Rapid and equipment‐free identification of papaya mealybug Paracoccus marginatus based on RPA‐CRISPR/Cas12a

Abstract

BACKGROUND

Paracoccus marginatus has invaded many countries, spreading rapidly and causing significant economic losses to crops. Accurate detection during the monitoring process is critical to prevent its expansion into new areas, therefore it is necessary to develop efficient and reliable detection methods. Traditional detection methods are time‐consuming and instrument‐dependent owing to the morphological similarities and small sizes of P. marginatus and other mealybugs, therefore establishing an efficient, rapid, and sensitive method for field detection in resource‐limited settings is critical.

RESULTS

A sensitive and rapid detection system was developed to detect P. marginatus using recombinase polymerase amplification (RPA) combined with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas12a. The RPA‐CRISPR/Cas12a assay distinguished P. marginatus from 10 other mealybugs. The entire process can be completed in approximately an hour, and the identification results can be determined by the naked eye using lateral flow strips or a portable mini‐UV torch. A method was developed to extract DNA from P. marginatus within 5 min. This method was combined with the RPA‐CRISPR/Cas12a assay to achieve rapid and simple detection. In addition, two portable thermos cups with temperature displays were used to maintain the reagents and assay reactions in the field.

CONCLUSION

This assay represents the first application of portable and easily available items (mini‐UV torch and thermos cup) based on the combination of RPA and CRISPR/Cas12a for rapid pest detection. This method is rapid, highly specific, and instrument‐flexible, allowing for the early monitoring of P. marginatus in the field. This study provides guidance for the development of suitable management strategies. © 2024 The Author(s). Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

We have developed a rapid, sensitive, and instrument‐flexible system for the detection of invasive mealybug Paracoccus marginatus in resource‐limited settings using recombinase polymerase amplification combined with clustered regularly interspaced short palindromic repeats/Cas12a. This approach offers high practicality for early monitoring of P. marginatus in the field.

1. INTRODUCTION

The papaya mealybug, Paracoccus marginatus (Williams and Granara de Willink), is a pest native to Central America that has spread worldwide. The invasion of P. marginatus was reported as early as 1994 in Caribbean. ¹ Over the past three decades, it has invaded several countries across Africa, North America, Oceania, Central and South America, and Asia. ² Its rapid spread and invasion has caused significant economic losses in many countries. P. marginatus is a highly polyphagous pest with a wide host range (over 200 plant species), including economically important crops, tropical and subtropical fruits, vegetables, and ornamental plants, ³ including Carica papaya L. (papaya), Manihot esculenta (cassava), and Solanum melongena L. (eggplant). Both the nymph and adult stages of the papaya mealybug feed on the sap of plant shoots, tender leaves, and fruits, thereby causing infection. This can result in crinkled or deformed plant leaves, leaf yellowing, leaf drop, and ultimately reduced yield or plant death. In China, the mealybug causes yield losses of 10–70% in cassava, papaya, and mulberry crops. ⁴ , ⁵ In Bangladesh, P. marginatus infestations in papaya orchards have resulted in an average economic loss of 700 USD per ha per year. ⁶ This mealybug is capable of being transported by wind easily, by ants between plant species, ⁷ via irrigation channels, and by human‐mediated transport. ⁸ P. marginatus has the potential to expand into new areas of Central and East Africa, Central America, and Asia. ⁹ Given the extent of its distribution and the considerable damage it causes, the quarantine status of P. marginatus could have a significant impact on global food production, with potential adverse effects on international trade, ¹⁰ therefore the prevention of its global spread is critical. Accurate detection is an essential first step for combating the global spread of invasive species.

Morphological identification of mealybugs can be challenging owing to their small size and variable morphology. Currently, the morphological identification of mealybugs relies on the microscopic observation of adult mealybugs using the slide mounting technique. ¹¹ However, this method requires specialized knowledge and is time‐consuming. Identification of papaya mealybugs using morphological observations is largely dependent on their life stages. It is difficult to distinguish between P. marginatus and closely related mealybug species at the species level, particularly at the immature and mature male stages. ¹²

Molecular identification can overcome the limitations of morphological identification at the species level. However, standard identification methods such as Polymerase Chain Reaction (PCR)‐based assays require well‐trained operators, expensive equipment, and laboratory conditions, which makes them difficult to apply in resource‐constrained scenarios. ¹³ In our previous study, we established a species‐specific PCR‐based methodology for the identification of P. marginatus in a laboratory setting. This methodology demanded the use of a water bath, centrifuge, thermocyclers, and electrophoresis apparatus, with the process requiring approximately 4 h. Isothermal amplification approaches, such as loop‐mediated isothermal amplification (LAMP) and recombinant polymerase amplification (RPA), amplify nucleotides at a constant temperature without using thermocyclers. The LAMP reaction requires four to six primers and a reaction temperature of 65 °C for successful amplification of the target DNA. ¹⁴ However, LAMP can result in nonspecific amplification, which can lead to false‐positive results. ¹⁵ Compared with LAMP, RPA has a simpler primer design, requiring only two primers for the detection reaction. In addition, it also has advantages in reaction temperature (approximately 37 °C), reaction time (approximately 15–30 min), and high sensitivity. ¹⁶ , ¹⁷ Therefore, RPA is particularly suitable for developing rapid, sensitive, and simple molecular detection methods in resource‐limited settings such as point‐of‐care testing and field applications.

Recently, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas (CRISPR‐associated protein)‐based nucleic acid detection approaches have emerged as accurate and powerful tools at the molecular level. The CRISPR‐Cas12a system can identify and cleave specific nucleic acid sequences with the guidance of complementary CRISPR RNA (crRNA) and subsequently trans‐cleave the non‐specific single‐stranded DNA (ssDNA) reporter. ¹⁸ On ssDNA cleavage, the fluorophore is released from the quencher and detected as a fluorescent signal. ¹⁹ The ssDNA reporter containing biotin was detected using a lateral flow test strip. Both the RPA and CRISPR/Cas12a systems can be conducted at a constant temperature of 37 °C, making them suitable for rapid, sensitive, and easy‐to‐operate detection. The RPA‐CRISPR/Cas12a system has been used to detect viruses ²⁰ , ²¹ , ²² and bacteria ²³ , ²⁴ in humans, food products, and plants. However, RPA‐CRISPR/Cas12a technology has only been applied a few times for the detection of insect pests. Alon et al. ²⁵ developed a CRISPR‐Cas12a detection assay for the differential detection of two important insect pests, Bactrocera zonata and Ceratitis capitata, which have similar morphologies. Deng et al. ²⁶ built a CRISPR/Cas12a‐based visual nucleic acid system combined with RPA to accurately distinguish Liposcelis bostrychophila from four other common stored‐product booklice. No reports are currently available of the use of this technology to detect mealybugs, which have a large number of varieties and morphological similarities.

This study presents a method that combines RPA and CRISPR‐Cas12a with fluorescence and lateral flow technologies to differentiate P. marginatus from 10 other mealybugs. The target DNA sequence of P. marginatus was amplified using RPA technology, and subsequently detected and cleaved by Cas12a guided by crRNA. When single‐stranded DNA (ssDNA) is cleaved using activated Cas12a, the resulting fluorescence or lateral flow strip results can be observed directly with the naked eye (Fig. 1). Thermal cups were used to maintain the reagents and assay reactions at stable temperatures during field detection. This RPA‐CRISPR/Cas12a assay has the potential to detect P. marginatus with high accuracy in less than 1 h without the need for any experimental equipment. This provides a simple and convenient method that can be deployed in the field for detecting P. marginatus.

Figure 1.

Schematic diagram of the RPA‐CRISPR/Cas12a method. (A) The mealybugs were collected from an infected host in the field. The RPA and CRISPR/Cas12a reagents were stored with ice in a thermos cup. (B) The DNA was extracted using an extraction buffer, an extraction dipstick, and a washing buffer. (C) The RPA assay was conducted in a thermos cup containing warm water (37 °C) for 35 min. (D) The CRISPR/Cas12a assay was performed in a thermos cup containing warm water (37 °C) for 10–30 min. (E) Positive results were indicated by the presence of visible fluorescence under a min‐UV torch and the appearance of both the C line and T line, or the appearance of only the T line on lateral flow test strips. CRISPR, clustered regularly interspaced short palindromic repeats; RPA, recombinant polymerase amplification.

2. MATERIALS AND METHODS

2.1. Insect rearing and sample collection

The egg, nymph, and adult stages of P. marginatus were collected from papaya in Zhangzhou City, Fujian Province, China in 2017. The specimens were transported to the Institute of Plant Protection, Fujian Academy of Agricultural Sciences, where they were subsequently maintained on potatoes with sprouts in a climate chamber at 26 ± 1 °C and 60% humidity. Ten other mealybugs were sampled from the field or received from Xiamen Customs, Fujian Province (Table 1). These mealybugs all belonged to the family Pseudococcidae. The following species were identified as invasive in China: Phenacoccus solenopsis Tinsley, Phenacoccus solani Ferris, Planococcus lilacinus (Cockerell), Planococcus minor Maskell, Pseudococcus jackbeardsleyi Gimpel et Miller, and Dysmicoccus neobrevipes Beardsley. The minute dimensions and morphological similarities of these 11 mealybugs make it difficult to distinguish them without specific knowledge.

Table 1.

Sample information for mealybugs in this study

Species	Host	Sample site
Phenacoccus solenopsis Tinsley	Cucurbita moschata	Reared in the climate chamber
Phenacoccus solani Ferris	Cucurbita moschata
Planococcus citri (Risso, 1813)	Cucurbita moschata
Planococcus lilacinus (Cockerell)	Cucurbita moschata
Dysmicoccus boninsis (Kuwana)	Saccharum officinarum	Zhangzhou city, Fujian Province, China
Pseudococcus cryptus (Hempel)	Cucurbita moschata	Fuzhou city, Fujian Province, China
Pseudococcus odermatti Miller & Williams	Vitis vinifera L.	Fuzhou city, Fujian Province, China
Planococcus minor Maskell	Unknown	Xiamen Customs, China
Pseudococcus jackbeardsleyi Gimpel et Miller	Unknown	Xiamen Customs, China
Dysmicoccus neobrevipes Beardsley	Unknown	Xiamen Customs, China

2.2. DNA extraction

The DNA was extracted from whole preserved adult mealybugs using an Insect DNA kit (D0926‐01, Omega Bio‐Tek, Norcross, GA, USA), in accordance with the manufacturer's protocol. The extracted DNA, based on the kit, was employed for the specificity and optimization of RPA/Cas12a‐based assays.

For crude DNA extraction, the extraction buffer, dipstick wash buffer configuration, and preparation of the nucleic acid extraction dipstick were as described by Mason and Botella ²⁷ In brief, extraction buffer contained 20 mm Tris (pH = 8), 25 mm NaCl, 2.5 mm ethylenediaminetetraacetic acid (EDTA), 0.05% (wt/vol) sodium dodecyl sulfate (SDS), and 2% (wt/vol) polyvinylpyrrolidone (PVP)‐40; dipstick wash buffer contained 10 mm Tris (pH = 8). The nucleic acid extraction dipstick consisted of a nucleic acid binding surface with a surface area of 20 mm² and a wax‐impregnated water repellent handle with a length of 6 cm. DNA from oocyst, first‐, second‐, and third‐instar nymphs, pupa, male, and female of P. marginatus was crudely extracted. The number of oocyst, first‐, second‐, and third‐instar nymphs, pupa, female, and male for crude DNA extraction was 1, 20, 5, 3, 5, 1 and 20, respectively. Samples in a 1.5 mL Eppendorf were crushed in 50 μL of extraction buffer using a plastic pestle. The nucleic acid extraction dipsticks were then immersed in the extraction buffer to capture the DNA. The dipsticks containing DNA were purified using 800 μL of washing buffer. The purified DNA, derived from the crude DNA extraction, was subsequently used as a template for RPA amplification in a universal amplification assay.

2.3. RPA primer and crRNA design

In the present study, candidate sequences from the 28S rDNA of P. marginatus and nine additional mealybug species were employed, as had been done in the previous study. ²⁸ The SnapeGene software (version 3.2.1, GSL Biotech, Chicago, IL, USA) was used to compare the similarity of the P. marginatus candidate sequences with those of other mealybugs. The primers Pm‐RPA‐F and Pm‐RPA‐R, which target the 28S rDNA of P. marginatus for the RPA assay, were designed using Oligo software (version 7.56, 1267 Vondelpark, Colorado Springs, CO 80907, USA) in accordance with design principles (Fig. S1(A)). The design principles were as follows: the length of the primer for the RPA assay was in the range of 28–35 nucleotides, the expected amplicon size was less than 500 base pairs, the GC rate was in the range of 20–70%, and the melting temperature was in the range of 50–100 °C.

The crRNA for the CRISPR detection system targeting RPA amplicons of 28S rDNA was designed based on the characteristic of LbCas12a crRNA recognition of the T‐rich protospacer adjacent motif sites at the 5′ end. The sequence was designed using CRISPOR (http://crispor.tefor.net/), the results of which are shown in Table 2 and Fig. S1(B).

Table 2.

RPA primers, crRNA sequence, and ssDNA reporter sequences

Primer name	Sequences (5′–3′)
Pm‐RPA‐F	GCGACGGAATTCAGAATTTGTGGCGTTTAC
Pm‐RPA‐R	TGCGGACGACCGGCCATATTACAAGAATAT
crRNA	UAAUUUCUACUAAGUGUAGAUGUAUUAUAACGGACGGCCGAUGCG
FQ reporter	6‐FAM‐TTATT‐BHQ1
LF reporter	6‐FAM‐TTATT‐Biotin

CRISPR, clustered regularly interspaced short palindromic repeats; crRNA, CRISPR RNA; RPA, recombinant polymerase amplification; ssDNA, single‐stranded DNA.

Reporter probes were designed as double‐labeled ssDNA probes with fluorophore quencher‐labeled (FQ) and lateral flow (LF) reporters intended for fluorescent detection and lateral flow strip assays, respectively. The 5′ ends of the FQ and LF reporters were both tagged with 6‐carboxyfluorescein (FAM) and the 3′ ends were tagged with the black hole quencher 1 (BHQ1) quencher and Biotin, respectively (Table 2).

Primers, crRNA, and reporter probes were synthesized by Sangon Biotech (Shanghai, China).

2.4. RPA assay and CRISPR/Cas12a digestion reaction

The RPA assay was performed using the TwistAmp basic kit (TwistDx™ Limited, Cambridge, UK). The assay was performed in 50 μL of reaction mixture, including 29.5 μL of rehydration buffer, 2.4 μL of forward and reverse primer (10 um), 2.5 μL of MgOAc (280 mm), 14.2 μL of RNase‐free H₂O, and 2 μL of DNA template. The DNA template concentration was diluted to 10 ng/μL. The reaction was incubated at 37 °C in a metal bath (HB150‐S1, Dragon Laboratory Instruments Limited, Beijing, China) for 30 min.

The fluorescent assay utilized a gRNA‐LbCas 12a cleavage system comprising 300 nm crRNA, 50 nm LbCas12a, 2 μL of 1X NEBuffer, 300 nm FQ reporter, and 2 μL of RPA product in a total volume of 20 μL. The Cas12a cleavage reaction was performed at 37 °C for 30 min using a fluorescent quantitative PCR instrument (Q6pro, Thermo Fisher Scientific Inc., Waltham, MA, USA). The fluorescence intensity was measured every minute. Positive reactions were indicated by the presence of a bright‐green fluorescence signal, which was observed by the naked eye under blue light using a blue LED transilluminator (GD50501, Monad Biotech Co., Ltd., Jiangsu, China). Conversely, the absence of fluorescence indicated a negative reaction, manifesting as a transparent appearance.

The RPA/Cas12a‐based lateral flow assay used the same reagents as the fluorescence assay, except that the FQ reporter was replaced with an LF reporter. The reaction mixture, which had a total volume of 20 μL, was incubated at 37 °C in the metal bath for 30 min, followed by the addition of 30 μL of RNase‐free water. A lateral flow strip (Cat. No. JY0301; Tiosbio Biotechnology Co, Ltd., Beijing, China) was inserted into the reaction mixture for 5 min. The results were recorded within 10 min. In the case of a reaction with target DNA amplicons, the LF reporter will be cleaved, resulting in the production of molecules with a free FAM or biotin group. The lateral flow strips, on contact with the CRISPR/Cas12a reaction buffer, facilitate the combination of the FAM group with the anti‐FITC antibody present on the surface of the AuNPs immobilized at the conjugation pad of the strips. The FAM‐gold nanoparticles (AuNPs) conjugate traversed the control area and reached the test area, where it formed a test line. Consequently, a positive result was indicated by the appearance of both a control line (C line) and a test line (T line), or the appearance of only the T line. In the case of a reaction that does not include target DNA amplicons, the LF reporter will not undergo cleavage. The FAM‐AuNPs conjugates possess biotin groups, which would be captured by the streptavidin immobilized on the control area, thereby forming the control band. A negative result was indicated by the appearance of only C line.

2.5. Specific of RPA/Cas12a‐based assay

To distinguish P. marginatus from the other mealybugs, the specificity of the other 10 mealybugs was evaluated. RPA/Cas12a‐based fluorescence and lateral flow assays were used for the detection. The procedures of the RPA and CRISPR/Cas12a assays were consistent with those described in Section 2.4.

2.6. Optimization of RPA assay reaction time

In accordance with the procedures detailed in Section 2.4, the RPA assay was conducted at 37 °C for varying durations of 5, 10, 15, 20, 25, 30, 35 and 40 min, respectively. The resulting RPA products were then added to the CRISPR/Cas12a reaction. The optimal RPA time was determined by measuring the fluorescence intensity and subsequently employed in further experiments.

2.7. Optimization of RPA/Cas12a‐based fluorescent assay

Optimization of the detection system involved the optimization of the Cas12a/crRNA ratio, Cas12a concentration, and FQ reporter concentration. First, in accordance with the procedures detailed in Section 2.4, the RPA time was set as the optimal time. Subsequently, following the study of Hu et al., ²⁹ the Cas12a concentration was set to 50 nm and the ratios were set to 1:1, 1:2, 1:4, and 1:6. When the optimal Cas12a/crRNA ratio was determined, the Cas12a concentration was optimized using seven concentration gradients, 5, 10, 25, 50, 100, 150, and 200 nm. Finally, the FQ reporter concentration was optimized by evaluating 11 content gradients ranging from 50 to 3000 nm. The fluorescence intensity was measured to determine the optimal Cas12a/crRNA ratio, Cas12a concentration, and FQ reporter concentration, respectively.

The specificity of the optimal RPA‐CRISPR/Cas12a assay for distinguishing papaya mealybugs from other mealybugs was tested once more.

2.8. Optimization of RPA/Cas12a‐based lateral flow assay and cleavage time

The optimal concentration of Cas12a and crRNA, as identified in the preceding step, were employed as the basis for optimizing the LF reporter concentration. This was conducted by evaluating six concentration gradients (50, 100, 200, 400, 800, and 1000 nm) and cleavage times of 10, 20, and 30 min. The lateral flow strips were used for visual readout.

2.9. Universal amplification assay

To test whether the RPA‐CRISPR/Cas12a assay combined with the crude DNA extraction method was suitable for detecting all stages of P. marginatus, genomic DNA from each P. marginatus stage (oocyst, first‐, second‐, and third‐instar nymphs, pupa, male, and female) was crudely extracted. Subsequently, optimal RPA‐CRISPR/Cas12a‐based fluorescence and lateral flow assays were performed. The fluorescence observed under blue light and the results of the lateral flow strips were used to generate a visual readout.

2.10. Portable thermos cup for field detection

Two thermos cups with temperature displays (AWP2775, 460 mL; Philips, Amsterdam, Netherlands) were used to store the reagents on ice and maintain the RPA‐CRISPR/Cas12a reaction temperature with warm water (37 °C). The RPA and CRISPR/Cas12a reagents were placed into separate 200‐μL centrifugal tubes and kept in the thermos cup with ice for 3, 6, 9, 12, 18 and 24 h. The RPA‐CRISPR/Cas12a‐based fluorescent and lateral flow assays were then performed in the thermos cup with warm water at 37 °C. The DNA template utilized in the RPA assay was derived from the crude DNA extraction.

Double and quadruple concentrations of Cas12a (100 and 200 nm), crRNA (100 and 200 nm), and FQ reporters (400 and 800 nm) were used to improve the fluorescence intensity of the RPA‐CRISPR/Cas12a reaction after keeping the reagents on ice for 12, 18, or 24 h.

The fluorescence was observed under blue light using the blue LED transilluminator and under UV light using a portable mini‐UV torch.

2.11. Statistical analysis

All experiments were conducted in triplicate. SPSS software (version 25.0, SPSS Inc., Chicago, IL, USA) was employed to calculate the statistical significance. Duncan's multiple range test (P < 0.05) was performed to detect statistically significant differences in the fluorescence intensity of RPA‐CRISPR/Cas12a reactions. GraphPad Prism (version 6.01, GraphPad Software Inc., San Diego, CA, USA) was used to generate the graphs.

3. RESULTS

3.1. Primer and crRNA specificity

Eleven species of mealybug, including papaya mealybug, were amplified using the RPA‐specific designed primers and subjected to CRISPR‐Cas12a fluorescence detection and lateral flow assays. A specific band of 460 bp was exhibited in the papaya mealybug, while no specific bands were exhibited in the other mealybugs and the control (Fig. S2), therefore the specific RPA primer pair (Pm‐RPA‐F and Pm‐RPA‐R) was used for subsequent amplification assays. The assay with papaya mealybugs produced the strongest fluorescence signal, whereas the other mealybugs and the blank control did not produce significant fluorescence signals (Fig. 2(A)). Under blue light, only the papaya mealybug sample tube displayed a positive color reaction, whereas the other mealybugs and the blank control displayed no color (Fig. 2(B)). The results of the RPA/Cas12a‐based lateral flow assay showed that only the papaya mealybug had a positive detection band (T line), whereas the other mealybugs and the blank control had no detection band in the T line (Figs 2(C) and S3).

Figure 2.

Evaluation of the specificity of the RPA/CRISPR‐Cas12a‐based fluorescent assay and lateral flow assay to distinguish P. marginatus from 10 other mealybug species. (A) Fluorescence intensity detection. (B) Fluorescence visualization under blue light. (C) Results of test strips with the LF‐reporter. No.1–No.11 correspond to samples of Paracoccus marginatus, Phenacoccus solani, Phenacoccus solenopsis, Planococcus minor, Planococcus lilacinus, Dysmicoccus neobrevipes, Pseudococcus jackbeardsleyi, Pseudococcus cryptus, Planococcus citri, Dysmicoccus boninsis, and Pseudococcus odermatti, respectively. Two other replicate results from test strips are shown in Fig. S3. CK, water as the control; CRISPR, clustered regularly interspaced short palindromic repeats; RPA, recombinant polymerase amplification.

3.2. Optimal RPA reaction time

To develop a rapid detection method, determining the optimal reaction time for the RPA reaction is crucial. The results showed that the fluorescence intensity of the assay increased with the RPA reaction time up to 35 min. The fluorescence intensity of the assay with products of the 40 min RPA reaction time was significantly lower than that at 35 min (Fig. 3), therefore the optimal RPA reaction time for this assay was set at 35 min.

Figure 3.

Effects of different RPA reaction times on RPR‐CRISPR/Cas12a assay. (A) Fluorescence intensity detection using a fluorescent quantitative PCR instrument. (B) Fluorescence visualization under blue light. Data are mean ± standard error (SE), n = 3 replicates. Different letters indicate significant differences at P < 0.05, as determined by Duncan's multiple range test. CRISPR, clustered regularly interspaced short palindromic repeats; RPA, recombinant polymerase amplification.

3.3. Optimization of CRISPR/Cas12 assay

The Cas12a/crRNA ratio was then optimized. The results showed no significant differences in the fluorescence signal accumulation at ratios of 1:1, 1:4, and 1:6. However, fluorescence signal accumulation at a ratio of 1:2 was significantly lower than that at a ratio of 1:6, therefore the optimal Cas12a/crRNA ratio was set at 1:1 (Fig. 4(A)). After establishing the optimal Cas12a/crRNA ratio, the optimal Cas12a concentration was determined. The fluorescence signal peaked at 50 nm Cas12a, which was determined to be the optimal concentration for this reaction (Fig. 4(B)). Accordingly, the optimal concentrations of Cas12a and crRNA were both established at 50 nm. Finally, the optimal ssDNA concentration was determined. In the fluorescence assay, the fluorescence intensity displayed a positive correlation with the concentration of the FQ‐reporter (Fig. 4(C)). The fluorescence intensity was relatively clear under blue light when the concentration of FQ reporter was ≥200 nm (Fig. 4(C)), therefore the final concentration of FQ reporter was set at 200 nm.

Figure 4.

Optimization of the CRISPR/Cas12a assay through the evaluation of the fluorescence signals across varying concentration gradients of reaction components. (A) Fluorescence signals at different Cas12/crRNA ratios. (B) Fluorescence signals at various Cas12a concentrations. (C) Fluorescence signals at different FQ reporter concentrations (50, 100 200, 300, 400, 500, 600, 800, 1000, 2000, and 3000 nm). Data are mean ± standard error (SE), n = 3 replicates. Different letters indicate significant differences at P < 0.05, as determined by Duncan's multiple range test. CK, water as the control; CRISPR, clustered regularly interspaced short palindromic repeats; crRNA, CRISPR RNA; FQ, fluorophore quencher‐labeled.

The specificity of the optimal RPA‐CRISPR/Cas12a assay for the detection of the papaya mealybug was investigated. The results demonstrated that the fluorescence signal was exclusively detected in the assay containing the papaya mealybug (Fig. S4).

3.4. Optimization of lateral flow assay

The lateral flow assay was optimized by varying the LF reporter concentration and cleavage time. The T line appeared darker at higher LF reporter concentrations and longer cleavage times (Figs 5 and S5). The deepest T‐line color was observed 30 min after cleavage. When the cleavage time was 10 min, the T‐line darkened with increasing LF reporter concentration (Figs 5(A) and S5(A)). When the cleavage time was 20 or 30 min, there were no significant differences in the T‐line color among the assays with various concentrations of the LF reporter (Figs 5(B),(C) and S5(B),(C)).

Figure 5.

Lateral flow assay with different lateral flow (LF) reporter concentration and cleavage time. (A) Cleavage time was 10 min, (B) 20 min, and (C) 30 min. The LF reporter concentrations were 50, 100, 200, 400, 800, and 1000 nm. Two other replicate results from test strips are shown in Fig. S5.

3.5. Universal amplification assay

The optimal RPA‐CRISPR/Cas12a based assay with crude DNA extraction detected all stages of the papaya mealybugs. The results showed that intense fluorescence under blue light was observed in the assays with DNA from all stages of P. marginatus (Fig. 6(A)). In the lateral flow assay, the T‐line on the lateral flow strip was observed to appear in all stages of P. marginatus (Figs 6(B) and S6).

Figure 6.

Detection of all stages of papaya mealybug using RPA/CRISPR‐Cas12a assay with crude DNA extraction. Detection was performed by fluorescence visualization under blue light (A) and a lateral flow assay (B). Two other replicate results from test strips are shown in Fig. S6. CK, water as the control; CRISPR, clustered regularly interspaced short palindromic repeats; E, egg; F, female; L1, first‐instar larva; L2, second‐instar larva; L3, third‐instar larva; M, male; P, pupae; RPA, recombinant polymerase amplification.

3.6. Portable thermos cup for field detection

The established RPA/Cas12a assay was employed for the detection of papaya mealybugs in the field. The RPA‐CRISPR/Cas12a assay, as previously described, demonstrated discernible fluorescence under blue light and the mini‐UV torch when the reagents were maintained on ice for 3, 6, and 9 h in the portable thermos cup (Fig. 7(A),(B)). However, the fluorescence was relatively weak when the reagents were stored on ice for 12, 18, and 24 h. When the concentrations of Cas12a, crRNA, and FQ reporter were doubled and quadrupled, an increase in fluorescence intensity was observed when the reagents were stored on ice for 12, 18, and 24 h, respectively (Fig. 7(C),(D)).

Figure 7.

Stability of RPA, Cas12a, and crRNA in a thermo cup with ice at different intervals. The fluorescence was visualized under blue light (A) using a portable mini‐UV torch (B). Fluorescence was visualized after doubling and quadrupling the concentrations of Cas12a, crRNA, and the fluorophore quencher‐labeled (FQ) reporter under blue light (C) and a portable mini‐UV torch (D). x1, optimal concentration of Cas12a, crRNA, and FQ reporter; x2, double the concentration of Cas12a, crRNA, and FQ reporter; x4, quadruple the concentration of Cas12a, crRNA, and FQ reporter. CRISPR, clustered regularly interspaced short palindromic repeats; FQ, RPA, recombinant polymerase amplification.

4. DISCUSSION

Paracoccus marginatus is an invasive and harmful pest that causes significant economic loss in many countries. The species is challenging to identify due to its small size and morphological similarity to other mealybugs. This necessitates the involvement of specialists, which is a time‐consuming process, therefore there is an urgent need for rapid and sensitive molecular identification methods. The RPA‐CRISPR/Cas12a system is advantageous over other molecular detection technologies owing to its simplicity, speed, sensitivity, and lack of instrumentation. ²⁶ , ²⁹

This study presents the development of an assay for the rapid and simple detection of P. marginatus without instrumentation in field or resource‐limited settings, based on the RPA‐CRISPR/Cas 12a system. In our study, the target gene 28S rDNA was employed for screening RPA primers and designing crRNA. Mitochondrial sequences, including COI, 16S rDNA, and ITS2 rDNA genes, are frequently employed in molecular identification techiques. ²⁵ , ³⁰ In some cases, alternative mitochondrial genes were used, such as NADH dehydrogenase subunit 2, which was used to design primers and crRNA for the purpose of distinguishing Liposcelis bostrychophila at the intraspecific level. ²⁶ Additionally, 28S rDNA has been used as a marker for species differentiation, representing a highly effective supplementary DNA sequence to cox1 mtDNA as recommended by the International Barcode of Life. ³¹ In our previous study, specific primers on 28S rDNA for PCR were able to distinguish the papaya mealybug from other mealybugs, ²⁸ therefore the primers and crRNA in this study were also designed based on 28S rDNA of the papaya mealybug. The specific RPA primers and crRNA could distinguish papaya mealybugs from 10 other mealybugs. The RPA‐CRISPR/Cas 12a‐based fluorescent assay for detecting papaya mealybug can be completed within 65 min at 37 °C. The lateral flow assay based on RPA‐CRISPR/Cas12a can be completed within 45 min at 37 °C when the concentration of the LF‐reporter is relatively high (800–1000 nm).

DNA extraction is necessary before performing RPA. A quick and simple DNA extraction method was combined with an RPA‐CRISPR/Cas 12a assay to detect papaya mealybugs in the field. In this study, kit‐based DNA was used in the establishment and optimization of the RPA‐CRISPR/Cas 12a system. The crude extraction‐based DNA was used in the construction of a comprehensive detection system, which could be applied in the field. In other studies, the kit was typically used for the extraction of genomic DNA from insects. ³² In certain instances, a rapid DNA extraction method was employed. However, a water bath set at 95 °C was used for the incubation of the centrifuge tube with tris‐EDTA (TE buffer and body fluid from detected insects. ²⁶ , ³⁰ , ³³ The primary advantage of the crude DNA extraction method employed in this study is its ability to markedly reduce the overall extraction time to a mere 5 min, in comparison to the approximately 3 h required by traditional DNA extraction kits. Secondly, the reagents used in the crude DNA extraction could be stored at room temperature for up to 1 year. ²⁷ Furthermore, this method does not require laboratory instrumentation such as water bath and centrifuge.

When applying CRISPR/Cas12a in the field, the required reagents must be stored at low temperatures. In this study, a temperature display thermos cup was used to store the reagents with ice and provide the RPA‐CRISPR/Cas12a reaction temperature with warm water at 37 °C. Alon et al. ²⁵ tested the stability of detection reactions during storage. The results showed that reagents stored at room temperature lost activity after 24 h, while reagents maintained at 4 °C lost activity between 48 and 168 h. ²⁵ In this study, field detection was conducted using an affordable and portable thermos cup with a temperature display and mini‐UV torch. These two ‘devices’ could provide field detection for at least 24 h. The stability of the reagents kept in the thermos cup was limited, but increasing the reagent quantity could address this problem to some extent. When the fieldwork was of a greater duration, it was possible to combine the Cas12a, crRNA, and FQ‐reporter at a high concentration (200, 200 and 800 nm, respectively). It may be possible to develop other portable and compact devices that can store reagents for longer periods of time in the field. Furthermore, the development of lyophilized reagents would allow for an extension of storage periods and a reduction in CRISPR reaction time. ³⁴ , ³⁵

The RPA‐CRISPR/Cas12a assay described in this study is a rapid method, with an RPA reaction time of 35 min and a CRISPR/Cas12a assay time of 30 min (fluorescence) or 10 min (lateral flow strips). The majority of studies also indicated that the RPA‐CRISPR/Cas12a assay reaction time was less than 1 h. ²⁶ , ³⁰ , ³² , ³³ Overall, the RPA‐CRISPR/Cas12a technique has the notable advantage of significantly reducing the time required for detection, in comparison to traditional morphology‐based identification and molecular detection methods, such as PCR, probe‐based quantitative PCR (qPCR), and RT‐qPCR.

However, applying RPA‐CRISPR/Cas12a assays to rapidly detect papaya mealybugs presents some challenges. First, it should be noted that RPA reagents are currently only commercially available from a single supplier, which may create a potential bottleneck in supply. Second, the costs of a single detection reaction were approximately 13.66 yuan (fluorescence visualization) and 33.66 yuan (lateral flow test strip). The cost of the lateral flow test strips was higher than that of fluorescence visualization. The RPA reagents and test strips accounted for the majority of the total cost. Alon et al. ²⁵ estimated that the cost per reaction for B. zonata detection was approximately 1.6 dollars. However, it is possible that the prices of the reagents and strips may decrease if the supplier increases or the purchaser acquires them in substantial quantities.

5. CONCLUSION

In conclusion, this study combined crude DNA extraction, RPA, and CRISPR/Cas12a technologies to develop, for the first time, an assay to detect papaya mealybugs in a short time (approximately 1 h) using a portable thermos cup. The identification results could be determined by naked eye. This assay has great potential for further application in the rapid detection of papaya mealybugs in the field or in other resource‐limited settings. This could potentially assist in monitoring and preventing invasions by P. marginatus.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

Supporting information

Figure S1. Partial 28S DNA with the detail sequence information of the designed primers (Pm‐RPA‐F and Pm‐RPA‐R) (A) and crRNA (Pm‐crRNA) targeting sequences (B).

Figure S2. Agarose gel electrophoresis of RPA products. No.1–No.12 correspond to samples of Paracoccus marginatus, Phenacoccus solani, Phenacoccus solenopsis, Planococcus minor, Planococcus lilacinus, Dysmicoccus neobrevipes, Pseudococcus jackbeardsleyi, Pseudococcus cryptus, Planococcus citri, Dysmicoccus boninsis, Pseudococcus odermatti, and water, respectively.

Figure S3. Results of test strips with the LF reporter. No.1‐No.11 correspond to samples of Paracoccus marginatus, Phenacoccus solani, Phenacoccus solenopsis, Planococcus minor, Planococcus lilacinus, Dysmicoccus neobrevipes, Pseudococcus jackbeardsleyi, Pseudococcus cryptus, Planococcus citri, Dysmicoccus boninsis, and Pseudococcus odermatti, respectively. CK: water as the control.

Figure S4. Evaluation of the specificity of the optimal RPA/CRISPR‐Cas12a‐based fluorescent assay to distinguish P. marginatus from 10 other mealybug species. No.1‐No.11 correspond to samples of Paracoccus marginatus, Phenacoccus solani, Phenacoccus solenopsis, Planococcus minor, Planococcus lilacinus, Dysmicoccus neobrevipes, Pseudococcus jackbeardsleyi, Pseudococcus cryptus, Planococcus citri, Dysmicoccus boninsis, and Pseudococcus odermatti, respectively. CK: water as the control.

Figure S5. Lateral flow assay with different LF reporter concentration and cleavage time. (A) Cleavage time was 10 min, (B) 20 min, and (C) 30 min.

Figure S6. Detection of all stages of papaya mealybug using RPA/CRISPR‐Cas12a based lateral flow assay with crude DNA extraction. E, egg; L1, first‐instar larva; L2, second‐instar larva; L3, third‐instar larva; P, pupae; F, female; M, male.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.