Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Nov 10;104(1):104542. doi: 10.1016/j.psj.2024.104542

Differences in central dopamine, but not serotonin, activity and welfare associated with age but not with preening cup use in commercial grow-out Pekin duck barns

MM Bergman a, JM Schober a, R Novak a, A Grief a, C Plue a, D Frey b, H Parnin b, GS Fraley a,⁎
PMCID: PMC11625317  PMID: 39580903

Abstract

Preening cups are a semi-open water source for Pekin duck enrichment. To evaluate the ducks’ affective state, we combined measuring welfare by walking a transect in the barn with mass spectrometry and qRT-PCR to measure brain neurotransmitter levels and gene expression for serotonin (5-HT) and dopamine (DA) synthesis and metabolism. 5-HT and DA have been established as indicators of mental state and emotions. We visited 4 standard commercial barns that housed approximately 6000–9000 ducks (one preening cup per 1500 ducks) and collected samples on d21 prior to preening cup placement, d28 one week after preening cup placement, and d35 one day prior to processing. Litter samples (n = 3/barn/day) were collected and transect walks were conducted to evaluate the welfare of the birds. Brain samples (n = 8/day/barn) were collected from two locations: ducks actively using the preening cups (PC) and ducks across the barn not actively using the preening cups (CON). The brains were hemisected and dissected in three brain areas: caudal mesencephalon (CM), rostral mesencephalon (RM), and diencephalon (DI). Litter samples showed no significant differences between collection dates. The transect showed significant differences in feather quality, feather cleanliness, and eye due to age, but not preening cups. The right hemisphere showed no differences in 5-HT turnover. For DA turnover, there are differences in CM (p < 0.05) and DI (p < 0.001) over time, but no differences between PC and CON. The left hemisphere measured TPH1, TPH2, and TH. CM and DI brain areas are not significantly different. Within the RM, there is a significant increase in TPH1 expression for ducks on d35 when compared to ducks on d28 and d21. These results suggest that 5-HT and DA do not differ due to duck location. However, DA activity increases as these ducks age. DA is an important neurotransmitter and activity increases as an animal grows allowing for behavioral development. Our data shows that commercial preening cups do not negatively impact ducks’ welfare or affective state.

Keywords: Open water source, Commercial, Enrichment, Poultry, Welfare

Introduction

Commercial Pekin duck barns may utilize preening cups as an environmental enrichment to increase welfare and improve affective state. Affective state is the mental and emotional state of an animal and is studied to improve the welfare of farm animals (Désiré et al., 2002; Jirkof et al., 2019). A positive affective state occurs when an animal has ability to express their Five Freedoms while being content with its surroundings (Muhammad et al., 2022). A negative affective state can be attributed to the animal's unfulfilled drive to perform natural behaviors that are not available to them in commercial housing (Dawkins, 1990). Without an outlet for these natural behaviors, animals tend to develop stereotypic or adverse behaviors that compromise their welfare. Understanding how an animal's mental state can influence their behavior may elicit the animals’ biological needs and what stimuli produce unwanted behaviors.

To satisfy the ducks’ need to express natural behaviors, humane certifications for duck producers from organizations that verify the humane treatment of farm animals require commercial rearing of Pekin ducks to add semi-open water sources to the barns that allow the animals to perform comfort and bathing behaviors like head dunking and wet preening (Karcher and Mench, 2018). Types of open water sources include water troughs, bell drinkers, preening cups, pekino cups, and misting showers (as reviewed by Makagon and Riber 2021). To assess the physical welfare of poultry, many studies utilize body condition scoring at an individual bird level or transect walks to evaluate thousands of birds at a commercial level. Parameters evaluated for ducks include gait, eye health, nostril health, feather condition (quality and cleanliness), and foot pad quality (presence of pododermatitis) (Karcher et al., 2013). There is a positive public perception associated with open water sources in duck barns and previous studies found that bell drinkers improved nostril health and feather quality but worsened foot pad quality (O'Driscoll and Broom, 2011). A breeder duck study found that water troughs decrease foot pad quality due to increased litter moisture (Lowman et al., 2016). Others have shown that water troughs have been correlated with decreased feather and foot pad quality as well as increased bacterial contamination and mortality (Schenk et al., 2016). Ducks are shown to alter their behaviors and physical condition due to their environment and types of enrichments at a commercial level (Jones and Dawkins, 2010), however exactly how these enrichments change behavior and welfare remain a controversy. Currently, semi-open water sources are recommended for commercial duck barns for American Humane welfare certification and are typically placed by industry partners at approximately 1000–2000 ducks per preening cup (authors, personal communication with stakeholders).

A previous study on preening cups by our lab found no differences in production values between ducks housed in pens with or without preening cups in an academic setting (Schober et al., 2023). On the other hand, Schober et al. (2023) observed an increase in aggressive feather pecking from ducks in pens with preening cups when compared to ducks with only nipple lines. We questioned how a duck's neurochemistry associated with affective state may be altered by preening cups placement. Differences in synaptic activity of serotonin (5-HT) and dopamine (DA) have been associated with aggressive behaviors such as feather pecking (Nelson and Chiavegatto, 2001; Nelson and Trainor, 2007; Dennis and Cheng, 2011). Duck brains from Schober et al. (2023) were evaluated for 5-HT and DA levels, their respective turnover, and for gene expression of their synthetic enzymes. We observed an increase in dopaminergic activity within duck brains placed with preening cups suggesting a negative affective state as ducks were observed aggressively defending the semi-open water resource (Bergman et al., 2024). However, that study was carried out in an academic setting with a relatively small number of ducks per preening cup. Thus, we wanted to better understand differences in brain neurotransmitter levels for ducks in a commercial setting before and after preening cup placement.

Our lab utilizes the combination of mass spectrometry and qRT-PCR to evaluate differences in 5-HT and DA anabolism and catabolism related to affective state. These neurotransmitter levels are applied to turnover equations to understand the activity of 5-HT and DA within the synapse. The neurotransmitter 5-HT is synthesized from tryptophan by the rate limiting enzyme, tryptophan hydroxylase, in the presynaptic neuron. Upon neuronal stimulation, 5-HT is released into the synapse to bind 5-HT1A and 5-HT1B receptors (Micheli et al., 2018). 5-HT can be metabolized into 5-hydroxyindoleacetic acid (5HIAA) after binding receptors, stored or catalyzed in glial cells, or transported back into the presynaptic neuron for catabolism or reuse (Kanova and Kohout, 2021). DA is synthesized by the enzyme tyrosine hydroxylase from the amino acid tyrosine. After interaction with its post-synaptic receptors (D1 and D2), it can be metabolized into 3-methoxytyramine (3-MT), homovanillic acid (HVA), and 3,4-dihydroxyphenylacetic acid (DOPAC) (Dennis and Cheng, 2011; Olguín et al., 2016). A ratio of metabolites to neurotransmitter (turnover) is used to understand the activity of 5-HT and DA within the synapse. This protocol has been recognized for decades to relate to emotional states, and affective states in mammals (Schildkraut and Kety, 1967; Morgan et al., 1975; Goodnick and Goldstein, 1998; Erp and Miczek, 2000; Alenina and Klempin, 2015; Micheli et al., 2018). These parameters have also been investigated in birds (Davison and Kuenzel, 1991; Hierden et al., 2002; Dennis and Cheng, 2011; Kops et al., 2013; Bergman et al., 2024). Further, synthetic enzyme relative mRNA levels can be assessed using qRT-PCR. Tryptophan hydroxylase (TPH1, TPH2) and tyrosine hydroxylase (TH) synthesize 5-HT and DA, respectively. Two gene isoforms, TPH1 and TPH2, have been demonstrated in humans, mice, and rat genomes (Walther and Bäder, 2003). TPH1 was discovered first and is known to be expressed in pineal gland and peripherally within thymus, spleen, and gut (Walther and Bäder, 2003). Mice deficient of TPH1 showed decreased levels of 5-HT in the gut, but 5-HT levels in the brain were not significantly altered (Walther et al., 2003). This suggested the presence of another gene encoding for tryptophan hydroxylase (TPH2) that is expressed centrally in brain stem (Walther et al., 2003). The differential distribution and expression of TPH1/TPH2 is unknown Pekin ducks, thus in our current study we measured both genes to broaden our understanding.

Our objective was to measure Pekin duck affective state at a commercial level associated with preening cup placement by evaluating brain neurotransmitters and environmental changes on welfare. We hypothesized that preening cup placement in a commercial barn will improve the ducks affective state as evidenced by transect welfare and an increase in central serotonergic activity but decrease in dopaminergic activity.

Materials and methods

Animals

Four commercial barns from Culver Duck Farms, Inc. (Middlebury, IN USA) were sampled over three age points (day 21, day 28, day 35); d21 represented the day preening cups were placed, and two additional days between placement and processing. Each industry standard curtain sided barn had a straight run of similar numbers of male and female ducks (6000–9000 per barn) that were raised for meat production. A nipple line spanned each barn over a slatted floor and pit that was separated from the litter floor by a slight ramp. Daily care and management of the ducks was conducted by contract growers chosen and monitored by Culver Duck Farms, Inc. Ducks received ad libitum feed and water from day of hatch to approximately d35 (Chen et al., 2021). The lighting inside of the barn followed industry standards of 18L:6D. Barns had an average of approximately 1500 ducks per preening cup (IMPEX Watering Solutions, Gainesville, GA) spaced evenly throughout the barn over the slatted waste pit flooring and set to a height that allows the ducks to submerge their heads, but not their bodies. Welfare certification requires the use of semi-open water sources in commercial barns thus we did not have access to barns without preening cups. Organizations that certify stakeholders for welfare standards do not permit barns without preening cup placement; using other stakeholders as controls would produce too many confounding factors due to differences in barn design, and management and strain differences. We sampled from two locations within each barn at all ages: ducks who were actively using the preening cups (PC) and ducks on the opposite side of the barn that were simply standing or sitting, but not performing any other behaviors (CON). The purpose for these two collections is not to compare brain chemistry associated with the active use of PCs at the moment. But rather, to obtain a more holistic assessment of the barn so that changes in brain chemistry can be assessed over time that may be the result of long term experiences on affective state. Second, we sampled ducks on the day of, but prior to, preening cup placement (d21), and compared to ducks on d28 one week after preening cup placement and d35 one day prior to processing. We had a final sample size of n = 8 ducks per barn per age. All procedures were approved by Purdue's Institutional Animal Care and Use Committee (PACUC #0423002383).

Transect walk

Our study performed a transect walk throughout each commercial duck barn during each collection date as described by our lab previously (Colton and Fraley, 2014) and by others (Marchewka et al., 2013; 2015; Abdelfattah et al., 2020). The transect walk included three highly trained individuals standing in a straight line (left, center, right) at the end of the barn and walked to the other end of the barn. Each individual recorded welfare concerns from 1/3 of the barn that was within 1 meter diameter as they walked. Then the individuals switched places and returned down the transect to record again. The physical welfare characteristics scored included gait, feather quality, feather cleanliness, eye, nostril, wing, sick, and dead. The frequency of occurrences were recorded as a severity of 1 or 2 (gait, feather quality, feather cleanliness, eyes, nostril, wing) or only if it occurred (sick, dead). The description for each welfare concern and transect rubric followed previously published research (Karcher et al., 2013; Colton and Fraley, 2014; BenSassi et al., 2019).

Litter moisture

Pine litter samples were collected from three locations at the bottom of the ramp within each barn. These locations included the front, middle, and back of the barn (n = 3/barn/age). The litter was weighed at the time of collection. Next, the litter was dried in an oven (Binder Oven Model # 155 ED) at 105 °C for 24 h (Benabdeljelil and Ayachi, 1996; Jacobs et al., 2011). To evaluate litter moisture percentage, we subtracted dry litter weight from wet litter weight, divided by wet litter weight, and multiplied by 100. Final litter moisture percentages were averaged per barn to obtain a final percentage for each barn (n = 4 per age).

Brain collection

Brains were collected from ducks actively using the preening cups (PC; n = 4/barn/day) and ducks on the opposite side the barn from the PC and not actively showing behaviors other than standing/walking (CON; n = 4/barn/day). Brains were sampled on d21, d28, and d35. All ducks were euthanized by cervical dislocation performed by flock managers present at the barns. Duck brains were placed on dry ice immediately after euthanasia and stored at -80°C until processed for mass spectrometry and qRT-PCR.

Brain microdissection

Brains were removed from -80 °C and hemisected. The right half was used for mass spectrometry and the left half was used for qRT-PCR. Each half was further dissected into caudal mesencephalon (CM), rostral mesencephalon (RM), and diencephalon (DI). Dissection coordinates were based upon previous studies and a published stereotaxic atlas of the avian brain (Kuenzel and Masson, 1988). Details of these procedures for ducks can be found in our previous study (Bergman et al., 2024).

Mass spectrometry

Brains areas were prepped for mass spectrometry following a previously published protocol (Kim et al., 2014; Bergman et al., 2024). The brain tissue was homogenized using 1.0 mm glass beads along with 10μl of internal standard and 10 μl of acetonitrile (ACN) per mg of brain tissue with 0.01 % ascorbic acid (Kim et al., 2014). Internal standard includes heavy hydrogen isotopes at the level of 10ng/μl for 3-MT, DOPAC, HVA, DA, 5-HT, and 5HIAA. Samples were vortexed for 10 min and centrifuged for 10 min at 12,000 rpm. Supernatant was removed and placed into a microcentrifuge tube to evaporate inside a speedvac for 24 h. The samples were stored at -80 °C until resuspension in 75μl of 9:1 HILIC A:B (Kim et al., 2014). Samples were vortexed until dried materials were homogenized again, approximately 30 min and centrifuged for 12,000 rpm for 10 min. Again, supernatant was collected into mass spectrometry tubes and run on Agilent Triple Quadruple Mass Spec (QQQ). Results are presented in neurotransmitter concentrations (ng/mg of tissue). These concentrations were applied to turnover equations for 5-HT and DA. The 5-HT turnover equation is (5HIAA/5-HT) and the DA turnover equation is (HVA+3-MT+DOPAC)/(DA) (Ahmed and Azmat, 2017). These equations are used to gain a greater understanding of the neurotransmitter metabolism and not just static numbers.

qRT-PCR

The left half of the brain was used for qRT-PCR using the same microdissected brain areas as described above for mass spectrometry. The tissues were first ground into a fine powder using liquid nitrogen and a mortar and pestle. RNA was then extracted from the tissue using Trizol, chloroform, and isopropanol. After washing RNA with ethanol, the samples were quantified using a Nanodrop (ND1000 spectrometer; Thermo Fisher Scientific). A DNase treatment using TURBO DNA-free Kit from Invitrogen by Thermo Fisher Scientific removed any excess DNA or cell debris from the sample. RNA was diluted to a level of 1000 ng/μl using Nanodrop. Gel electrophoresis for RNA quality must show two distinct bands of 18S and 28S to be considered good quality and all samples met that criterion. Next, reverse transcription transformed RNA into cDNA using High-Capacity cDNA Reverse Transcription Kit from applied biosystems by Thermo Fisher Scientific. Primers used for qRT-PCR are listed in Table 1. The primers include TPH1 and TPH2 for tryptophan hydroxylase and TH for tyrosine hydroxylase. Primer validation included a temperature validation and an efficiency curve where efficient primers were between 90 % and 110 % (Huang et al., 2021; Downs et al., 2023). Efficiency was calculated using Thermo Fisher qPCR efficiency calculator. These primers were created to span exon-exon junctions and intended to amplify all known transcript variants of the target genes. Final qRT-PCR was run in duplicates with a coefficient of variance of less than 1 using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and cDNA. The CFX Connect qPCR system (Bio-Rad, Hercules, CA) provided cycle threshold (Ct) results and the geometric mean of normalized housekeeping genes (GAPDH, HMBS, RPS13, SDHA) was used to calculate fold changes relative to the control group using the 2-ΔΔCt of gene expression on a logarithmic scale for graphical representation. This methodology is similarly reported in Smith et al. (2024).

Table 1.

Forward and reverse primers sequences used for qRT-PCR.

Gene ID Primers Forward Reverse Amplicon Length Annealing Temperature Reference Sequence
101803965 GAPDH* TGATTAACGGGAATGCCATC TCATGGTTCACACCCATCAC 211 58° XM_038180584.1
101799203 HMBS* CCGTGAGTTACACCCAGACC AAAGGCTCTTCTCCCCAATC 104 58° XM_027444343.2
101792265 SDHA* GACACAGTGAAAGGCTCCGA CTCCAGCTCTATCACGGCAG 304 58° XM_027451817.2
101789833 RPS13* AAGAAAGGCCTGACTCCCTC TGCCAGTAACAAAGCGAACC 151 59° XM_027462169.2
101794610 TH AGTCCACAGCTCTGACCTCAA GGTCCCCGTGCTTATAGTGA 248 58° XM_005019749.5
101797806 TPH1 TCGGACCCTCTCTACACACC TAGCTGTCCCTCTTGCTTGC 244 58° XM_005028406.4
101793780 TPH2 TCGTGTCTCTCAATCCACCA AATCCAGGGTGATCTGCATC 151 58° XM_038168432.1
Open in a new tab
⁎

Housekeeping Genes.

Statistical analyses

Transect walks were analyzed by determining the frequency of occurrences of physical welfare concerns; the experimental unit was the barn. These data were evaluated using a generalized linear mixed model (GLIMMIX) that ran repeated measures of ANOVA and least mean squares with Tukey's post hoc pairwise analysis in SAS Studio 9.4. Using the same software, litter moisture percentage was evaluated using a one-way ANOVA with Tukey's post hoc pairwise analysis. Neurotransmitter turnover and respective static levels were analyzed using a 2-way ANOVA (age x location; SAS, MacJMP Pro 15). Using RStudio 4.3, gene expression ΔCt results were not normally distributed so we applied non-parametric statistics. Results were evaluated using a pairwise comparison Wilcoxon rank sum test. All statistics found significance at a level of p ≤ 0.05.

Results

Transect walk

There were no significant differences in the frequency of occurrences of welfare concerns of gait 1, gait 2, feather quality 1, feather cleanliness 1, nostril 1, wing 1, sick, and dead. All other concerns were significantly affected by age and are listed in tables. Table 2 shows the mean values ± standard error of frequency of welfare scores of gait 1, gait 2, eye 1, eye 2, nostril 1, and nostril 2. Eyes receiving a score of 1 were increased (p = 0.0434) on d35 when compared to d21. Eyes receiving a score of 2 were increased (p = 0.0498) on d35 when compared to d21. A score of 2 for nostrils was increased (p = 0.0211) on d35 when compared to d28. Table 3 shows the mean values ± standard error of frequency of welfare scores of feather quality 1, feather quality 2, feather cleanliness 1, feather cleanliness 2, wing 1, and wing 2. There is an increased (p = 0.0081) score of 2 for feather quality for d28 when compared to d21. A feather cleanliness score of 2 increased on d28 (p = 0.0001) and d35 (p = 0.0499) when compared to d21. Wing problems with a score of 2 were increased on d28 when compared to d21 (p = 0.0403) and d35 (p = 0.0403). Table 4 shows the mean values ± standard error of frequency of welfare scores of sick and dead where no significant differences were observed.

Table 2.

Mean values ( ± SE) of frequency of occurrences for welfare scores of gait 1, gait 2, eye 1, eye 2, nostril 1, and nostril 2 across day of age (DOA). Values lacking a common superscript letter (a,b) are significant (p ≤ 0.05). Mean values represent the average number of ducks that exhibited welfare concerns.

DOA Gait 1 Gait 2 Eye 1 Eye 2 Nostril 1 Nostril 2
21 1.958 ± 0.410 2.250 ± 0.486 0.583 ± 0.645a 0.125 ± 0.069a 0.083 ± 0.058 0.042 ± 0.042
28 1.167 ± 0.280 2.417 ± 0.412 0.875 ± 0.392 0.583 ± 0.208 0.417 ± 0.146 0.000 ± 0.000a
35 1.125 ± 0.202 2.042 ± 0.392 1.750 ± 0.529b 0.708 ± 0.175b 0.417 ± 0.158 0.208 ± 0.085b
Open in a new tab

Table 3.

Mean values ( ± SE) of frequency of occurrences for welfare scores of feather quality 1, feather quality 2, feather cleanliness 1, feather cleanliness 2, wing 1, and wing 2 across day of age (DOA). Values lacking a common superscript letter (a,b) are significant (p ≤ 0.05). Mean values represent the average number of ducks that exhibited welfare concerns.

DOA Feather Quality 1 Feather Quality 2 Feather Cleanliness 1 Feather Cleanliness 2 Wing 1 Wing 2
21 2.125 ± 0.552 0.583 ± 0.240a 4.042 ± 0.791 0.375 ± 0.189a 0.083 ± 0.058 0.000 ± 0.000a
28 1.208 ± 0.248 2.750 ± 0.776b 2.042 ± 0.378 2.792 ± 0.574b 0.125 ± 0.092 0.583 ± 0.318b
35 1.208 ± 0.395 1.333 ± 0.287 3.542 ± 0.725 1.708 ± 0.292b 0.000 ± 0.000 0.000 ± 0.000a
Open in a new tab

Table 4.

Mean values ( ± SE) of frequency of occurrences for welfare scores of sick and dead across day of age (DOA). Values lacking a common superscript letter (a,b) are significant (p ≤ 0.05). Mean values represent the average number of ducks that exhibited welfare concerns.

DOA Sick Dead
21 0.917 ± 0.300 0.500 ± 0.262
28 0.292 ± 0.127 0.167 ± 0.078
35 0.542 ± 0.147 0.833 ± 0.197
Open in a new tab

Litter moisture

There were no differences for litter moisture across collection ages (p = 0.2150).

Mass spectrometry

5-HT, 5HIAA, DA, DOPAC, 3-MT, and HVA were measured and applied to turnover equations to understand the activity within the synapse of biogenic amines. Fig. 1 illustrates 5-HT turnover between PC and CON locations within three different brain areas (CM, RM, and DI). No significant differences in 5-HT turnover were found due to age or location. Fig. 2 presents static levels of 5-HT (ng/mg) and, again, no significant differences due to age or location were observed. Fig. 3 illustrates DA turnover from the CM, RM, and DI brain areas and no significant differences between locations for DA turnover were found. However, there are differences due to age. Within the CM (Fig. 3A), duck brains collected on d28 have a decreased (p ˂ 0.05) DA turnover. Within the RM (Fig. 3B), d28 and d35 duck brains have a decreased (p = 0.07) DA turnover when compared to brains from d21. Within the DI (Fig. 3C), d28 and d35 duck brains have a decreased (p ˂ 0.001) DA turnover when compared to d21 brains. Fig. 4 presents the static levels of DA (ng/mg) and there are no significant differences within the CM or RM brain areas for age or location. Static levels of DA are increased (p < 0.001) in the DI of CON ducks on d35 when compared to PC on d35 in Fig. 4C.

Fig. 1.

Fig 1

Open in a new tab

Serotonin (5-HT) turnover measured within (A) caudal mesencephalon (CM), (B) rostral mesencephalon (RM), and (C) diencephalon (DI). Each brain area compared brains collected from ducks actively using the preening cup (PC) and brains collected from ducks across the barn not actively using the preening cup (CON) during the three collection dates (d21, d28, d35). All brain areas show no differences due to age or location.

Fig. 2.

Fig 2

Open in a new tab

Serotonin (5-HT) static levels were measured within (A) caudal mesencephalon (CM), (B) rostral mesencephalon (RM), and (C) diencephalon (DI). Each brain area compared brains collected from ducks actively using the preening cup (PC) and brains collected from ducks across the barn not actively using the preening cup (CON) during the three collection dates (d21, d28, d35). All brain areas show no significant differences due to age or location.

Fig. 3.

Fig 3

Open in a new tab

Dopamine (DA) turnover measured within (A) caudal mesencephalon (CM), (B) rostral mesencephalon (RM), and (C) diencephalon (DI). Each brain area compared brains collected from ducks actively using the preening cup (PC) and brains collected from ducks across the barn not actively using the preening cup (CON) during the three collection dates (d21, d28, d35). The CM brain area shows a decrease (p < 0.05) in DA turnover from d21 to d28. The RM (p = 0.07) and DI (p <0.001) brain areas shows a decrease in DA turnover from d21 to d28 to d35.

Fig. 4.

Fig 4

Open in a new tab

Dopamine (DA) static levels were measured within (A) caudal mesencephalon (CM), (B) rostral mesencephalon (RM), and (C) diencephalon (DI). Each brain area compared brains collected from ducks actively using the preening cup (PC) and brains collected from ducks across the barn not actively using the preening cup (CON) during the three collection dates (d21, d28, d35). There are no significant differences in the CM and RM brain areas. The DI brain areas shows an increase (p < 0.001) in static DA levels on d35 for CON when compared to PC.

qRT-PCR

Gene expression of tryptophan hydroxylase (TPH1 and TPH2) and tyrosine hydroxylase (TH) were measured using qRT-PCR. Fig. 5 shows that no significant differences were observed due to age for all genes of interest in the CM brain area. Within the RM brain area, Fig. 6 shows no significant differences for TPH1 and TH but shows an increase in TPH2 fold change. TPH2 gene expression on d35 is significantly increased when compared to d21 (p = 0.0409) and d28 (p = 0.0032). Fig. 7 shows no significant differences due to age for all genes of interest for the DI brain area.

Fig. 5.

Fig 5

Open in a new tab

qRT-PCR within the CM brain area measuring relative mRNA expression of TPH1, TPH2, and TH. No significant differences in gene expression.

Fig. 6.

Fig 6

Open in a new tab

qRT-PCR within the RM brain area measuring relative mRNA expression of TPH1, TPH2, and TH. For TPH2, there is an increase in fold change for d35 when compared to d21 (p = 0.0409) and d28 (p = 0.0032).

Fig. 7.

Fig 7

Open in a new tab

qRT-PCR within the DI brain area measuring relative mRNA expression of TPH1, TPH2, and TH. No significant differences in gene expression.

Discussion

The purpose of our study was to investigate the effectiveness of semi-open water sources at a commercial setting on Pekin duck welfare and neurochemistry. We set out to determine if increased aggression and resource guarding observed with preening cup usage in an academic study coincident with increased dopaminergic activity would be replicated in a commercial setting. We evaluated welfare by performing transect walks and by measuring 5-HT and DA turnover and synthetic enzyme mRNA expression within discrete brain areas. We found age dependent effects for transect welfare and DA turnover within all brain areas. This increase in dopaminergic activity could be due to preening cup placement but is more likely due to increasing DA activity levels during early development (Davison and Kuenzel, 1991; Fraley and Kuenzel, 1993). We did not see any changes in 5-HT turnover associated with age or preening cup placement. Our study suggests that under commercial conditions, preening cups do negatively impact affective state, but ascertaining whether preening cups in a commercial setting improve duck welfare requires further research.

The need for open water enrichment within a commercial duck farm is recommended by humane certifications in the USA (American Humane Association, 2019) and required by the European Union (Council of Europe, 1999). However, the effect of open water on ducks’ welfare has been reported to be both positive and negative (Karcher and Mench, 2018; Chen et al., 2021; Makagon and Riber, 2021). Our study utilized transect welfare assessments as a systematic approach to measure the welfare of a large flock without causing a handling stress to the birds (BenSassi et al., 2019). Our results show an increase in frequency of welfare scores for eye 1, eye 2, feather quality 2, and feather cleanliness 2 as the ducks age. The welfare concerns increase over time, but due to the transect method, the percentage of ducks with each welfare concern is extremely low compared to the density in the barns. This means that all barns had overall very good welfare. Multiple studies have shown an increase in body condition scores as ducks naturally age within a production phase (Jones and Dawkins, 2010; Karcher et al., 2013; Colton and Fraley, 2014; Schober et al., 2023). As there is an increased demand for poultry products and increased growth rate, the industry needs to balance high production characteristics with welfare and animal health when genetically selecting animals (Hiemstra and Ten Napel, 2013).

Semi-open water sources such as preening cups are used in commercial barns to allow for natural bathing behaviors while attempting to reduce water usage problems like wet litter. Litter within Pekin duck barns consists of rice hulls, straw, or pine shavings that are added daily as needed by the contracted grower. The litter also collects excreta, water, and feed as the birds interact with their environment. Wet litter (moisture percentage above 25 %) can alter microbial activity, temperature, humidity, and ammonia levels (Dunlop et al., 2016). Wet litter is shown to reduce welfare by increasing foot pad dermatitis in turkeys and broilers (Greene et al., 1985; Mayne et al., 2007) and ducks (Schenk et al., 2016). Another study found increased Salmonella levels due to increased moisture content in the litter in broiler housing suggesting that moisture content is conducive to bacterial growth (Opara et al., 1992). Utilizing open water sources for Pekin ducks increases the amount of water that is accessible, yet our study found no significant differences in litter moisture across time or due to preening cup placement. This suggests that the management of preening cups within these barns prevented the excessive accumulation of water in the litter. Our study suggests that preening cups should be placed over a waste pit to allow overflow water to drain and be stored away from the ducks. This means that proper management of water sources is important to reduce the effect of increased environmental water (O'Driscoll and Broom, 2011).

We wanted to investigate if preening cup placement could be associated with improved affective state as determined by brain chemistry. We evaluated 5-HT turnover using mass spectrometry and found no significant differences across location or age. While preening cups are not associated with reduced 5-HT activity, they are not increasing 5-HT activity either, as would be suggested by an improved affective state. This suggests that, neurologically, these water sources are not improving or harming the duck's mental state. While evaluating tryptophan hydroxylase (TPH2) using qRT-PCR, our data reveals a significant increase in expression on d35. Thus, the enzyme to produce 5-HT is increased two weeks after preening cup placement. This suggests that there is a need for more 5-HT within the brain, yet there are no changes in static levels or turnover. This points to a disconnect between gene expression and levels of neurotransmitter that could be due to the lateralization of the brain function, which means that each hemisphere of the brain controls different functions within the brain (Güntürkün et al., 2020). By dividing the brain along the midline, the brain areas measured for mass spectrometry and qRT-PCR were different and may show different properties. Gene expression regulates the cell's ability to produce mRNA that is translated into proteins (Walther and Bäder, 2003). The process of gene expression changing the static levels of neurotransmitter is complex and includes multiple cell signaling pathways, therefore an increase in expression may not directly reflect a change in neurotransmitter levels. However, it is important to evaluate turnover, static levels, and gene expression to understand the complexity of brain chemistry and how environmental factors alter affective state and welfare of ducks.

We evaluated DA turnover using mass spectrometry and found significant decreases. A decrease in DA turnover represents an increase in dopaminergic activity within the synapse (Olguín et al., 2016). High feather pecking strains of adult layer hens have been linked to decrease DA turnover when compared to low feather pecking hens (Kops et al., 2013). That study showed how chickens with predisposed aggressive tendencies exhibit more DA activity than chickens with less aggressive tendencies (Kops et al., 2013). Similarly, increased dopaminergic activity has been linked to aggression and resource guarding in the presence of preening cups on an experimental farm (Bergman et al., 2024). However, unlike Bergman et al. (2024), we did not observe any concurrent unwanted pecking behaviors nor poor feather quality. Thus, we believe the increase in DA activity may not be due to the presence of preening cups as the large number of ducks per preening cup may have prevented them from becoming a defensible resource. We were unable to sample brains from similar barns without preening cups due to humane certifications requiring semi-open waters sources in all barns. Since there were no differences in DA turnover due to location of brain collection (PC or CON), the decrease in DA turnover could be linked to natural neural development that increases DA activity as animals age. DA was shown to increase as broiler chicks approached sexual maturation to stimulate LH secretion from the anterior pituitary gland (Davison and Kuenzel, 1991). This means that DA activity is increased as broiler chicks age. A similar study of broiler chicks suggest that brain levels of DA were increased as the chicks approached the onset of puberty (Fraley and Kuenzel, 1993). Brain development within precocial poultry has been shown to correlate with increasing DA (Fraley and Kuenzel, 1993).

In conclusion, 5-HT and DA are important neurotransmitters affiliated with affective state and increasing their activity as an animal grows allows for behavioral development. Negative affective states and decreased welfare are associated with poor production and a loss of income for the producer. In poultry production, a negative affective state of aggression can lead to increased feather pecking, loss of feathers for down products, and increased mortality (Sun et al., 2014; Kelly and Wilson, 2019). Semi-open water sources aim to improve duck welfare by providing an outlet for natural behaviors, but may cause further problems including aggression, and increased moisture, and bacterial contamination (Lowman et al., 2016; Schenk et al., 2016). Our study suggests that at a commercial level, preening cups do not negatively impact affective state as assessed by neurotransmitter profiles and body condition. The ducks in this study were in excellent physical condition with similar neurotransmitter profiles both before and after preening cup placement. However, more research is required to determine if the presence of semi-open water sources improve affective, or welfare states, and health above that with water lines alone.

Disclosures

The authors declare no conflict of interest.

Acknowledgments

The authors would like to thank Culver Duck Farms, Inc. (Middlebury, IN USA) for their continued support of our research.

References

  1. Abdelfattah E.M., Vezzoli G., Makagon M.M. On-farm welfare assessment of commercial Pekin ducks: a comparison of methods. Poult. Sci. 2020 doi: 10.1016/j.psj.2019.10.006. https://pubmed.ncbi.nlm.nih.gov/32036973 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahmed M., Azmat A. Decreased brain serotonin turnover rate following administration of Sharbat-e-Ahmed Shah produces antidepressant and anxiolytic effect in rats. Metab. Brain Dis. 2017 doi: 10.1007/s11011-017-0065-6. https://pubmed.ncbi.nlm.nih.gov/28687902 Available at. [DOI] [PubMed] [Google Scholar]
  3. Alenina N., Klempin F. The role of serotonin in adult hippocampal neurogenesis. Behav. Brain Res. 2015 doi: 10.1016/j.bbr.2014.07.038. https://pubmed.ncbi.nlm.nih.gov/25125239 Available at. [DOI] [PubMed] [Google Scholar]
  4. American Humane Association. 2019. American humane CertifiedTM animal welfare standards for ducks (meat and egg layers). Available from https://www.americanhumane.org/app/uploads/2021/08/Ducks-Meat-and-Egg-Layers.pdf [accessed April 23 2024].
  5. Benabdeljelil K., Ayachi A. Evaluation of alternative litter materials for poultry. J. Appl. Poult. Res. 1996 doi: 10.1093/japr/5.3.203. Available at. [DOI] [Google Scholar]
  6. BenSassi N., Vas J., Vasdal G., Averós X., Estevéz I., Newberry R.C. On-farm broiler chicken welfare assessment using transect sampling reflects environmental inputs and production outcomes. PLoS One. 2019 doi: 10.1371/journal.pone.0214070. https://pubmed.ncbi.nlm.nih.gov/30995219 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bergman M., Schober J., Oluwagbenga E., Frey D., Parnin H., Fraley G. Preening cups in duck housing are associated with an increase in central dopamine activity that suggests a negative affective state. Poult. Sci. 2024 doi: 10.1016/j.psj.2024.103588. https://pubmed.ncbi.nlm.nih.gov/38479100 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen X., Shafer D., Sifri M., Lilburn M.S., Karcher D.M., Cherry P., Wakenell P., Fraley S.M., Turk M., Fraley G.S. Centennial review: history and husbandry recommendations for raising Pekin ducks in research or commercial production. Poult. Sci. 2021 doi: 10.1016/j.psj.2021.101241. https://pubmed.ncbi.nlm.nih.gov/34229220 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Colton S., Fraley G.S. The effects of environmental enrichment devices on feather picking in commercially housed Pekin ducks. Poult. Sci. 2014 doi: 10.3382/ps.2014-03885. https://pubmed.ncbi.nlm.nih.gov/25037824 Available at. [DOI] [PubMed] [Google Scholar]
  10. Council of Europe. 1999. Recommendation concerning domestic ducks (Anas platyrynchos). Standing Committee of the European Convention for the Protection of Animals Kept for Farming Purposes (T-AP).
  11. Davison B.A., Kuenzel W.J. Hypothalamic biogenic amine levels in broiler chicks showing advanced sexual maturation. Poult. Sci. 1991 doi: 10.3382/ps.0701610. https://pubmed.ncbi.nlm.nih.gov/1886872 Available at. [DOI] [PubMed] [Google Scholar]
  12. Dawkins M.S. From an animal's point of view: motivation, fitness, and animal welfare. Behav. Brain Sci. 1990 doi: 10.1017/s0140525x00077104. Available at. [DOI] [Google Scholar]
  13. Dennis R.L., Cheng H.W. The dopaminergic system and aggression in laying hens. Poult. Sci. 2011 doi: 10.3382/ps.2011-01513. https://pubmed.ncbi.nlm.nih.gov/22010227 Available at. [DOI] [PubMed] [Google Scholar]
  14. Désiré L., Boissy A., Veissier I. Emotions in farm animals: a new approach to animal welfare in applied ethology. Behav. Process. 2002 doi: 10.1016/s0376-6357(02)00081-5. https://pubmed.ncbi.nlm.nih.gov/12426068 Available at. [DOI] [PubMed] [Google Scholar]
  15. Downs S.L., Madhi S., Van Der Merwe L., Nunes M., Olwagen C. Optimization of a high-throughput nanofluidic real-time PCR to detect and quantify of 15 bacterial species and 92 Streptococcus pneumoniae serotypes. Sci. Rep. 2023 doi: 10.1038/s41598-023-31820-4. https://pubmed.ncbi.nlm.nih.gov/36944704 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dunlop M.W., McAuley J., Blackall P.J., Stuetz R.M. Water activity of poultry litter: relationship to moisture content during a grow-out. J. Environ. Manag. 2016 doi: 10.1016/j.jenvman.2016.02.036. https://pubmed.ncbi.nlm.nih.gov/26946169 Available at. [DOI] [PubMed] [Google Scholar]
  17. van Erp A.M.M., Miczek K.A. Aggressive behavior, increased accumbal dopamine, and decreased cortical serotonin in rats. J. Neurosci. 2000 doi: 10.1523/JNEUROSCI.20-24-09320.2000. https://pubmed.ncbi.nlm.nih.gov/11125011 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fraley G.S., Kuenzel W.J. Precocious puberty in chicks (gallus domesticus) induced by central injections of neuropeptide Y. Life Sci. 1993 doi: 10.1016/0024-3205(93)90047-7. https://pubmed.ncbi.nlm.nih.gov/8483393 Available at. [DOI] [PubMed] [Google Scholar]
  19. Goodnick P.J., Goldstein B.J. Selective serotonin reuptake inhibitors in affective disorders–I. Basic pharmacology. J. Psychopharmacol. 1998 doi: 10.1177/0269881198012003021. https://pubmed.ncbi.nlm.nih.gov/9808077 Available at. [DOI] [PubMed] [Google Scholar]
  20. Greene J.A., McCracken R.M., Evans R.T. A contact dermatitis of broilers -clinical and pathological findings. Avian Pathol. 1985 doi: 10.1080/03079458508436205. https://pubmed.ncbi.nlm.nih.gov/18766896 Available at. [DOI] [PubMed] [Google Scholar]
  21. Güntürkün O., Ströckens F., Ocklenburg S. Brain lateralization: a comparative perspective. Physiol. Rev. 2020 doi: 10.1152/physrev.00006.2019. https://pubmed.ncbi.nlm.nih.gov/32233912 Available at. [DOI] [PubMed] [Google Scholar]
  22. S.J. Hiemstra, J. Ten Napel, 2013. Study of the impact of genetic selection on the welfare of chickens bred and kept for meat production. Final report of a project commissioned by the European Commission (DG SANCO 2011/12254). Retrieved on 08 May 2024 from https://food.ec.europa.eu/system/files/2016-10/aw_practice_farm_broilers_653020_final-report_en.pdf.
  23. van Hierden Y.M., Ruesink E.W., van Reenen C.G., Engel B., Korte-Bouws G.A.H., Koolhaas J.M., Blokhuis H.J. Adrenocortical reactivity and central serotonin and dopamine turnover in young chicks from a high and low feather-pecking line of laying hens. Physiol. Behav. 2002 doi: 10.1016/s0031-9384(02)00667-4. https://pubmed.ncbi.nlm.nih.gov/12020730 Available at. [DOI] [PubMed] [Google Scholar]
  24. Huang W.F., Zhang Y., Mehmood S., Wang Z., Hou C., Li Z. Updating sacbrood virus quantification PCR method using a TaqMan-MGB probe. Vet. Sci. 2021 doi: 10.3390/vetsci8040063. https://pubmed.ncbi.nlm.nih.gov/33924550 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jacobs B.M., Patience J.F., Dozier W.A., Stalder K.J., Kerr B.J. Effects of drying methods on nitrogen and energy concentrations in pig feces and urine, and poultry excreta. J. Anim. Sci. 2011 doi: 10.2527/jas.2010-3768. https://pubmed.ncbi.nlm.nih.gov/21454859 Available at. [DOI] [PubMed] [Google Scholar]
  26. Jirkof P., Rudeck J., Lewejohann L. Assessing affective state in laboratory rodents to promote animal welfare-what is the progress in applied refinement research? Animal. 2019 doi: 10.3390/ani9121026. https://pubmed.ncbi.nlm.nih.gov/31775293 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jones T.A., Dawkins M.S. Effect of environment on Pekin duck behaviour and its correlation with body condition on commercial farms in the UK. Br. Poult. Sci. 2010 doi: 10.1080/00071668.2010.499143. https://pubmed.ncbi.nlm.nih.gov/20680866 Available at. [DOI] [PubMed] [Google Scholar]
  28. Kanova M., Kohout P. Serotonin-its synthesis and roles in the healthy and the critically ill. Int. J. Mol. Sci. 2021 doi: 10.3390/ijms22094837. https://pubmed.ncbi.nlm.nih.gov/34063611 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Karcher D.M., Makagon M.M., Fraley G.S., Fraley S.M., Lilburn M.S. Influence of raised plastic floors compared with pine shaving litter on environment and Pekin duck condition. Poult. Sci. 2013 doi: 10.3382/ps.2012-02215. https://pubmed.ncbi.nlm.nih.gov/23436508 Available at. [DOI] [PubMed] [Google Scholar]
  30. D.M. Karcher, and J.A. Mench. 2018. Overview of commercial poultry production systems and their main welfare challenges. Available at 10.1016/b978-0-08-100915-4.00001-4.
  31. Kelly A.M., Wilson L.C. Aggression: perspectives from social and systems neuroscience. Horm. Behav. 2019 doi: 10.1016/j.yhbeh.2019.04.010. https://pubmed.ncbi.nlm.nih.gov/31002771 Available at. [DOI] [PubMed] [Google Scholar]
  32. Kim T.H., Choi J., Kim H.G., Kim H.R. Quantification of neurotransmitters in mouse brain tissue by using liquid chromatography coupled electrospray tandem mass spectrometry. J. Autom. Methods Manag. Chem. 2014 doi: 10.1155/2014/506870. https://pubmed.ncbi.nlm.nih.gov/25258696 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kops M.S., de Haas E.N., Rodenburg T.B., Ellen E.D., Korte-Bouws G.A.H., Olivier B., Güntürkün O., Bolhuis J.E., Korte S.M. Effects of feather pecking phenotype (severe feather peckers, victims and non-peckers) on serotonergic and dopaminergic activity in four brain areas of laying hens (Gallus gallus domesticus. Physiol. Behav. 2013 doi: 10.1016/j.physbeh.2013.07.007. https://pubmed.ncbi.nlm.nih.gov/23911692 Available at. [DOI] [PubMed] [Google Scholar]
  34. Kuenzel W.J., Masson M. A stereotaxic atlas of the brain of the chick (Gallus domesticus). The Johns Hopkins University Press; Baltimore, MD, USA: 1988.. https://www.semanticscholar.org/paper/ff834abf4bcc37b7e3ab07ce640e2c2e4ae23bcb [Google Scholar]
  35. Lowman Z.S., Parkhurst C.R., Romano J. Effect of nipple lines vs. water trough on Pekin duck breeder performance and well-being. Int. J. Poult. Sci. 2016 doi: 10.3923/ijps.2016.52.56. Available at. [DOI] [Google Scholar]
  36. Makagon M.M., Riber A.B. Setting research driven duck-welfare standards: a systematic review of Pekin Duck welfare research. Poult. Sci. 2021 doi: 10.1016/j.psj.2021.101614. https://pubmed.ncbi.nlm.nih.gov/35042179 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Marchewka J., Estevéz I., Vezzoli G., Ferrante V., Makagon M.M. The transect method: a novel approach to on-farm welfare assessment of commercial turkeys. Poult. Sci. 2015 doi: 10.3382/ps/peu026. https://pubmed.ncbi.nlm.nih.gov/25577791 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Marchewka J., Watanabe T.T.N., Ferrante V., Estevez I. Welfare assessment in broiler farms: transect walks versus individual scoring. Poult. Sci. 2013 doi: 10.3382/ps.2013-03229. https://pubmed.ncbi.nlm.nih.gov/24046404 Available at. [DOI] [PubMed] [Google Scholar]
  39. Mayne R.K., Else R., Hocking P. High litter moisture alone is sufficient to cause footpad dermatitis in growing turkeys. Br. Poult. Sci. 2007 doi: 10.1080/00071660701573045. https://pubmed.ncbi.nlm.nih.gov/17952724 Available at. [DOI] [PubMed] [Google Scholar]
  40. Micheli L., Ceccarelli M., D'Andrea G., Tirone F. Depression and adult neurogenesis: positive effects of the antidepressant fluoxetine and of physical exercise. Brain Res. Bull. 2018 doi: 10.1016/j.brainresbull.2018.09.002. https://pubmed.ncbi.nlm.nih.gov/30236533 Available at. [DOI] [PubMed] [Google Scholar]
  41. Morgan W.W., Rudeen P.K., Pfeil K.A. Effect of immobilization stress on serotonin content and turnover in regions of the rat brain. Life Sci. 1975 doi: 10.1016/0024-3205(75)90250-7. https://pubmed.ncbi.nlm.nih.gov/1143007 Available at. [DOI] [PubMed] [Google Scholar]
  42. Muhammad M., Stokes J.E., Manning L. Positive aspects of welfare in sheep: current debates and future opportunities. Animals. 2022 doi: 10.3390/ani12233265. https://pubmed.ncbi.nlm.nih.gov/36496786 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nelson R.J., Chiavegatto S. Molecular basis of aggression. Trends Neurosci. 2001 doi: 10.1016/s0166-2236(00)01996-2. https://pubmed.ncbi.nlm.nih.gov/11718876 Available at. [DOI] [PubMed] [Google Scholar]
  44. Nelson R.J., Trainor B.C. Neural mechanisms of aggression. Nat. Rev. Neurosci. 2007 doi: 10.1038/nrn2174. https://pubmed.ncbi.nlm.nih.gov/17585306 Available at. [DOI] [PubMed] [Google Scholar]
  45. O'Driscoll K.K.M., Broom D.M. Does access to open water affect the health of Pekin ducks (Anas platyrhynchos) Poult. Sci. 2011 doi: 10.3382/ps.2010-00883. https://pubmed.ncbi.nlm.nih.gov/21248325 Available at. [DOI] [PubMed] [Google Scholar]
  46. Olguín H.J., Guzmán D.C., García E.H., Mejía G.B. The role of dopamine and its dysfunction as a consequence of oxidative stress. Oxidative Med. Cell. Longev. 2016 doi: 10.1155/2016/9730467. https://pubmed.ncbi.nlm.nih.gov/26770661 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Opara O.O., Carr L.E., Russek-Cohen E., Tate C., Mallinson E.T., Miller R.G., Stewart L.E., Johnston R.W., Joseph S.W. Correlation of water activity and other environmental conditions with repeated detection of Salmonella contamination on poultry farms. Avian Dis. 1992 https://pubmed.ncbi.nlm.nih.gov/1417596 Available at. [PubMed] [Google Scholar]
  48. Schenk A., Porter A., Alenciks E., Frazier K., Best A.A., Fraley S.M., Fraley G.S. Increased water contamination and grow-out Pekin duck mortality when raised with water troughs compared to pin-metered water lines using a United States management system. Poult. Sci. 2016 doi: 10.3382/ps/pev381. https://pubmed.ncbi.nlm.nih.gov/26769272 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Schildkraut J.J., Kety S.S. Biogenic amines and emotion. Science. 1967 doi: 10.1126/science.156.3771.21. https://pubmed.ncbi.nlm.nih.gov/5335690 (1979) Available at. [DOI] [PubMed] [Google Scholar]
  50. Schober J.M., Merritt J., Swanson M., Tetel V., Oluwagbenga E., Frey D., Parnin H., Erasmus M., Fraley G. Preening cups increase apparent wet preening behaviors, but have no impact on other behaviors, body condition, growth, or body morphometrics of grow-out Pekin ducks. Poult. Sci. 2023 doi: 10.1016/j.psj.2023.103145. Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Smith A.A., Vesey A., Helfrich C., Pasternak J.A. Late gestation fetal hypothyroidism alters cell cycle regulation across multiple organ systems. BMC Vet. Res. 2024 doi: 10.1186/s12917-024-04102-y. https://pubmed.ncbi.nlm.nih.gov/38902754 Available at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sun Y., Ellen E.D., van der Poel J.J., Parmentier H.K., Bijma P. Modelling of feather pecking behavior in beak-trimmed and non-beak-trimmed crossbred laying hens: variance component and trait-based approach. Poult. Sci. 2014 doi: 10.3382/ps.2013-03367. https://pubmed.ncbi.nlm.nih.gov/24706953 Available at. [DOI] [PubMed] [Google Scholar]
  53. Walther D.J., Bäder M. A unique central tryptophan hydroxylase isoform. Biochem. Pharmacol. 2003 doi: 10.1016/s0006-2952(03)00556-2. https://pubmed.ncbi.nlm.nih.gov/14563478 Available at. [DOI] [PubMed] [Google Scholar]
  54. Walther D.J., Peter J.U., Bashammakh S., Hörtnagl H., Voits M., Fink H., Bäder M. Synthesis of serotonin by a second tryptophan hydroxylase isoform. Science. 2003 doi: 10.1126/science.1078197. https://pubmed.ncbi.nlm.nih.gov/12511643 (1979) Available at. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES