α-peptide of E. coli β-galactosidase, LacZ4-60. A periplasmic localization of the reporter leads to high alkaline phosphatase activity and low β-galactosidase activity, whereas a cytosolic location of the reporter results in high β-galactosidase activity and low alkaline phosphatase activity. Pho-Lac-FipA and FipA-Pho-Lac fusion proteins were ectopically expressed in E. coli DH5α grown on a dual-indicator LB medium containing a blue indicator for phosphatase activity (X-Phos) and red indicator for β-galactosidase activity (Red-Gal) (see Figure 1—figure supplement 1).

Bioinformatic analysis

Homologues of FipA were searched using BLAST against the KEGG database, with the sequence of the V. parahaemolyticus protein. All homologues containing a DUF2802 were included. The search was later expanded to species known to encode a FlhF homologue (defined as the highest scoring result from a BLAST search using FlhF of V. parahaemolyticus as a query, that was also encoded upstream of an FlhG homologue). The flagellation phenotype was later corroborated in the description registered at the List of Prokaryotic names with Standing in Nomenclature (Parte et al., 2020).

Acknowledgements

We are grateful to Dr. Kathrin Schirner for comments on the manuscript and suggestions for experiments, and Manuel González-Vera for his help on the phylogenetic search. We would like to thank Ulrike Ruppert for great technical support and Jan Heering for construction of plasmid pJH036. This work was supported by the Ludwig-Maximilians-Universität München and the Max Planck Society (SR) and by a grant (TRR 174 P12) from the Deutsche Forschungsgemeinschaft DFG to KMT within the framework of the DFG priority program TRR 174.

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Vibrio parahaemolyticus) fipA KEGG VP2224
Gene (Pseudomonas putida) fipA KEGG PP_4331
Gene (Shewanella putrefaciens) fipA KEGG Sputcn32_2550
Gene (Vibrio parahaemolyticus) flhF KEGG VP2234
Gene (Pseudomonas putida) flhF KEGG PP_4343
Gene (Shewanella putrefaciens) flhF KEGG Sputcn32_2561
Strain (Escherichia coli) SM10λpir Simon et al., 1983
Strain (Escherichia coli) DH5pir Miller and Mekalanos, 1988
Strain (Escherichia coli) BTH101 Euromedex
Strain (Escherichia coli) WM3064 Metcalf, University of Illinois, Urbana‐Champaign
Strain (Vibrio parahaemolyticus) RIMD 2210633 Makino et al., 2003 Wild type
Strain (Vibrio parahaemolyticus) Δvp2234 (ΔflhF), Δvpa1548 (ΔlafA) Arroyo-Pérez and Ringgaard, 2021 EP12
Strain (Vibrio parahaemolyticus) Δvp2225 (ΔcheW) Ringgaard et al., 2014 SR58
Strain (Vibrio parahaemolyticus) Δvpa1548 (ΔlafA) Arroyo-Pérez and Ringgaard, 2021 JH2
Strain (Vibrio parahaemolyticus) Δvp2224 (ΔfipA), Δvpa1548 (ΔlafA) this study EP15 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2234 (ΔflhF) Arroyo-Pérez and Ringgaard, 2021 PM60
Strain (Vibrio parahaemolyticus) Δvp2224 (ΔfipA) this study SW01 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2191 (ΔhubP) Arroyo-Pérez and Ringgaard, 2021 JH4
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp) Arroyo-Pérez and Ringgaard, 2021 PM69
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2224 (fipA) this study PM77 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2191 (hubP) Arroyo-Pérez and Ringgaard, 2021 EP11
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2224 (fipA), Δvp2191 (hubP) this study EP09 Materials and Methods
Strain (Vibrio parahaemolyticus) vp2224 (fipA) L129A this study PM65 Materials and Methods
Strain (Vibrio parahaemolyticus) vp2224 (fipA) G110A this study PM66 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), vp2224 (fipA) L129A this study EP16 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), vp2224 (fipA) G110A this study EP17 Materials and Methods
Strain (Vibrio parahaemolyticus) vp2224 L129A, Δvpa1548(lafA) this study EP13 Materials and Methods
Strain (Vibrio parahaemolyticus) vp2224 G110A, Δvpa1548(lafA) this study EP14 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2224::vp2224-sfgfp (ΔfipA::fipA-sfgfp) this study PM64 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2224::vp2224-sfgfp (ΔfipA::fipA-sfgfp), Δvp2234 (flhF) this study PM68 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2224::vp2224 L129A-sfgfp (ΔfipA L129A::fipA-sfgfp) this study PM71 Materials and Methods
Strain (Vibrio parahaemolyticus) Δvp2224::vp2224 G110A-sfgfp (ΔfipA G110A::fipA-sfgfp) this study PM72 Materials and Methods
Strain (Pseudomonas putida) KT2440 Nelson et al., 2002 Wild type
Strain (Pseudomonas putida) FliC S267C Hintsche et al., 2017
Strain (Pseudomonas putida) FliC S267C ΔflhF this study Materials and Methods
Strain (Pseudomonas putida) ΔfipA this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C ΔfipA this study Materials and Methods
Strain (Pseudomonas putida) FipA -DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C ΔflhF FipA-DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C ΔfimV FipA -DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) ΔfipA FlhF-GS-mCherry this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA G104A this study Materials and Methods
Strain (Pseudomonas putida) FipA L123A this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA L123A this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA-DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA L116A this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA G104A-DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA L123A-DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA L116A-DILEL-sfGFP this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry ΔfimV this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C ΔfipA FipA KI this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry ΔfimV ΔfipA this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry FipA L123A this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry FipA L116A this study Materials and Methods
Strain (Pseudomonas putida) FlhF-GS-mCherry FipA G104A this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FlhF D362A-GS-mCherry this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FlhF-GS-mCherry FipA ΔTMD this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FlhF-GS-mCherry FipA ΔTMD this study Materials and Methods
Strain (Pseudomonas putida) FliC S267C FipA ΔTMD-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) CN-32 Fredrickson et al., 1998 Wild type
Strain (Shewanella putrefaciens) ΔflhF Rossmann et al., 2015
Strain (Shewanella putrefaciens) CheA-mCherry this study Materials and Methods
Strain (Shewanella putrefaciens) flgE1 T183C Rossmann et al., 2019
Strain (Shewanella putrefaciens) flaB1 T166C flaA1 T174C ΔflagL Kühn et al., 2017
Strain (Shewanella putrefaciens) ΔfipA this study Materials and Methods
Strain (Shewanella putrefaciens) CheA-mCherry ΔfipA this study Materials and Methods
Strain (Shewanella putrefaciens) flaB1 T166C flaA1 T174C ΔflagL ΔfipA this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus this study Materials and Methods
Strain (Shewanella putrefaciens) FipA-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus ΔfipA this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus ΔflhG this study Materials and Methods
Strain (Shewanella putrefaciens) FipA-DILEL-sfGFP ΔflhF this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus ΔhubP this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus ΔfipA ΔhubP this study Materials and Methods
Strain (Shewanella putrefaciens) flgE1 T183C ΔflagL Hook et al., 2020
Strain (Shewanella putrefaciens) FipA-DILEL-sfGFP ΔhubP this study Materials and Methods
Strain (Shewanella putrefaciens) HubP-mCherry FlhF-GS-Venus this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus ΔhubP ΔSputcn32_3157 this study Materials and Methods
Strain (Shewanella putrefaciens) flaB1 T166C flaA1 T174C ΔflagL FipA-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) flaB1 T166C flaA1 T174C ΔflagL ΔflhF this study Materials and Methods
Strain (Shewanella putrefaciens) ΔfipA fipA (Sputcn32_2550) KI this study Materials and Methods
Strain (Shewanella putrefaciens) FipA L118A this study Materials and Methods
Strain (Shewanella putrefaciens) FipA G106A this study Materials and Methods
Strain (Shewanella putrefaciens) FipA L118-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) FipA G106A-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) flgE1 T183C ΔflagL FliM1-GS-sfGFP Hook et al., 2020
Strain (Shewanella putrefaciens) FipA L125A this study Materials and Methods
Strain (Shewanella putrefaciens) flaB1 T166C flaA1 T174C ΔflagL ΔfipA ΔhubP this study Materials and Methods
Strain (Shewanella putrefaciens) FipA L125A-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-mCherry FipA-DILEL-sfGFP this study Materials and Methods
Strain (Shewanella putrefaciens) FipA L118A FlhF-GS-mVenus this study Materials and Methods
Strain (Shewanella putrefaciens) FipA G106A FlhF-GS-mVenus this study Materials and Methods
Strain (Shewanella putrefaciens) FipA L125A FlhF-GS-mVenus this study Materials and Methods
Strain (Shewanella putrefaciens) FipA ΔTMD this study Materials and Methods
Strain (Shewanella putrefaciens) FlhF-GS-mVenus FipA ΔTMD this study Materials and Methods
Strain (Shewanella putrefaciens) FipA ΔTMD-DILEL-sfGFP this study Materials and Methods
Antibody JL-8 anti-GFP (mouse monoclonal) Takarabio 632380 WB (1:10,000)
Antibody Amersham ECL mouse IgG (sheep, polyclonal) General Electric NA931 WB (1:5,000)
Antibody Anti-GFP (mouse) Roche 11814460001 WB (1:5,000)
Antibody Anti-mCherry (rabbit) Biovision 5993–100 WB (1:10,000)
Antibody Anti-mouse Sigma A3562 WB (1:5,000)
Antibody Anti-rabbit Sigma A8025 WB (1:20,000)
Recombinant DNA reagent pDM4 Milton et al., 1996 Suicide vector for
gene deletions
in Vibrio sp.
Recombinant DNA reagent pJH036 Iyer et al., 2020 pBAD33 derivative for
sfGFP C-terminal fusion
Recombinant DNA reagent pNPTS138-R6KT Lassak et al., 2010 Suicide vector for gene
deletions in P. putida and
S. Putrefaciens
Recombinant DNA reagent pKT25 Karimova et al., 1998 For bacterial two
hybrid assay
Recombinant DNA reagent pKNT25 Karimova et al., 1998 For bacterial two
hybrid assay
Recombinant DNA reagent pUT18 Karimova et al., 1998 For bacterial two
hybrid assay
Recombinant DNA reagent pUT18C Karimova et al., 1998 For bacterial two
hybrid assay
Recombinant DNA reagent pJH003 Heering and Ringgaard, 2016 For deletion of
vpa1548(lafA)
Recombinant DNA reagent pSW022 This work For deletion of vp2224(fipA)
Recombinant DNA reagent pPM188fip Arroyo-Pérez and Ringgaard, 2021 For insertion of vp2234-
sfgfp (flhF-sfgfp),
replacing native flhF
Recombinant DNA reagent pPM178 this work For insertion of vp2224-
sfgfp (fipA-sfgfp),
replacing native fipA
Recombinant DNA reagent pPM179 this work For insertion of vp2224
(fipA) G110A point
mutation in the chromosome
in the native locus
Recombinant DNA reagent pPM180 this work For insertion of vp2224 (fipA)
L129A point mutation
in the chromosome in the native locus
Recombinant DNA reagent pPM191 this work For insertion of vp2224 (fipA)
G110A fused
to sfGFP in the chromosome in
the native locus
Recombinant DNA reagent pPM187 this work For insertion of vp2224 (fipA) L129A fused
to sfGFP in the chromosome
in the native locus
Recombinant DNA reagent pPM039 Arroyo-Pérez and Ringgaard, 2021 For deletion of vp2191 (hubP)
Recombinant DNA reagent pPM194 this work For overexpression of VP2224(FipA)
Δ7–27 -sfGFP
Recombinant DNA reagent pPM146 this work For overexpression of
VP2224(FipA)
Recombinant DNA reagent pPM159 this work For overexpression of
VP2224(FipA)-sfGFP
Recombinant DNA reagent pNPTS138-R6KT flhF KO (PP_4343) this study For deletion of the flhF gene
(PP_4343)
in P. putida KT2440;
Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF K235A (PP_4343) this study For in frame complementation of flhF
(PP_4343) with FlhF
K235A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF-GS-mCherry (PP_4343) this study For in frame complementation of flhF (PP_4343)
with FlhF-GS-mCherry in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF K235A-GS-mCherry (PP_4343) this study For in frame complementation
of flhF (PP_4343) with
FlhF K235A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF D301A-GS-mCherry (PP_4343) this study For in frame complementation of flhF
(PP_4343) with FlhF
D301A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF D362A-GS-mCherry (PP_4343) this study For in frame complementation
of flhF (PP_4343) with FlhF D362A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT fipA KO (PP_4331) this study For deletion of the fipA gene (PP_4331) in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT fipA KI (PP_4331) this study For in frame complementation of fipA
(PP_4331) with wild
type fipA in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA ΔTMD (AS5-22) (PP_4331) this study For in frame complementation
of fipA (PP_4331) with FipA ΔTMD
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA G104A (PP_4331) this study For in frame complementation
of fipA
(PP_4331) with FipA G104A
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L116A (PP_4331) this study For in frame complementation
of fipA (PP_4331) with FipA L116A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L123A (PP_4331) this study For in frame complementation
of fipA (PP_4331) with FipA L123A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA-DILEL-sfGFP (PP_4331) this study For in frame complementation of fipA
(PP_4331) with FipA-DILEL-sfGFP in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA ΔTMD-DILEL-sfGFP (AS5-22) (PP_4331) this study For in frame complementation of fipA
(PP_4331) with FipA ΔTMD-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA G104A-DILEL-sfGFP (PP_4331) this study For in frame complementation of fipA
(PP_4331) with FipA G104A-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L116A-DILEL-sfGFP (PP_4331) this study For in frame complementation of fipA
(PP_4331) with FipA L116A-DILEL-sfGFP mutant in
P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L123A-DILEL-sfGFP (PP_4331) this study For in frame complementation of fipA
(PP_4331) with FipA L123A-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagent pNPTS138-R6KT polar flagellar cluster KO (Sputcn32_2548–2608) this study plasmid for deletion of the polar flagellar
gene cluster (Sputcn32_2548–2608) in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT lateral flagellar cluster KO (Sputcn32_3444–3485) Lassak et al., 2010 plasmid for deletion of the lateral flagellar
gene cluster (Sputcn32_3444–3485) in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT flagL KO (Sputcn32_3455, Sputcn32_3456) Rossmann et al., 2015 plasmid for deletion of the lateral flagellin
genes (Sputcn32_3455, Sputcn32_3456)
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT hubP KO (Sputcn32_2442) Rossmann et al., 2015 plasmid for deletion of the hubP gene
(Sputcn32_2442) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT flhF KO (Sputcn32_2561) Rossmann et al., 2015 plasmid for deletion of the flhF gene
(Sputcn32_2561) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT flhG KO (Sputcn32_2560) Schuhmacher et al., 2015a plasmid for deletion of the flhG gene
(Sputcn32_2560) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FlhF-GS-Venus (Sputcn32_2561) this study plasmid for in frame complementation
of flhF (Sputcn32_2561) with FlhF-GS-mVenus
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT fipA KO (Sputcn32_2550) this study plasmid for deletion of the fipA gene
(Sputcn32_2550) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT fipA KI (Sputcn32_2550) this study plasmid for in frame complementation
of fipA (Sputcn32_2550) with wild type
fipA in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA ΔTMD (AS5-23) (Sputcn32_2550) this study plasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA ΔTMD mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA G106A (Sputcn32_2550) this study plasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA G106A mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L118A (Sputcn32_2550) this study plasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA L118A mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L125A (Sputcn32_2550) this study plasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L125 mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA-DILEL-sfGFP (Sputcn32_2550) this study plasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA-DILEL-sfGFP
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA ΔTMD-DILEL-sfGFP (AS5-23) (Sputcn32_2550) this study plasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA
ΔTMD-DILEL-sfGFP mutant in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA G106A-DILEL-sfGFP (Sputcn32_2550) this study plasmid for in frame
complementation of fipA (Sputcn32_2550)
with FipA G106A-DILEL-sfGFP mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L116A-DILEL-sfGFP (Sputcn32_2550) this study plasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L116A-DILEL-sfGFP
mutant in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FipA L125A-DILEL-sfGFP (Sputcn32_2550) this study plasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L125A mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pNPTS138-R6KT FliM1-GS-sfGFP (Sputcn32_2569) Hook et al., 2020 plasmid for in frame
complementation of fliM1
(Sputcn32_2569) with FliM1-GS-sfGFP
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagent pSW74 this study T25-vp2224(fipA)Δ1–27
Recombinant DNA reagent pSW119 this study T18-vp2224(fipA)Δ1–27
Recombinant DNA reagent pPM118 this study vp2224(fipA)Δ1–27 T18
Recombinant DNA reagent pPM119 this study vp2224(fipA)Δ1–27 T25
Recombinant DNA reagent pPM124 this study vp2234(flhF)-T18
Recombinant DNA reagent pPM128 this study vp2234(flhF)-T25
Recombinant DNA reagent pPM132 this study T18-vp2234(flhF)
Recombinant DNA reagent pPM136 this study T25-vp2234(flhF)
Recombinant DNA reagent pPM160 this study T18-vp2224(fipA)
Δ1–27 G110A
Recombinant DNA reagent pPM161 this study T18-vp2224(fipA)
Δ1–27 E126A
Recombinant DNA reagent pPM162 this study T18-vp2224(fipA)
Δ1–27 L129A
Recombinant DNA reagent pKT25 FlhF (PP_4343) this study plasmid for BACTH assay
carrying T25-FlhF
(PP_4343); Kanr
Recombinant DNA reagent pKNT25 FlhF (PP_4343) this study plasmid for BACTH assay
carrying FlhF-T25
(PP_4343); Kanr
Recombinant DNA reagent pUT18 FlhF (PP_4343) this study plasmid for BACTH assay
carrying FlhF-T18
(PP_4343);
Ampr
Recombinant DNA reagent pUT18C FlhF (PP_4343) this study plasmid for BACTH assay
carrying T18-FlhF (PP_4343);
Ampr
Recombinant DNA reagent pKT25 FlhF K235A (PP_4343) this study plasmid for BACTH assay
carrying T25-FlhF K235A
(PP_4343);
Kanr
Recombinant DNA reagent pKNT25 FlhF K235A (PP_4343) this study plasmid for BACTH assay
carrying FlhF K235A -T25 (PP_4343);
Kanr
Recombinant DNA reagent pUT18 FlhF K235A (PP_4343) this study plasmid for BACTH assay
carrying FlhF K235A -T18
(PP_4343); Ampr
Recombinant DNA reagent pUT18C FlhF K235A (PP_4343) this study plasmid for BACTH assay
carrying T18-FlhF K235A
(PP_4343);
Ampr
Recombinant DNA reagent pKT25 FipA (PP_4331) this study plasmid for BACTH assay
carrying T25-FipA (PP_4331);
Kanr
Recombinant DNA reagent pKNT25 FipA (PP_4331) this study plasmid for BACTH assay
carrying FipA-T25 (PP_4331);
Kanr
Recombinant DNA reagent pUT18 FipA (PP_4331) this study plasmid for BACTH assay
carrying FipA-T18 (PP_4331);
Ampr
Recombinant DNA reagent pUT18C FipA (PP_4331) this study plasmid for BACTH assay
carrying T18-FipA (PP_4331);
Ampr
Recombinant DNA reagent pKT25 FipA G104A (PP_4331) this study plasmid for BACTH assay
carrying T25-FipA G104A
(PP_4331); Kanr
Recombinant DNA reagent pKNT25 FipA G104A (PP_4331) this study plasmid for BACTH assay
carrying FipA G104A -T25
(PP_4331); Kanr
Recombinant DNA reagent pUT18 FipA G104A (PP_4331) this study plasmid for BACTH assay
carrying FipA G104A -T18
(PP_4331); Ampr
Recombinant DNA reagent pUT18C FipA G104A (PP_4331) this study plasmid for BACTH assay
carrying T18-FipA G104A
(PP_4331); Ampr
Recombinant DNA reagent pKT25 FipA L116A (PP_4331) this study plasmid for BACTH assay
carrying T25-FipA L116A
(PP_4331); Kanr
Recombinant DNA reagent pKNT25 FipA L116A (PP_4331) this study plasmid for BACTH assay
carrying FipA L116A -T25
(PP_4331); Kanr
Recombinant DNA reagent pUT18 FipA L116A (PP_4331) this study plasmid for BACTH assay
carrying FipA L116A -T18
(PP_4331); Ampr
Recombinant DNA reagent pUT18C FipA L116A (PP_4331) this study plasmid for BACTH assay
carrying T18-FipA L116A
(PP_4331); Ampr
Recombinant DNA reagent pKT25 FipA L125A (PP_4331) this study plasmid for BACTH assay
carrying T25-FipA L123A
(PP_4331); Kanr
Recombinant DNA reagent pKNT25 FipA L125A (PP_4331) this study plasmid for BACTH assay
carrying FipA L123A -T25
(PP_4331); Kanr
Recombinant DNA reagent pUT18 FipA L125A (PP_4331) this study plasmid for BACTH assay
carrying FipA L123A -T18
(PP_4331); Ampr
Recombinant DNA reagent pUT18C FipA L125A (PP_4331) this study plasmid for BACTH assay
carrying T18-FipA L123A
(PP_4331); Ampr
Recombinant DNA reagent pKT25 FlhF (Sputcn32_2561) this study plasmid for BACTH assay
carrying T25-FlhF
(Sputcn32_2561); Kanr
Recombinant DNA reagent pKNT25 FlhF (Sputcn32_2561) this study plasmid for BACTH assay
carrying FlhF-T25
(Sputcn32_2561); Kanr
Recombinant DNA reagent pUT18 FlhF (Sputcn32_2561) this study plasmid for BACTH assay
carrying FlhF-T18
(Sputcn32_2561); Ampr
Recombinant DNA reagent pUT18C FlhF (Sputcn32_2561) this study plasmid for BACTH assay
carrying T18-FlhF
(Sputcn32_2561); Ampr
Recombinant DNA reagent pKT25 FipA (Sputcn32_2550) this study plasmid for BACTH assay
carrying T25-FipA
(Sputcn32_2550); Kanr
Recombinant DNA reagent pKNT25 FipA (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA-T25
(Sputcn32_2550); Kanr
Recombinant DNA reagent pUT18 FipA (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA-T18
(Sputcn32_2550); Ampr
Recombinant DNA reagent pUT18C FipA (Sputcn32_2550) this study plasmid for BACTH assay
carrying T18-FipA
(Sputcn32_2550); Ampr
Recombinant DNA reagent pKT25 FipA G106A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T25-FipA G106A
(Sputcn32_2550); Kanr
Recombinant DNA reagent pKNT25 FipA G106A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA G106A -T25
(Sputcn32_2550); Kanr
Recombinant DNA reagent pUT18 FipA G106A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA G106A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagent pUT18C FipA G106A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T18-FipA G106A
(Sputcn32_2550); Ampr
Recombinant DNA reagent pKT25 FipA L116A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T25-FipA L116A
(Sputcn32_2550); Kanr
Recombinant DNA reagent pKNT25 FipA L116A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA L116A -T25
(Sputcn32_2550); Kanr
Recombinant DNA reagent pUT18 FipA L116A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA L116A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagent pUT18C FipA L116A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T18-FipA L116A
(Sputcn32_2550); Ampr
Recombinant DNA reagent pKT25 FipA L125A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T25-FipA L125A
(Sputcn32_2550); Kanr
Recombinant DNA reagent pKNT25 FipA L125A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA L125A
-T25 (Sputcn32_2550); Kanr
Recombinant DNA reagent pUT18 FipA L125A (Sputcn32_2550) this study plasmid for BACTH assay
carrying FipA L125A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagent pUT18C FipA L125A (Sputcn32_2550) this study plasmid for BACTH assay
carrying T18-FipA L125A
(Sputcn32_2550); Ampr
Sequence-based reagent VP2224-del-a this study PCR primers CCCCC tctaga ACGTTGTCATGCTTGGTGAAAGCA
Sequence-based reagent VP2224-del-b this study PCR primers AGTCTCTTCAGCCATCGTCATTC
Sequence-based reagent VP2224-del-c this study PCR primers gaatgacgatggctgaagagact cgacgataaagagaataaaaagaagc
Sequence-based reagent VP2224-del-d this study PCR primers CCCCC tctaga ACGCGACGCTGCTGACCCGCAGAA
Sequence-based reagent VP2224-check this study PCR primers acaaactccgtggggatgaatac
Sequence-based reagent vp2224 AA1-6/28-end w/o Stop this study PCR primers ccccc ctcaga atg gctgaagagacttttctgcgc
Sequence-based reagent pUT18C/pKT25-vp2234-cw this study PCR primers ccccc tctaga G aaaataaagcgattttttgccaaagac
Sequence-based reagent pUT18C/pKT25-vp2234-ccw this study PCR primers ccccc ggtacc ctagagtccttcgttgtcactg
Sequence-based reagent vpa1548-del-d this study PCR primers Ccccc ctcgag TTATGTGTTCCGCCTTCCTCTC
Sequence-based reagent vpa1548-del-chk this study PCR primers aagtagccacatcccaaacgc
Sequence-based reagent VP2191-del-d this study PCR primers ccccc tctaga GACAATGCGCTGCACGGAAT
Sequence-based reagent VP2191-del-chk this study PCR primers gatggaaaacggctacacca
Sequence-based reagent del vp2234(FlhF)-d this study PCR primers CCCCC tctaga GAATACATGCTACGAGCTCAAGG
Sequence-based reagent del vp2234(FlhF)-chk this study PCR primers GTTTACGGCATGATTGATGGCG
Sequence-based reagent vp2224-Gly110Ala-cw this study PCR primers gagcaaccaaaatggtgcagttaGCGgctgatatcaacgagctaatcg
Sequence-based reagent vp2224-Gly110Ala-ccw this study PCR primers CGATTAGCTCGTTGATATCAGCcgcTAACTGCACCATTTTGGTTGCTC
Sequence-based reagent vp2224-Glu126Ala-cw this study PCR primers agagtgtgaactgccaaaagcaGCAgcagagttgatgctctctttgc
Sequence-based reagent vp2224-Glu126Ala-ccw this study PCR primers GCAAAGAGAGCATCAACTCTGctgCTGCTTTTGGCAGTTCACACTCT
Sequence-based reagent vp2224-Leu129Ala-cw this study PCR primers tgaactgccaaaagcagaagcagag GC gatgctctctttgcagaaaaaactg
Sequence-based reagent vp2224-Leu129Ala-ccw this study PCR primers CAG TTT TTT CTG CAA AGA GAG CAT CGC CTC TGC TTC TGC TTT TGG CAG TTC A
Sequence-based reagent C-term sfGFP-vp2224-a this study PCR primers CCCCC actagt ATGGCTGAAGAGACTTTTTTATCTGTAC
Sequence-based reagent C-term sfGFP-vp2224-b this study PCR primers gagctcgaggatgtc TCGTCGACGCCCACGTGG
Sequence-based reagent C-term sfGFP-vp2224-c this study PCR primers gacatcctcgagctc atgagcaaaggagaagaacttttcac
Sequence-based reagent C-term sfGFP-vp2224-d this study PCR primers tta tttgtagagctcatccatgcc
Sequence-based reagent C-term sfGFP-vp2224-e this study PCR primers ggcatggatgagctctacaaa taa AGAGAATAAAAAGAAGCTTCGG
Sequence-based reagent C-term sfGFP-vp2224-f this study PCR primers ccccc gcatgc TTTGTTTGTCGATTGCTGTTAGTGG
Sequence-based reagent del AA7-27 vp2224-b this study PCR primers AAAAGTCTCTTCAGCCATCGTCATTC
Sequence-based reagent del AA7-27 vp2224-c this study PCR primers GAATGACGATGGCTGAAGAGACTTTT CTGCGCATTCGTGCTAGTTTGC
Sequence-based reagent vp2224-cw-pBAD this study PCR primers CCCCC tctaga atggctgaagagacttttttatctg
Sequence-based reagent vp2224-ccw-pBAD this study PCR primers CCCCC gcatgc ttatcgtcgacgcccacg
Sequence-based reagent vp2224 cw restore deletion this study PCR primers ACCTATAATTGGCTGAATGACG ATGGCTGAAGAGACTTTTTTATCTGTAC
Sequence-based reagent downstream vp2224 cw this study PCR primers AGAGAATAAAAAGAAGCTTCGGC
Sequence-based reagent pUT18/pKNT25- vp2224-cw this study PCR primers ccccc TCTAGA atggctgaagagacttttttatctgtac
Sequence-based reagent pUT18/pKNT25- tr-vp2224-cw this study PCR primers ccccc TCTAGA ATG cgcattcgtgctagtttgc
Sequence-based reagent pUT18/pKNT25-vp2222 -ccw this study PCR primers ccccc GGTACC CG tcgtcgacgcccacgtg
Sequence-based reagent pUT18C/pKT25-vp2224-cw this study PCR primers ccccc tctaga G gctgaagagacttttttatctgtac
Sequence-based reagent pUT18C/pKT25-vp2224-ccw this study PCR primers ccccc ggtacc ttatcgtcgacgcccacgtg
Sequence-based reagent tr2224 put18C cw this study PCR primers ccccc tctaga G ATG cgcattcgtgctagtttgcaaaa
Sequence-based reagent sfGFP-1-ccw this study PCR primers ccccc tctaga tttgtagagctcatccatgccatg
Sequence-based reagent vp2224 C-term PhoA-LacZ cw this study PCR primers CCCCC tctaga g atggcccggacaccagaaatg
Sequence-based reagent end -LacZ w/o STOP ccw this study PCR primers gcgccattcgccattcaggctgc
Sequence-based reagent LacZ to vp2224 w/o ATG this study PCR primers CCT GAA TGG CGA ATG GCG C GCT GAA GAG ACT TTT TTA TCT GTA CC
Sequence-based reagent end vp2224 ccw this study PCR primers CCCCC aagctt ttatcgtcgacgcccacgtgg
Sequence-based reagent vp2224 ccw restore deletion this study PCR primers GCCGAAGCTTCTTTTTATTCTCT TTATCGTCGACGCCCACGTG
Sequence-based reagent M13 this study PCR primers TGTAAAACGACGGCCAGTCC
Sequence-based reagent M13r this study PCR primers CACACAGGAAACAGCTATGACC
Sequence-based reagent flhF1-flhG1 fwd this study PCR primers GCGCTGAGTGTGTTGATCCAAA
Sequence-based reagent EcoRV FliM1 N-term fwd this study PCR primers GCGAATTCGTGGATCCAGATGCTCATTGAAGATGCTCTCCTG
Sequence-based reagent EcoRV FliM1 N-term rev this study PCR primers GCCAAGCTTCTCTGCAGGATAATAAAACTGCGGCCCACTTCC
Sequence-based reagent Check-GFP FliM1-fwd this study PCR primers GCAGTTCAGATGAGTCATCCTC
Sequence-based reagent Check-GFP FliM1 KO-rev this study PCR primers GACATTTTGGCAGTTGATGCGAC
Sequence-based reagent OL FliM1 GFP rev this study PCR primers GAAAAGTTCTTCTCCTTTGCTGCTGCCTAATTCAGATATATCTCTAGCTTTGCCTTTGC
Sequence-based reagent OL FliM1 GFP fwd this study PCR primers GGATGAGCTCTACAAAGGATCCTAAGGTGAAGCAAGATGAGCACAGAAGATA
Sequence-based reagent EcoRV FlhF C-term fwd this study PCR primers GCGAATTCGTGGATCCAGATGCAAGAAATGGTTGGACAGCCT
Sequence-based reagent EcoRV FlhF C-term rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCCACATCTAAAAATCGGTCGG
Sequence-based reagent Check-FlhF-FLAG-fwd this study PCR primers GCATCAGTCAATGCAAGCAACC
Sequence-based reagent OL-FlhF-Venus rev this study PCR primers CACGCTGCCCTCAAATGCACAGGCCATATTATCTG
Sequence-based reagent OL_Venus fwd this study PCR primers GCATTTGAGGGCAGCGTGAGCAAGGGCGAGGAGCTGTT
Sequence-based reagent OL_Venus rev this study PCR primers GTCATAACTTTACTTGTACAGCTCGTCCATGCC
Sequence-based reagent OL-FlhF-Venus fwd this study PCR primers TACAAGTAAAGTTATGACCCTGGATCAAGCAAG
Sequence-based reagent FlhF-Ven Seq_Primer this study PCR primers GCTGAGTTAGTACGAGCACTAC
Sequence-based reagent FlhG-Ven Seq_Primer this study PCR primers CGATATTATTGTCCGTGGGCCT
sequence-based reagent FlhF-Ven Seq_Primer fwd this study PCR primers GCTGTTGTAGTTGTACTCCAGC
sequence-based reagent EcoRV FlhF C-term rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCCACATCTAAAAATCGGTCGG
sequence-based reagent EcoRV-2550-GFP-fwd this study PCR primers GCGAATTCGTGGATCCAGATGCCATCAATAACGGAAAAGGGG
sequence-based reagent OL-2550-GFP-rev this study PCR primers GAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCTTTACGATGTAACCGGATCAATAATTCAGC
sequence-based reagent OL-2550-GFP-fwd this study PCR primers GGATGAGCTCTACAAAGGATCCTAACGAAGTGTAGGGGCTAAGACG
sequence-based reagent EcoRV-2550-GFP-rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCCTTTGTTTATATGCTCGACGG
sequence-based reagent Check-2550-GFP-fwd this study PCR primers CGATGAAGAATGGGCTGAACTC
sequence-based reagent Check-2550-GFP-rev this study PCR primers CGAAGGATGCGAGAATGACGAA
sequence-based reagent OL-2069_FlhF-rev this study PCR primers AATCTTCACTAGCATCCCCGTACATTGAACTC
sequence-based reagent OL-FlhF-Ven-fwd this study PCR primers GGGATGCTAGTGAAGATTAAACGATTTTTTGCCAAAGAC
sequence-based reagent OL-FlhF-Ven-rev this study PCR primers AACATTAGCTTACTTGTACAGCTCGTCCATGC
sequence-based reagent OL-2068-fwd this study PCR primers TACAAGTAAGCTAATGTTTTAGGGTCTTACGCG
sequence-based reagent BACTH 2550 pkT25 fwd this study PCR primers CAGGGTCGACTCTAGAGGGCGATGAATTTTTGATCGCGG
sequence-based reagent BACTH 2550 pkT25 rev this study PCR primers TTAGTTACTTAGGTACCCGGGGTTTACGATGTAACCGGATCAATAATTCAGC
sequence-based reagent BACTH 2550 fwd this study PCR primers CTGCAGGTCGACTCTAGAGGGCGATGAATTTTTGATCGCGG
Sequence-based reagent BACTH 2550 rev this study PCR primers GAGCTCGGTACCCGGGGTTTACGATGTAACCGGATCAATAATTCAGC
Sequence-based reagent OL_FliM1 mCh rev this study PCR primers TTTGTATAACTCATCCATACCA
Sequence-based reagent FlhF-Ven Seq_Primer rev this study PCR primers GCTGGAGTACAACTACAACAGC
Sequence-based reagent OL-GFP-fwd this study PCR primers AGCAAAGGAGAAGAACTTTTC
Sequence-based reagent OL-GFP-rev this study PCR primers GGATCCTTTGTAGAGCTCATCC
Sequence-based reagent OL -mCherry fwd this study PCR primers GTTTCCAAAGGGGAAGAGGACA
Sequence-based reagent pKT25-for this study PCR primers CACTGACGGCGGATATCGACATGTT
Sequence-based reagent pKT25-rev this study PCR primers CCGCCGGACATCAGCGCCATTC
Sequence-based reagent pUT18-for this study PCR primers CCAGGCTTTACACTTTATGCTTCC
Sequence-based reagent pUT18-rev this study PCR primers GACGCGCCTCGGTGCCCACTGC
Sequence-based reagent pKNT25-for this study PCR primers CCCAGGCTTTACACTTTATGCTTCC
Sequence-based reagent pKNT25-rev this study PCR primers GTTTTTTTCCTTCGCCACGGCCTTG
Sequence-based reagent pUT18C-for this study PCR primers CGGCGTGCCGAGCGGACGTTCG
Sequence-based reagent pUT18C-rev this study PCR primers TCAGCGGGTGTTGGCGGGTGTC
Sequence-based reagent FlhF Seq_Primer fwd this study PCR primers GCCCACTTTGGATCAACACACT
Sequence-based reagent FlhF Seq_Primer rev this study PCR primers CGTGCTCACAAAACTCGATGAA
Sequence-based reagent EcoRV FliFG1 KO fwd this study PCR primers GCGAATTCGTGGATCCAGATGCCGAAAACTTGTGGCTGAAAA
Sequence-based reagent OL- FliFG1 KO rev this study PCR primers ATCGCCACCCCCGACAATCATTTCTGTGCTC
Sequence-based reagent OL- FliFG1 KO fwd this study PCR primers ATTGTCGGGGGTGGCGATGAGTTCCTCTAAT
Sequence-based reagent EcoRV FliFG1 KO rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCAACCTAATAGTCACTGCTTG
Sequence-based reagent OL-fipA L118A rev this study PCR primers AGCTTCAGCTTTGGGCGCTTCACA
Sequence-based reagent OL-fipA L118A fwd this study PCR primers ATAAAAGAGTGTGAAGCGCCCAAA
Sequence-based reagent OL-fipA G106A rev this study PCR primers TTCATCGACTCCCGCGGCAAGTCC
Sequence-based reagent OL-fipA G106A fwd this study PCR primers AAAATGGTCGGACTTGCCGCGGGA
Sequence-based reagent OL-PPfipA G104A rev this study PCR primers CATCGATACTCGCAGCCATCCC
Sequence-based reagent OL-PPfipA G104A fwd this study PCR primers GCTGGTGGGGATGGCTGCGAGT
Sequence-based reagent OL-PPfipA L123A rev this study PCR primers ACACCTTGCTCATCGCCTCCGC
Sequence-based reagent OL-PPfipA L123A fwd this study PCR primers GGCCGAGGCGGAGGCGATGAGC
Sequence-based reagent EcoRV-flhF KO-fwd this study PCR primers GCCAAGCTTCTCTGCAGGATGCATAGGCGTCGGTGATTGAGG
Sequence-based reagent OL-flhF KO-rev this study PCR primers TAAGTGAAGGCATTTGAGTAGAGTTATGACCCTGG
Sequence-based reagent OL-flhF KO-fwd this study PCR primers CTCAAATGCCTTCACTATGCGTCCTCTACTGG
Sequence-based reagent EcoRV-flhF KO-rev this study PCR primers GCGAATTCGTGGATCCAGATGCTAAGCATTCTCCTAAGCTTGTTG
Sequence-based reagent OL-fipA L125A rev this study PCR primers TAACCGGATCAAGGCTTCAGCTTC
Sequence-based reagent OL-fipA L125A fwd this study PCR primers GCTGAAGCTGAAGCCTTGATCCGG
Sequence-based reagent EcoRV FlhF sub rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCTCGTCACATACAACGACTAG
Sequence-based reagent BACTH 2550 L125A pkT25 rev this study PCR primers TTAGTTACTTAGGTACCCGGGGTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagent BACTH 2550 L125A rev this study PCR primers GAGCTCGGTACCCGGGGTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagent OL-FipA L125A-GFP-rev this study PCR primers GAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagent BACTH FlhF pkT25 fwd this study PCR primers CAGGGTCGACTCTAGAGAAGATTAAACGATTTTTTGCCAAAGACA
Sequence-based reagent BACTH FlhF pkT25 rev this study PCR primers TTAGTTACTTAGGTACCCGGGGCTCAAATGCACAGGCCATATTATCT
Sequence-based reagent BACTH FlhF fwd this study PCR primers CTGCAGGTCGACTCTAGAGAAGATTAAACGATTTTTTGCCAAAGACA
Sequence-based reagent BACTH FlhF rev this study PCR primers GAGCTCGGTACCCGGGGCTCAAATGCACAGGCCATATTATCT
Sequence-based reagent BACTH FlhF GTG fwd this study PCR primers CTGCAGGTCGACTCTAGAGGTGAAGATTAAACGATTTTTTGCCAAAG
Sequence-based reagent EcoRV_FipA KO fwd this study PCR primers GCGAATTCGTGGATCCAGATTTTTAGGTATCATTAACTTACGTGGTAATGT
Sequence-based reagent OL-FipA KO rev this study PCR primers ACACTTCGCTATTTACGATGATCGCCCATTAAAAATCCTTATGCA
Sequence-based reagent OL-FipA KO fwd this study PCR primers AAGGATTTTTAATGGGCGATCATCGTAAATAGCGAAGTGTAGGG
Sequence-based reagent EcoRV-FipA KO rev this study PCR primers GCCAAGCTTCTCTGCAGGATGAACTGATCGCCTTTGTTTATATGC
Sequence-based reagent Check-FipA KO fwd this study PCR primers AAGAAATGTCGCAGCCGTAGC
Sequence-based reagent Check-FipA KO rev this study PCR primers CCAGTTGCGACAATCTTCGGAG
Sequence-based reagent OL-PPfipA L116A rev this study PCR primers CATCAACTCCGCCTCGGCCTGGGTCGCGCCGCAGCTCTGGGT
Sequence-based reagent OL-PPfipA L1164A fwd this study PCR primers GAGTTGACCCAGAGCTGCGGCGCGACCCAGGCCGAGGCG
Sequence-based reagent Check-PP_4331 (FipA) fwd this study PCR primers GCTTACGAACAGAACGCAAGGC
Sequence-based reagent Check-PP_4331 (FipA) rev this study PCR primers GCAATACGTGATTTCGGTGCAG
Sequence-based reagent EcoRV-PP_4331 KO-fwd this study PCR primers GCGAATTCGTGGATCCAGATGCAGATGCACGCCAAACAGAAA
Sequence-based reagent PP_4331 KO-OL-rev this study PCR primers TCAAGGAGCTAGGATCAACTCAGATGTTCTCCAGC
Sequence-based reagent PP_4331KO-OL-fwd this study PCR primers TTGATCCTAGCTCCTTGACGGGGTACCCTCG
Sequence-based reagent EcoRV-PP_4331 KO-rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCATGAATTGCCTGTACAACACCA
Sequence-based reagent Check-PP_4331KO-fwd this study PCR primers GCGAAACGATCGATCAGGTCGA
Sequence-based reagent Check-PP_4331KO-rev this study PCR primers GCACCGTAATCGAACACATGTG
Sequence-based reagent EcoRV-PP_4331-GFP-fwd this study PCR primers GCGAATTCGTGGATCCAGATGCAGATGCACGCCAAACAGAAA
Sequence-based reagent PP_4331-GFP-OL-rev this study PCR primers GAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCAGGAGCCCGGTACACCTTGCTC
Sequence-based reagent PP_43310-GFP-OL-fwd this study PCR primers GGATGAGCTCTACAAAGGATCCTGACGGGGTACCCTCGGCAGCA
Sequence-based reagent EcoRV-PP_4331-GFP-rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCATGAATTGCCTGTACAACACCA
Sequence-based reagent EcoRV-FlhF-mCh-fwd this study PCR primers GCGAATTCGTGGATCCAGATGCATGGACAGCTTCCGTATCGG
Sequence-based reagent FlhF-mCh-OL-rev this study PCR primers CTCTTCCCCTTTGGAAACGCTGCCACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagent FlhF-mCh-OL-fwd this study PCR primers ATGGATGAGTTATACAAATGACCATGAAGCGTGTGCAAAG
Sequence-based reagent EcoRV-FlhF-mCh-rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCCAACACACGGAAACGGTTCA
Sequence-based reagent Check-PP_4343 KO-fwd this study PCR primers GCCTGAAATCGAGCCGATCGAA
Sequence-based reagent Check-PP_4343 KO-rev this study PCR primers GCGTCGGTAATCGAGGTAGGTT
Sequence-based reagent BACTH PP FipA pkT25 fwd this study PCR primers CAGGGTCGACTCTAGAGATCCTAGAGGTTGCTGTCATCT
Sequence-based reagent BACTH PP FipA pkT25 rev this study PCR primers TTAGTTACTTAGGTACCCGGGGAGGAGCCCGGTACACCTTGCTC
Sequence-based reagent BACTH PP FipA fwd this study PCR primers CTGCAGGTCGACTCTAGAGATCCTAGAGGTTGCTGTCATCT
Sequence-based reagent BACTH PP FipA rev this study PCR primers GAGCTCGGTACCCGGGGAGGAGCCCGGTACACCTTGCTC
Sequence-based reagent BACTH PP FlhF pkT25 fwd this study PCR primers CAGGGTCGACTCTAGAGCAAGTTAAGCGATTTTTCGCCGC
Sequence-based reagent BACTH PP FlhF pkT25 rev this study PCR primers TTAGTTACTTAGGTACCCGGGGACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagent BACTH PP FlhF fwd this study PCR primers CTGCAGGTCGACTCTAGAGCAAGTTAAGCGATTTTTCGCCGC
Sequence-based reagent BACTH PP FlhF rev this study PCR primers GAGCTCGGTACCCGGGGACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagent EcoRV FlhF sub fwd this study PCR primers GCGAATTCGTGGATCCAGATGCATCAGTCAATGCAAGCAACC
Sequence-based reagent Check-FlhF KI/O-fwd this study PCR primers GCCACTGGGTAGTGTCGTAAAA
Sequence-based reagent OL-FlhF D328A rev this study PCR primers CCCCATACCAGCGGTGGCTATCAATAC
Sequence-based reagent OL-FlhF D328A fwd this study PCR primers AAGCTAGTATTGATAGCCACCGCTGGT
Sequence-based reagent EcoRV PPFlhF sub fwd this study PCR primers GCGAATTCGTGGATCCAGATGCATGTTCTGGCGTATCAGGAA
Sequence-based reagent OL-FlhF K235A rev this study PCR primers GCGCGCGGCCAGCGCGGCCAGGGT
Sequence-based reagent OL-FlhF K235A fwd this study PCR primers GGCAAGACCACCACCCTGGCCGCGCTGGCCGCG
Sequence-based reagent EcoRV PPFlhF sub rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCATGCTACCCATGTCTGTTCT
Sequence-based reagent Check-PP_4343 KI-fwd this study PCR primers GCTACCAGTGATTACCCTGGAG
Sequence-based reagent EcoRV PPFlhF sub 1 rev this study PCR primers GCCAAGCTTCTCTGCAGGATGCGTCGGTAATCGAGGTAGGTT
Sequence-based reagent KT2440 FlhF Seq primer rev this study PCR primers GCTGGTGAGCATGGACAGCTTC
Sequence-based reagent EcoRV-FipA dTM fwd this study PCR primers GCGAATTCGTGGATCCAGATGCCGTAGCTGCAAGTAAAGATG
Sequence-based reagent OL-FipA dTM rev this study PCR primers CTGCTTTTGTTCATCGCCCATTAAAAATCCTTATGC
Sequence-based reagent OL-FipA dTM fwd this study PCR primers GGCGATGAACAAAAGCAGTTGAGTAAATTACGTAATAAAGTTG
Sequence-based reagent OL-PP_FipA dTM rev this study PCR primers GCTGTAGTTCTCTAGGAT
CAACTCAGATGTTCTCC
Sequence-based reagent OL-PP_FipA dTM fwd this study PCR primers ATCCTAGAGAACTACAGCAAGCGCCAGCGCG
Software, algorithm cellProfiles (R package) Cameron et al., 2014; Cameron, 2018 https://github.com/ta-cameron/Cell-Profiles
Software, algorithm MicrobeJ Ducret et al., 2016

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Erick E Arroyo-Pérez, Email: erick.arroyo.perez@umontreal.ca.

Kai Thormann, Email: Kai.Thormann@mikro.bio.uni-giessen.de.

Karine A Gibbs, University of California, Berkeley, United States.

Dominique Soldati-Favre, University of Geneva, Switzerland.

Funding Information

This paper was supported by the following grants:

  • Max-Planck-Gesellschaft to Erick E Arroyo-Pérez, Alejandra Alvarado, Stephan Wimmi, Timo Glatter, Simon Ringgaard.

  • Deutsche Forschungsgemeinschaft TRR 174-P12 to John C Hook, Kai Thormann.

  • Ludwig-Maximilians-Universität München to Simon Ringgaard.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing.

Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing.

Data curation, Validation, Investigation, Methodology, Writing – review and editing.

Investigation, Methodology, Writing – review and editing.

Data curation, Formal analysis, Validation, Investigation, Methodology.

Conceptualization, Supervision, Funding acquisition, Investigation, Writing – original draft, Project administration, Writing – review and editing.

Conceptualization, Funding acquisition, Validation, Investigation, Visualization, Writing – original draft, Project administration, Writing – review and editing.

Additional files

Supplementary file 1. Supplementary tables.

(a) Enriched proteins in Co-IP FlhF-sfGFP vs. sfGFP. The genes with the largest enrichment in FlhF-sfGFP vs. sfGFP are shown. The corresponding protein designation is indicated if available. (b) Flagellation pattern and presence of FipA and FlhF in bacteria. (c) Bacterial strains used in this study. (d) Plasmids used in this study. (e) Oligonucleotides used in this study.

elife-93004-supp1.docx (88.1KB, docx)
MDAR checklist
Source data 1. Contains the data used for generation of the indicated figure panels.
elife-93004-data1.xlsx (51.6KB, xlsx)

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Ainsaar K, Tamman H, Kasvandik S, Tenson T, Hõrak R. The TonBm-PocAB system is required for maintenance of membrane integrity and polar position of flagella in Pseudomonas putida. Journal of Bacteriology. 2019;201:e00303-19. doi: 10.1128/JB.00303-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arroyo-Pérez EE, Ringgaard S. Interdependent polar localization of flhf and flhg and their importance for flagellum formation of vibrio parahaemolyticus. Frontiers in Microbiology. 2021;12:655239. doi: 10.3389/fmicb.2021.655239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Banerjee P, Raghav S, Goswami HN, Jain D. The antiactivator FleN uses an allosteric mechanism to regulate σ54-dependent expression of flagellar genes in Pseudomonas aeruginosa. Science Advances. 2021;7:eabj1792. doi: 10.1126/sciadv.abj1792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bange G, Petzold G, Wild K, Parlitz RO, Sinning I. The crystal structure of the third signal-recognition particle GTPase FlhF reveals a homodimer with bound GTP. PNAS. 2007;104:13621–13625. doi: 10.1073/pnas.0702570104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Blagotinsek V, Schwan M, Steinchen W, Mrusek D, Hook JC, Rossmann F, Freibert SA, Kratzat H, Murat G, Kressler D, Beckmann R, Beeby M, Thormann KM, Bange G. An ATP-dependent partner switch links flagellar C-ring assembly with gene expression. PNAS. 2020;117:20826–20835. doi: 10.1073/pnas.2006470117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cameron TA, Anderson-Furgeson J, Zupan JR, Zik JJ, Zambryski PC. Peptidoglycan synthesis machinery in Agrobacterium tumefaciens during unipolar growth and cell division. mBio. 2014;5:e01219-14. doi: 10.1128/mBio.01219-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cameron T. Cell profiles. v3.0Github. 2018 https://github.com/ta-cameron/Cell-Profiles
  8. Campos-García J, Nájera R, Camarena L, Soberón-Chávez G. The Pseudomonas aeruginosa motR gene involved in regulation of bacterial motility. FEMS Microbiology Letters. 2000;184:57–62. doi: 10.1111/j.1574-6968.2000.tb08990.x. [DOI] [PubMed] [Google Scholar]
  9. Chen M, Zhao Z, Yang J, Peng K, Baker MA, Bai F, Lo CJ. Length-dependent flagellar growth of Vibrio alginolyticus revealed by real time fluorescent imaging. eLife. 2017;6:e22140. doi: 10.7554/eLife.22140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chevance FFV, Hughes KT. Coordinating assembly of a bacterial macromolecular machine. Nature Reviews. Microbiology. 2008;6:455–465. doi: 10.1038/nrmicro1887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Coil DA, Anné J. The role of fimV and the importance of its tandem repeat copy number in twitching motility, pigment production, and morphology in Legionella pneumophila. Archives of Microbiology. 2010;192:625–631. doi: 10.1007/s00203-010-0590-8. [DOI] [PubMed] [Google Scholar]
  12. Correa NE, Peng F, Klose KE. Roles of the regulatory proteins FlhF and FlhG in the Vibrio cholerae flagellar transcription hierarchy. Journal of Bacteriology. 2005;187:6324–6332. doi: 10.1128/JB.187.18.6324-6332.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dasgupta N, Ramphal R. Interaction of the antiactivator FleN with the transcriptional activator FleQ regulates flagellar number in Pseudomonas aeruginosa. Journal of Bacteriology. 2001;183:6636–6644. doi: 10.1128/JB.183.22.6636-6644.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Donnenberg MS, Kaper JB. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infection and Immunity. 1991;59:4310–4317. doi: 10.1128/iai.59.12.4310-4317.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dornes A, Schmidt LM, Mais CN, Hook JC, Pané-Farré J, Kressler D, Thormann KM, Bange G. Polar confinement of a macromolecular machine by an SRP-type GTPase. Nature Communications. 2024;15:50274-4. doi: 10.1038/s41467-024-50274-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ducret A, Quardokus EM, Brun YV. MicrobeJ, a tool for high throughput bacterial cell detection and quantitative analysis. Nature Microbiology. 2016;1:16077. doi: 10.1038/nmicrobiol.2016.77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fogel MA, Waldor MK. A dynamic, mitotic-like mechanism for bacterial chromosome segregation. Genes & Development. 2006;20:3269–3282. doi: 10.1101/gad.1496506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Francis NR, Sosinsky GE, Thomas D, DeRosier DJ. Isolation, characterization and structure of bacterial flagellar motors containing the switch complex. Journal of Molecular Biology. 1994;235:1261–1270. doi: 10.1006/jmbi.1994.1079. [DOI] [PubMed] [Google Scholar]
  19. Fredrickson JK, Zachara JM, Kennedy DW, Dong H, Onstott TC, Hinman NW, Li S. Biogenic iron mineralization accompanying the dissimilatory reduction of hydrous ferric oxide by a groundwater bacterium. Geochimica et Cosmochimica Acta. 1998;62:3239–3257. doi: 10.1016/S0016-7037(98)00243-9. [DOI] [Google Scholar]
  20. Gao T, Shi M, Ju L, Gao H. Investigation into FlhFG reveals distinct features of FlhF in regulating flagellum polarity in Shewanella oneidensis. Molecular Microbiology. 2015;98:571–585. doi: 10.1111/mmi.13141. [DOI] [PubMed] [Google Scholar]
  21. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, III, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 2009;6:343–345. doi: 10.1038/nmeth.1318. [DOI] [PubMed] [Google Scholar]
  22. Green JCD, Kahramanoglou C, Rahman A, Pender AMC, Charbonnel N, Fraser GM. Recruitment of the earliest component of the bacterial flagellum to the old cell division pole by a membrane-associated signal recognition particle family GTP-binding protein. Journal of Molecular Biology. 2009;391:679–690. doi: 10.1016/j.jmb.2009.05.075. [DOI] [PubMed] [Google Scholar]
  23. Heering J, Ringgaard S. Differential localization of chemotactic signaling arrays during the lifecycle of Vibrio parahaemolyticus. Frontiers in Microbiology. 2016;7:1767. doi: 10.3389/fmicb.2016.01767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Heering J, Alvarado A, Ringgaard S. Induction of cellular differentiation and single cell imaging of vibrio parahaemolyticus swimmer and swarmer cells. Journal of Visualized Experiments. 2017;e55842:55842. doi: 10.3791/55842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hendrixson DR, DiRita VJ. Transcription of sigma54-dependent but not sigma28-dependent flagellar genes in Campylobacter jejuni is associated with formation of the flagellar secretory apparatus. Molecular Microbiology. 2003;50:687–702. doi: 10.1046/j.1365-2958.2003.03731.x. [DOI] [PubMed] [Google Scholar]
  26. Hintsche M, Waljor V, Großmann R, Kühn MJ, Thormann KM, Peruani F, Beta C. A polar bundle of flagella can drive bacterial swimming by pushing, pulling, or coiling around the cell body. Scientific Reports. 2017;7:16771. doi: 10.1038/s41598-017-16428-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Homma M, Aizawa S, Dean GE, Macnab RM. Identification of the M-ring protein of the flagellar motor of Salmonella typhimurium. PNAS. 1987;84:7483–7487. doi: 10.1073/pnas.84.21.7483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hook JC, Blagotinsek V, Pané-Farré J, Mrusek D, Altegoer F, Dornes A, Schwan M, Schier L, Thormann KM, Bange G. A proline-rich element in the type III secretion protein flhb contributes to flagellar biogenesis in the beta- and gamma-proteobacteria. Frontiers in Microbiology. 2020;11:564161. doi: 10.3389/fmicb.2020.564161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Iyer SC, Casas-Pastor D, Kraus D, Mann P, Schirner K, Glatter T, Fritz G, Ringgaard S. Transcriptional regulation by σ factor phosphorylation in bacteria. Nature Microbiology. 2020;5:395–406. doi: 10.1038/s41564-019-0648-6. [DOI] [PubMed] [Google Scholar]
  30. Karimova G, Pidoux J, Ullmann A, Ladant D. A bacterial two-hybrid system based on A reconstituted signal transduction pathway. PNAS. 1998;95:5752–5756. doi: 10.1073/pnas.95.10.5752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Karimova G, Robichon C, Ladant D. Characterization of YmgF, a 72-residue inner membrane protein that associates with the Escherichia coli cell division machinery. Journal of Bacteriology. 2009;191:333–346. doi: 10.1128/JB.00331-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kazmierczak BI, Hendrixson DR. Spatial and numerical regulation of flagellar biosynthesis in polarly flagellated bacteria. Molecular Microbiology. 2013;88:655–663. doi: 10.1111/mmi.12221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kim YK, McCarter LL. Analysis of the polar flagellar gene system of Vibrio parahaemolyticus. Journal of Bacteriology. 2000;182:3693–3704. doi: 10.1128/JB.182.13.3693-3704.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kojima S, Terashima H, Homma M. Regulation of the single polar flagellar biogenesis. Biomolecules. 2020;10:533. doi: 10.3390/biom10040533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kondo S, Homma M, Kojima S. Analysis of the GTPase motif of FlhF in the control of the number and location of polar flagella in Vibrio alginolyticus. Biophysics and Physicobiology. 2017;14:173–181. doi: 10.2142/biophysico.14.0_173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kondo S, Imura Y, Mizuno A, Homma M, Kojima S. Biochemical analysis of GTPase FlhF which controls the number and position of flagellar formation in marine Vibrio. Scientific Reports. 2018;8:12115. doi: 10.1038/s41598-018-30531-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kühn MJ, Schmidt FK, Eckhardt B, Thormann KM. Bacteria exploit a polymorphic instability of the flagellar filament to escape from traps. PNAS. 2017;114:6340–6345. doi: 10.1073/pnas.1701644114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kusumoto A, Kamisaka K, Yakushi T, Terashima H, Shinohara A, Homma M. Regulation of polar flagellar number by the flhF and flhG genes in Vibrio alginolyticus. Journal of Biochemistry. 2006;139:113–121. doi: 10.1093/jb/mvj010. [DOI] [PubMed] [Google Scholar]
  39. Kusumoto A, Nishioka N, Kojima S, Homma M. Mutational analysis of the GTP-binding motif of FlhF which regulates the number and placement of the polar flagellum in Vibrio alginolyticus. Journal of Biochemistry. 2009;146:643–650. doi: 10.1093/jb/mvp109. [DOI] [PubMed] [Google Scholar]
  40. Lassak J, Henche AL, Binnenkade L, Thormann KM. ArcS, the cognate sensor kinase in an atypical arc system of Shewanella oneidensis MR-1. Applied and Environmental Microbiology. 2010;76:3263–3274. doi: 10.1128/AEM.00512-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Macnab RM. How bacteria assemble flagella. Annual Review of Microbiology. 2003;57:77–100. doi: 10.1146/annurev.micro.57.030502.090832. [DOI] [PubMed] [Google Scholar]
  42. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K, Iijima Y, Najima M, Nakano M, Yamashita A, Kubota Y, Kimura S, Yasunaga T, Honda T, Shinagawa H, Hattori M, Iida T. Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V cholerae. The Lancet. 2003;361:743–749. doi: 10.1016/S0140-6736(03)12659-1. [DOI] [PubMed] [Google Scholar]
  43. McCarter LL. Genetic and molecular characterization of the polar flagellum of Vibrio parahaemolyticus. Journal of Bacteriology. 1995;177:1595–1609. doi: 10.1128/jb.177.6.1595-1609.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. Journal of Bacteriology. 1988;170:2575–2583. doi: 10.1128/jb.170.6.2575-2583.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. Flagellin A is essential for the virulence of Vibrio anguillarum. Journal of Bacteriology. 1996;178:1310–1319. doi: 10.1128/jb.178.5.1310-1319.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Minamino T. Protein export through the bacterial flagellar type III export pathway. Biochimica et Biophysica Acta. 2014;1843:1642–1648. doi: 10.1016/j.bbamcr.2013.09.005. [DOI] [PubMed] [Google Scholar]
  47. Moisi M, Jenul C, Butler SM, New A, Tutz S, Reidl J, Klose KE, Camilli A, Schild S. A novel regulatory protein involved in motility of Vibrio cholerae. Journal of Bacteriology. 2009;191:7027–7038. doi: 10.1128/JB.00948-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Muraleedharan S, Freitas C, Mann P, Glatter T, Ringgaard S. A cell length-dependent transition in MinD-dynamics promotes A switch in division-site placement and preservation of proliferating elongated Vibrio parahaemolyticus swarmer cells. Molecular Microbiology. 2018;109:365–384. doi: 10.1111/mmi.13996. [DOI] [PubMed] [Google Scholar]
  49. Murray TS, Kazmierczak BI. FlhF is required for swimming and swarming in Pseudomonas aeruginosa. Journal of Bacteriology. 2006;188:6995–7004. doi: 10.1128/JB.00790-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Navarrete B, Leal-Morales A, Serrano-Ron L, Sarrió M, Jiménez-Fernández A, Jiménez-Díaz L, López-Sánchez A, Govantes F. Transcriptional organization, regulation and functional analysis of flhF and fleN in Pseudomonas putida. PLOS ONE. 2019;14:e0214166. doi: 10.1371/journal.pone.0214166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Nelson KE, Weinel C, Paulsen IT, Dodson RJ, Hilbert H, Martins dos Santos VAP, Fouts DE, Gill SR, Pop M, Holmes M, Brinkac L, Beanan M, DeBoy RT, Daugherty S, Kolonay J, Madupu R, Nelson W, White O, Peterson J, Khouri H, Hance I, Chris Lee P, Holtzapple E, Scanlan D, Tran K, Moazzez A, Utterback T, Rizzo M, Lee K, Kosack D, Moestl D, Wedler H, Lauber J, Stjepandic D, Hoheisel J, Straetz M, Heim S, Kiewitz C, Eisen JA, Timmis KN, Düsterhöft A, Tümmler B, Fraser CM. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environmental Microbiology. 2002;4:799–808. doi: 10.1046/j.1462-2920.2002.00366.x. [DOI] [PubMed] [Google Scholar]
  52. Pandza S, Baetens M, Park CH, Au T, Keyhan M, Matin A. The G-protein FlhF has a role in polar flagellar placement and general stress response induction in Pseudomonas putida. Molecular Microbiology. 2000;36:414–423. doi: 10.1046/j.1365-2958.2000.01859.x. [DOI] [PubMed] [Google Scholar]
  53. Parte AC, Sardà Carbasse J, Meier-Kolthoff JP, Reimer LC, Göker M. List of Prokaryotic names with Standing in Nomenclature (LPSN) moves to the DSMZ. International Journal of Systematic and Evolutionary Microbiology. 2020;70:5607–5612. doi: 10.1099/ijsem.0.004332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Petersen BD, Liu MS, Podicheti R, Yang AY-P, Simpson CA, Hemmerich C, Rusch DB, van Kessel JC. The polar flagellar transcriptional regulatory network in Vibrio campbellii deviates from canonical Vibrio species. Journal of Bacteriology. 2021;203:e0027621. doi: 10.1128/JB.00276-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Ringgaard S, Schirner K, Davis BM, Waldor MK. A family of ParA-like ATPases promotes cell pole maturation by facilitating polar localization of chemotaxis proteins. Genes & Development. 2011;25:1544–1555. doi: 10.1101/gad.2061811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Ringgaard S, Zepeda-Rivera M, Wu X, Schirner K, Davis BM, Waldor MK. ParP prevents dissociation of CheA from chemotactic signaling arrays and tethers them to a polar anchor. PNAS. 2014;111:E255–E264. doi: 10.1073/pnas.1315722111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Rossmann F, Brenzinger S, Knauer C, Dörrich AK, Bubendorfer S, Ruppert U, Bange G, Thormann KM. The role of FlhF and HubP as polar landmark proteins in Shewanella putrefaciens CN-32. Molecular Microbiology. 2015;98:727–742. doi: 10.1111/mmi.13152. [DOI] [PubMed] [Google Scholar]
  58. Rossmann FM, Rick T, Mrusek D, Sprankel L, Dörrich AK, Leonhard T, Bubendorfer S, Kaever V, Bange G, Thormann KM. The GGDEF domain of the phosphodiesterase PdeB in Shewanella putrefaciens Mediates Recruitment by the Polar Landmark Protein HubP. Journal of Bacteriology. 2019;201:e00534. doi: 10.1128/JB.00534-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Schuhmacher JS, Rossmann F, Dempwolff F, Knauer C, Altegoer F, Steinchen W, Dörrich AK, Klingl A, Stephan M, Linne U, Thormann KM, Bange G. MinD-like ATPase FlhG effects location and number of bacterial flagella during C-ring assembly. PNAS. 2015a;112:3092–3097. doi: 10.1073/pnas.1419388112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Schuhmacher JS, Thormann KM, Bange G. How bacteria maintain location and number of flagella? FEMS Microbiology Reviews. 2015b;39:812–822. doi: 10.1093/femsre/fuv034. [DOI] [PubMed] [Google Scholar]
  61. Schwan M, Khaledi A, Willger S, Papenfort K, Glatter T, Häußler S, Thormann KM. FlrA-independent production of flagellar proteins is required for proper flagellation in Shewanella putrefaciens. Molecular Microbiology. 2022;118:670–682. doi: 10.1111/mmi.14993. [DOI] [PubMed] [Google Scholar]
  62. Simon R, Priefer U, Pühler A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Bio/Technology. 1983;1:784–791. doi: 10.1038/nbt1183-784. [DOI] [Google Scholar]
  63. Takekawa N, Kwon S, Nishioka N, Kojima S, Homma M. HubP, a polar landmark protein, regulates flagellar number by assisting in the proper polar localization of FlhG in Vibrio alginolyticus. Journal of Bacteriology. 2016;198:3091–3098. doi: 10.1128/JB.00462-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Turriziani B, Garcia-Munoz A, Pilkington R, Raso C, Kolch W, von Kriegsheim A. On-beads digestion in conjunction with data-dependent mass spectrometry: A shortcut to quantitative and dynamic interaction proteomics. Biology. 2014;3:320–332. doi: 10.3390/biology3020320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Ueno T, Oosawa K, Aizawa S. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. Journal of Molecular Biology. 1992;227:672–677. doi: 10.1016/0022-2836(92)90216-7. [DOI] [PubMed] [Google Scholar]
  66. Wehbi H, Portillo E, Harvey H, Shimkoff AE, Scheurwater EM, Howell PL, Burrows LL. The peptidoglycan-binding protein FimV promotes assembly of the Pseudomonas aeruginosa type IV pilus secretin. Journal of Bacteriology. 2011;193:540–550. doi: 10.1128/JB.01048-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yamaichi Y, Bruckner R, Ringgaard S, Möll A, Cameron DE, Briegel A, Jensen GJ, Davis BM, Waldor MK. A multidomain hub anchors the chromosome segregation and chemotactic machinery to the bacterial pole. Genes & Development. 2012;26:2348–2360. doi: 10.1101/gad.199869.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang K, He J, Cantalano C, Guo Y, Liu J, Li C. FlhF regulates the number and configuration of periplasmic flagella in Borrelia burgdorferi. Molecular Microbiology. 2020;113:1122–1139. doi: 10.1111/mmi.14482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zheng L, Baumann U, Reymond JL. An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Research. 2004;32:e115. doi: 10.1093/nar/gnh110. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife assessment

Karine A Gibbs 1

This important study describes the discovery of a mechanism by which multiple species of bacteria synthesize and localize polar flagella via a novel protein, FipA, which interacts with FlhF. The authors use appropriate methodological approaches (biochemistry, molecular microbiology, quantitative microscopy, and bacterial genetics) to obtain and present convincing results and interpretations. This work will particularly interest those studying bacterial motility and bacterial cell biologists.

Reviewer #1 (Public review):

Anonymous

Summary:

Bacteria exhibit species-specific numbers and localization patterns of flagella. How specificity in number and pattern is achieved is poorly understood but often depends on a soluble GTPase called FlhF. Here the authors take an unbiased protein-pulldown approach to identify a protein FipA in V. parahaemolyticus that interacts with FlhF. They show that FipA co-occurs with FlhF in the genomes of bacteria with polarly-localized flagella and study the role of FipA in three different bacteria: V. parahaemolyticus, S. purtefaciens, and P. putida. In each case, they show that FipA contributes to FlhF polar localization, flagellar assembly, flagellar patterning, and motility to different species-specific extents.

Strengths:

The authors perform a comprehensive analysis of FipA, including phenotyping of mutants, protein localization, localization dependence, and domains of FipA necessary for each. Moreover, they perform a time-series analysis indicating that FipA localizes to the cell pole likely prior to, or at least coincident with, flagellar assembly. They also show that the role of FipA appears to differ between organisms in detail but the overarching idea that it is a flagellar assembly/localization factor remains convincing.

Weaknesses:

For me the comparative analysis in the different organism was on balance, a weakness. By mixing the data for each of the organisms together, I found it difficult to read, and take away key points from the results. In its current form, the individual details seem to crowd out the model.

Reviewer #2 (Public review):

Anonymous

Summary:

The authors identify a novel protein, FipA, which facilitates recruitment of FlhF to the membrane at the cell pole together with the known recruitment factor HupB. This finding is key to understanding the mechanism of polar localization. By comparing the role of FipA in polar flagellum assembly in three different species from Vibrio, Shewanella and Pseudomonas, they discover that, while FipA is required in all three systems, evolution has brought different nuances that open avenues for further discoveries.

Strengths:

The discovery of a novel factor for polar flagellum development. A significant contribution to our understanding of flagellar evolution. The solid nature and flow of the experimental work.

Weaknesses:

All my concerns have been addressed. I find no weaknesses. A nice, solid piece of work.

Reviewer #3 (Public review):

Anonymous

Summary:

The authors investigate how polar flagellation is achieved in gamma-proteobacteria. By probing for proteins that interact with the known flagellar placement factor FlhF, they uncover a new regulator (FipA) for flagellar assembly and polar positioning in three flagellated gamma-proteobacteria. They convincingly demonstrate that FipA interacts genetically and biochemically with previously known spatial regulators HubP and FlhF. FipA is a membrane protein with a cytoplasmic DUF2802 and it co-localizes to the flagellated pole with HubP and FlhF. The DUF2802 mediates the interaction between FipA and FlhF and this interaction is required for FipA function. FipA localization depends on HubP and FlhF.

Strengths:

The work is throughly executed, relying on bacterial genetics, cell biology and protein interaction studies. The analysis is deep, beginning with the discovery af a new and conserved factor, to the molecular dissection of the protein and probing localisation and interaction determinants. Finally, they show that these determinants are important for function and they perform these studies in parallel in three model systems.

Weaknesses:

Because some of the phenotypes and localisation dependencies differ somewhat between model systems, the comparison is challenging to the reader because it is sometimes not obvious what these differences mean and why they arise.

eLife. 2024 Dec 5;13:RP93004. doi: 10.7554/eLife.93004.3.sa4

Author response

Erick E Arroyo-Pérez 1, John C Hook 2, Alejandra Alvarado 3, Stephan Wimmi 4, Timo Glatter 5, Kai Thormann 6, Simon Ringgaard 7

The following is the authors’ response to the original reviews.

eLife assessment

This important research uses an elegant combination of protein-protein biochemistry, genetics, and microscopy to demonstrate that the novel bacterial protein FipA is required for polar flagella synthesis and binds to FlhF in multiple bacterial species. This manuscript is convincing, providing evidence for the early stages of flagellar synthesis at a cell pole; however, the protein biochemistry is incomplete and would benefit from additional rigorous experiments. This paper could be of significant interest to microbiologists studying bacterial motility, appendages, and cellular biology.

We are very grateful for the very positive and helpful evaluation.

Joint Public Review:

Bacteria exhibit species-specific numbers and localization patterns of flagella. How specificity in number and pattern is achieved in Gamma-proteobacteria needs to be better understood but often depends on a soluble GTPase called FlhF. Here, the authors take an unbiased protein-pulldown approach with FlhF, resulting in identifying the protein FipA in V. parahaemolyticus. They convincingly demonstrate that FipA interacts genetically and biochemically with previously known spatial regulators HubP and FlhF. FipA is a membrane protein with a cytoplasmic DUF2802; it co-localizes to the flagellated pole with HubP and FlhF. The DUF2802 mediates the interaction between FipA and FlhF, and this interaction is required for FipA function. Altogether, the authors show that FipA likely facilitates the recruitment of FlhF to the membrane at the cell pole together with the known recruitment factor HupB. This finding is crucial in understanding the mechanism of polar localization. The authors show that FipA co-occurs with FlhF in the genomes of bacteria with polarly-localized flagella and study the role of FipA in three of these organisms: V. parahaemolyticus, S. purtefaciens, and P. putida. In each case, they show that FipA contributes to FlhF polar localization, flagellar assembly, flagellar patterning, and motility, though the details differ among the species. By comparing the role of FipA in polar flagellum assembly in three different species, they discover that, while FipA is required in all three systems, evolution has brought different nuances that open avenues for further discoveries.

Strengths:

The discovery of a novel factor for polar flagellum development. The solid nature and flow of the experimental work.

The authors perform a comprehensive analysis of FipA, including phenotyping of mutants, protein localization, localization dependence, and domains of FipA necessary for each. Moreover, they perform a time-series analysis indicating that FipA localizes to the cell pole likely before, or at least coincident with, flagellar assembly. They also show that the role of FipA appears to differ between organisms in detail, but the overarching idea that it is a flagellar assembly/localization factor remains convincing.

The work is well-executed, relying on bacterial genetics, cell biology, and protein interaction studies. The analysis is deep, beginning with discovering a new and conserved factor, then the molecular dissection of the protein, and finally, probing localization and interaction determinants. Finally, the authors show that these determinants are important for function; they perform these studies in parallel in three model systems.

Weaknesses:

The comparative analysis in the different organisms was on balance, a weakness. Mixing the data for the organisms together made the text difficult to read and took away key points from the results. The individual details crowded out the model in its current form. Indeed, because some of the phenotypes and localization dependencies differ between model systems, the comparison is challenging to the reader. The authors could more clearly state what these differences mean, why they arise, and (in the discussion) how they might relate to the organism's lifestyle.

More experiments would be needed to fully analyze the effects of interacting proteins on individual protein stability; this absence slightly detracted from the conclusions.

We have tried our best to improve the manuscript according to the insightful suggestions of the reviewers. Please find our answers to the raised issues below.

Reviewer #1 (Recommendations For The Authors):

We are very grateful to this reviewer for the very positive evaluation and the great suggestions to improve the manuscript.

I think there is value to the comparative analysis but how to present it in such a way that the key similarities and differences stand out is the challenge. Perhaps a table that compares the three datasets is sufficient. Or tell the story of V. parahaemolyticus first to establish the model, followed by comparative analysis of the other two organisms highlighting differences and relegating similarities to supplemental?

We agree that the our previous presentation of our comparative analysis made it very hard to follow the major findings and the general role(s) of FipA, and we are very grateful for the suggestions on how to improve this. We have decided to change the presentation as the reviewer recommended. We used V. parahaemolyticus as a ‚lead model‘ to describe the role of FipA, and we then compared the major findings to the other two species. We hope that the story is now easier to follow.

This is not something that needs to be addressed in the text but I wanted to bring the protein SwrB to the authors' attention which may further expand FipA relevance. Bacillus subtilis uses FlhFG to somehow pattern flagella in a peritrichous arrangement and there are a number of striking similarities, in my opinion, between FipA and SwrB. The two proteins have very similar domain architecture/topology, both proteins promote flagellar assembly, and the genetic neighborhood/operon organization is uncannily similar. There are other more minor similarities dependent on the organism in this paper.

Phillips, Kearns. 2021. Molecular and cell biological analysis of SwrB in Bacillus subtilis. J Bacteriol 203:e0022721

Phillips, Kearns. 2015. Functional activation of the flagellar type III secretion export apparatus. PLoS Genet 11:e1005443.

We thank this reviewer for pointing out these intriguing similarities. For this study we have decided to exclusively concentrate on polarly flagellated bacteria. FlhF und FlhG are also present in B. subtilis where they play a role in organizing flagellation, but we feel that this would be out of scope for this manuscript.

Reviewer #2 (Recommendations For The Authors):

We would like to thank this reviewer for the very positive evaluation and for pointing out several issues to strengthen the story.

Figure 3A data are problematic since everything is too small to visualize. Since these are functional GFP fusions (or mCherry for 2E data), why are they not presented in color?

Again - why are color figures not used to help the reader in Fig 4A and 5F & 5G to confirm what is asserted?

Again, it is difficult to see the images presented. It is asserted that FipA is recruited to the cell pole after cell division and before flagellum assembly, but one has to take their word for it.

We fully agree that in some case the localization pattern is hard to see on the micrographs presented. We have, therefore, provided enlarged micrographs in the supplemental part which allow to better see the fluorescent foci within the cells. With respect to presentations in color – we found that this did not improve the visibility of localizations and therefore have decided to use the grayscale images.

Here, what is missing are turnover assays. Do FipA, FlhF, and HubP all co-localize as complex or is the absence of one leading to the protein turnover of other partners? I think this needs to be sorted out before final conclusions can be made.

Thanks for pointing out this important point. We have now provided western analysis which demonstrate that FipA and FlhF are produced and stable in the absence of the other partners (see Supplemental Figure 5). Stability of HubP as a general polar marker not only required for flagellation was not determined.

Minor comments:

Line 58: change "around" to "in timing with"

Line 79: what "signal" is transferred from the C-ring to the MS-ring. Are they not fully connected such that rotation is the entire structure - C-ring-MS-ring-Rod-Hook-Filament. Is it not the change in the relationship to the stator complex where the signal is transferred?

Line 85: change "counting" to "control of flagellar numbers per cell"

Line 110: change "is (co-)responsible for recruiting" to "facilitates recruitment of"

Thanks for pointing this out. We have adjusted the wording according to the reviewer’s suggestions.

Given that motility phenotypes vary on individual plates (volumes and dryness vary), why in Figure 2C are the motility assays for fipA and flhF mutants of P. putida done on different plates?

For better visualisation, we have rearranged the spreading halos for the figure. All strain spreading comparisons on soft agar were always conducted on the same plate due to the reasons this reviewer mentioned.

Reviewer #3 (Recommendations For The Authors):

We thank this reviewer for the very positive evalution and the great suggestions.

One possibility is to describe first all the results relating to FipA in Vibrio and then add the result sections at the end to illustrate the differences between Vibrio and Shewanella, and then Vibrio and Pseudomonas. This may make it easier to follow for the reader.

We agree that the our previous presentation of our comparative analysis made it very hard to follow the major findings and the general role(s) of FipA, and we are very grateful for the suggestions on how to improve this. We have decided to change the presentation as the reviewer recommended. We used V. parahaemolyticus as a ‚lead model‘ to describe the role of FipA, and we then compared the major findings to the other two species. We hope that the story is now easier to follow.

I would have liked to see some TEM analysis of flagella in fipA/hubP double mutants strains and was also wondering if FipA/FlhF/HubP colocalization had been studied in E. coli when all proteins are expressed together, at least with two bearing fluorescent tags.

Thanks for these great suggestions. In this study, we have concentrated on the localization of FlhF by FipA and HubP. HubP has multiple functions in the cell and may also affect flagellar synthesis to some extent in a species-specific fashion. Therefore, any findings would have to be discussed very carefully, so we have decided to leave that out for the time being.

With respect to the FipA/HubP/FlhF production in a heterologous host such as E. coli, this has been partly done (without FipA) in a second parallel story (see reference to Dornes et al (2024) in this manuscript). Rebuilding larger parts of the system in a heterologous host is currently done in an independent study. Therefore, we have decided not to include this already here.

From the Reviewing Editor:

We are grateful for handling the fair reviewing process, for the positive evaluation and the helpful hints.

The microscopy was inconsistent (DIC versus phase) for unclear reasons. Did using different microscopes impact the ability to acquire low-intensity fluorescence signals? Please add a sentence in the Methods section to clarify.

We are sorry for this inconsistency. As the imaging was carried out by different labs (to some part before the projects were joined), the corresponding preferred microscopy settings were used. We have added an explaining sentence to the Methods section.

Also, some subcellular fluorescence localizations were not visible in the selected images (e.g., Figures 3 and 5). The reader had to rely on the authors' statements and analyses. The conclusions could be more robust with fluorescence measurements across the cell body for a subset of cells. The authors could provide this data analysis in the Supplemental; this measurement would more clearly show an accumulation of fluorescence at the cell pole, particularly in low-intensity images.

We fully agree that in some case the localization pattern is hard to see on the micrographs presented. Unfortunately, often the signal is not sufficiently strong to provied proper demographs. We have, therefore, provided enlarged micrographs in the supplemental part, which allow to better see the fluorescent foci within the cells.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 3—figure supplement 1—source data 1. Scans of the original western blots for Figure 3—figure supplement 1.
    Figure 3—figure supplement 1—source data 2. Scans of the original western blots for Figure 3—figure supplement 1 with labels.
    Figure 6—figure supplement 1—source data 1. Scans of the original western blots for Figure 6—figure supplement 1.
    Figure 6—figure supplement 1—source data 2. Scans of the original western blots for Figure 6—figure supplement 1 with labels.
    Supplementary file 1. Supplementary tables.

    (a) Enriched proteins in Co-IP FlhF-sfGFP vs. sfGFP. The genes with the largest enrichment in FlhF-sfGFP vs. sfGFP are shown. The corresponding protein designation is indicated if available. (b) Flagellation pattern and presence of FipA and FlhF in bacteria. (c) Bacterial strains used in this study. (d) Plasmids used in this study. (e) Oligonucleotides used in this study.

    elife-93004-supp1.docx (88.1KB, docx)
    MDAR checklist
    Source data 1. Contains the data used for generation of the indicated figure panels.
    elife-93004-data1.xlsx (51.6KB, xlsx)

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES