Proliferation and differentiation of Wharton’s jelly-derived mesenchymal stem cells on prgf-treated hydrogel scaffold

ABSTRACT

Background

To address the limitations of Cultivated Limbal Epithelial Transplantation (CLET) and the use of amniotic membrane (AM) in treating Limbal Stem Cell Deficiency (LSCD), we aimed to develop a Collagen/Silk Fibroin (Co/SF) scaffold enriched with Platelet-Rich Growth Factor (PRGF) to support the proliferation, maintenance, and differentiation of Wharton’s jelly-derived mesenchymal stem cells (WJMSCs) into corneal epithelial cells (CECs).

Method

Scaffolds loaded with PRGF were evaluated through release studies, cytotoxicity assays, and cell differentiation. The proliferation and differentiation of WJMSCs and Limbal Epithelial Stem Cells (LESCs) were investigated using MTT assays, real-time PCR and immunostaining.

Results

The PRGF-loaded Co/SF scaffold significantly promoted the proliferation of both WJMSCs and LESCs in a concentration-dependent manner. Real-time PCR and immune staining revealed a significant increase in the expression of P63, ABCG2, and cytokeratin 3/12 markers in WJMSCs, a significant decrease in the expression of P63 and ABCG2, and a significant increase in the expression of cytokeratin 3/12 markers indicating successful differentiation into CECs.

Conclusion

The WJMSC cultured on PRGF-enriched Co/SF scaffold demonstrates potential as a viable alternative to conventional CLET, offering a promising strategy for corneal tissue regeneration.

1. Introduction

LESCs in the corneal limbus help to rejuvenate the corneal epithelium and keep the cornea clear and avascular. [1,2]. Loss of the cells or their niches can cause LESC deficiency (LSCD) and visual impairment. CLET has been demonstrated to successfully treat LSCD, with a 70% success rate in LSCD [3]. In this method small part of limbal biopsy is grown ex vivo on human AM and then transplanted into the patient’s damaged eye [4–6]. Despite the good performance of HAM due to its anti-inflammatory, antibacterial and anti-angiogenic features [5,7], using AM in ocular tissue engineering has some limitations such as: the lack of donors and disease transmission [8], inappropriate thickness, unfavorable physical and mechanical properties, high priced and difficult laboratory processing [7–10].

Recent advancements in tissue engineering have shifted the composition of scaffolds from synthetic materials to more biodegradable and less toxic natural materials. Additionally, scaffold designs have improved to better mimic the spatial conformation of the natural extracellular matrix. The latest innovation includes the use of hydrogels, enabling the development of highly customizable and flexible hydrogel scaffolds [11]. Various hydrogel scaffolds have been developed to transfer cells, growth factors and drugs in corneal tissue engineering [3,12], which can deliver the signals required for the differentiation and proliferation of stem cells. Numerous research investigated these scaffolds in terms of potential therapeutic treatments for corneal diseases. Each of them is associated with several inherent advantages and drawbacks [11]. Cell adhesiveness, biocompatibility, biodegradability, and availability have proposed collagen as a successful option in corneal tissue regeneration [13,14]. Collagen extracted from fish skin because of low immunogenicity, disease-free transmission, high biodegradability and appropriate solubility has superiority to mammalian source [15,16]. The mechanical weakness of collagen-based scaffolds has led to the use of other biomaterial additives such as SF or crosslinkers to improve their properties [17–20]. The studies showed that the fish skin-derived Collagen scaffold with a small amount of silk fibroin additive reduces the need for large amounts of chemical crosslinkers such as carbodiimides, which can ultimately improve the cellular performance of the scaffolds [12,21].

In addition to scaffolds, growth factors can also help the tissue regeneration process. PRGF derived from platelet-rich plasma (PRP) is a significant source of endogenous growth factors [22]. PRGF has been widely employed in various species to accelerate healing and enhance tissue regeneration [23,24]. The positive effects of PRGF are controlled by the degranulation of alpha granules in platelets [25,26], which contain a diversity of growth factors that accelerate cell growth, proliferation, and differentiation [27,28]. PRGF, including platelet-derived growth factor (PDGF), nerve growth factor (NGF), epithelial growth factor (EGF), and fibroblast growth factor (FGF) maintains the ocular surface. The effectiveness of PRGF was evaluated in promoting adipocyte-derived stem cell (ADSCs) migration, proliferation, differentiation, and survival [29].

Plasma rich in growth factors (PRGF) is an enhanced form of platelet-rich plasma (PRP) that has been extensively used in treating various ophthalmological conditions [6]. PRGF possesses several notable biological properties, including lubricating, immunomodulatory, regenerative, and bacteriostatic effects. Furthermore, the safety of PRGF treatment has been well established through numerous clinical and preclinical studies [30–33].

LSC transplantation from the opposite eye can treat unilateral LSCD caused by the loss or inability to function of LSCs [34]. Patients with bilateral LSCD are treated with allogeneic LSCs, which may results in graft rejection [35,36]. Damaged limbal/corneal epithelium may be repaired or substituted by stem cells [37] for instance mesenchymal stem cells (MSCs) [38,39], embryonic stem cells (ESCs) [40] or induced pluripotent stem cells (iPSCs) [41]. Umbilical cord-derived mesenchymal stem cells (UC-MSCs) offer advantages over other sources of stem cells since they are less immunogenic, less tumorigenic, less ethically problem [37,42]. UC-MSCs are able to differentiate into osteoblasts, adipocytes, and chondroblast. Studies have shown these cells are capable of developing hepatocytes [43], oligodendrocytes [44] neurons [45], oligodendrocytes [44], corneal endothelium [46], and cardiomyocytes [47] as well. Within the umbilical cord, gelatinous material _Wharton’s jelly (WJ)_ contains stromal cells that resemble myofibroblasts. WJMSCs are a distinct cell population of mesenchymal stromal cells that are proposed to have stemness traits. Evidence is mounting that WJMSCs have numerous potential benefits as transplantable cells for treating a variety of illnesses, including cancer [48,49], liver disease [50], cardiovascular conditions [51], injuries to nerves [52,53], and cartilage [54].

Our previous study [55] has demonstrated that fish skin-derived Collagen with a small quantity of SF additive can be an ideal substrate with acceptable physical, mechanical, and biological qualities for culture of CECs. The study focuses on developing a novel Co/SF scaffold enriched with PRGF, a rich source of growth factors, offering a promising alternative that enhances the proliferation and differentiation of WJMSCs into CECs. Additionally, we compared the traditional approach of LSCs cultured on AM with WJMSCs cultured on Co/SF/PRGF scaffolds through various analyses, including cell proliferation assays, Real-time PCR, and immunostaining.

2. Materials and methods

2.1. Preparation of Co/SF scaffold

Fish skin-derived collagen and silk fibroin were extracted as the primary materials for preparing the Co/SF scaffold, based on a previously established method. Briefly, fish fat, non-collagenous proteins, and pigments were removed by treating the skin with 10% n-butyl alcohol and 0.1 M NaOH. The skin was then swollen in 0.5 M acetic acid and subjected to filtration and centrifugation at 4°C for 30 minutes at 11,000 g. Collagen was precipitated by adding 2.5 M NaCl to the solution, followed by centrifugation at 4°C for 20 minutes at 11,000 g. The resulting precipitate was re-dissolved in 0.5 M acetic acid and dialyzed – first against 0.1 M acetic acid for one day, then against deionized water for two days. Finally, the collagen was lyophilized and stored at −4°C [56]. In the previous study, silk fibroin was extracted using a traditional technique. Silk cocoons were degummed in a Na₂CO₃ solution for 30 minutes and then dissolved in 9.3 M LiBr at 60°C for 4 hours. The resulting fibroin solution was dialyzed for 72 hours using a 12 kDa dialysis membrane, followed by centrifugation at room temperature for 10 minutes at 1000 g [55]. In this research, we used the optimal scaffold design based on previous studies, which demonstrated favorable physical, mechanical, and biological properties for corneal tissue engineering. The scaffold consisted of (Co/SF, 98/2) [55]. The hydrogel solution was molded into 24 well plates and, after dried for 24 h at room temperature, immersed in a 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) crosslinker solution (0.06% w/v in ethanol/water (90/10)). The crosslinked samples were washed and stored for PRGF loading.

2.2. Preparation of the PRGF

The preparation of PRGF involved extracting 9 milliliters of blood from each healthy male volunteer, aged between 27 and 67 years (ethical code: IR.NIMAD.REC.1398.363). The blood was drawn into vacutainers containing 10% sodium citrate as an anticoagulant, followed by centrifugation at 850 g for 8 minutes to separate the three layers. The plasma layer was transferred to a second tube and centrifuged again at 500 g for 10 minutes at 4°C. 2 ml of plasma at the down of the tube and the precipitated platelets as inactivated PRGF were transferred to another glass tube. The PRGF was then activated by adding 0.2 ml of 10% calcium chloride, and the solution was stored at 4°C for 48 hours to allow any potential deposits to form. Finally, the PRGF was preserved at −80°C until use [57]. For PRGF treatment, the hydrogel scaffolds were immersed in different concentrations of (20, 36, and 56 μg/ml) (5, 9, and 14 µl) PRGF for 24 h at 4°C. Figure 1 schematically illustrates the process used in this study.

Figure 1.

Schematic of the process of preparing hydrogel scaffold impregnated with growth factor.

(a) Collagen Extraction: Collagen was isolated from fish skin, purified, precipitated, dialyzed, and lyophilized, (b) Silk Fibroin Extraction: Silk fibroin from Bombyx mori cocoons was degummed, dissolved in lithium bromide, dialyzed, and purified, (c) PRGF Preparation: PRGF was prepared from blood through two centrifugation steps. Platelets were precipitated, activated with calcium chloride, (d) Wharton Jelly Stem Cell Isolation: Stem cells were isolated from Wharton Jelly using an enzymatic method.

2.3. Preparation of human AM

AM were obtained following cesarean deliveries at Taleghani Hospital (SBMU, IRAN)/Cesarean section (ethical code: IR.NIMAD.REC.1398.363). Informed consent was obtained from each donor, and the membranes were screened for infectious diseases, including syphilis, hepatitis B and C, and human immunodeficiency virus. The membranes were then rinsed in PBS containing penicillin and streptomycin. To remove the epithelial layer, the membranes were treated with 0.25% trypsin and 0.02% EDTA [58].

2.4. Protein release

Disc-shaped scaffolds (2 cm in diameter and 100 µm in thickness) were incubated at 37°C with moderate shaking for the following time points: 6 and 12 hours, one to 14 days. To determine the cumulative protein release, 100 μL aliquots were collected at each time point and cryopreserved. Simultaneously, 100 μL of PBS was added to maintain a total volume of 1 mL. Protein quantification in each sample was performed using a micro-BCA assay, with absorbance measured at 570 nm using a microplate reader (BioTek, USA). The absorbance values for the control hydrogel scaffolds were used to normalize the readings of PRGF-containing scaffolds. The BSA standard curve was used to convert the absorbance data to μg/mL, allowing for quantification of the released protein in each sample [59].

2.5. Cell studies

2.5.1. Isolation & characterization of WJSCs

After obtaining informed consent and following the guidelines set by the Iran National Committee on Ethics in Biomedical Research (ethical code: IR.NIMAD.REC.1398.363), human umbilical cords from full-term cesarean births were collected. Human umbilical cord cells were isolated using an enzymatic procedure. The umbilical cords were first washed in 70% alcohol for 30 seconds, cut into manageable pieces, and the veins were separated after washing in HBSS buffer. The Wharton’s jelly was then divided into 1–2 mm pieces and placed in a Falcon tube containing 2 mg/ml collagenase II, 1.2 units/ml dispase II, and 0.25% trypsin/EDTA (Gibco, USA). The samples were centrifuged for 10 minutes at 300 g and incubated for 3 hours at 37°C [60]. Following the manufacturer’s recommendations, flow cytometry was used to examine the expression of WJMSCs markers. WJMSCs at passage 3 were trypsinized and centrifuged. A 100 μL cell suspension containing 6000 cells was treated for 30 minutes with primary labeled antibodies: FITC (fluorescein isothiocyanate)-conjugated anti-CD166, anti-CD90, anti-CD45, and anti-CD34, as well as PE (phycoerythrin)-conjugated anti-CD31, anti-CD73, anti-CD105, and anti-CD44 antibodies (all from Abcam, UK, Cambridge). The data were analyzed using FlowJo software (Tree Star Inc., Ashland, USA) [61].

At designated passages during the exponential phase of expansion, when the cells reached 65–75% confluence, metaphase chromosomal spreads were obtained from the cultures. Colcemid (Boehringer Mannheim GMBH) at a concentration of 10 μL/mL was added to the cell cultures, and they were incubated for 2 hours at 37°C. The cells were trypsinized to detach them from the culture flask, and then washed with PBS. The cells were subsequently incubated in 0.075 mol/L KCl for 15 minutes at 37°C. After incubation, the cells were fixed with methanol/acetic acid and examined. An automated imaging system for cytogenetics was used to capture images of individual metaphase spreads and karyotypes.

2.5.2. Cytotoxicity study

The proliferation rate of hWJMSCs on scaffolds containing various doses of PRGF was evaluated using the MTT assay (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide; Sigma, Germany). The scaffolds, with different PRGF concentrations, placed in a 24-well plate and were UV sterilized. Each well was seeded with 5 × 10³ cells in 500 μL of DMEM-F12 supplemented with 5% FBS, 2 mm glutamine, and 1% penicillin-streptomycin (100 μg/mL), and incubated for 14 days at 37°C, 5% CO₂, and 95% humidity. Tissue culture polystyrene (TCPS) without any scaffold was used as a control. The experiment was conducted in triplicates. On days 1, 3, 7, and 14, the culture medium was replaced with fresh media and 50 μL of MTT solution (5 mg/mL in DMEM), followed by incubation at 37°C for 4 hours. The mitochondrial succinate dehydrogenases in live cells converted the MTT into formazan crystals. After removing the medium, dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) was added to dissolve the formazan crystals. The optical density was measured at 570 nm using a microplate spectrophotometer (BioTech, ELx800, USA) [62].

2.5.3. Cell adhesion

To assess cell morphology and adhesion on hydrogel scaffolds, 5,000 hWJMSCs were cultured on scaffolds with a diameter of 2 cm. The cells were grown in DMEM-F12 supplemented with 5% FBS, 2 mm glutamine, and 1% penicillin-streptomycin (100 μg/mL) at 37°C in 5% CO₂. Phase-contrast microscopy was used to examine the scaffolds before they were fixed in 2.5% glutaraldehyde for 2 hours at 4°C. After fixation, the scaffolds were washed with PBS for 5 minutes and dehydrated using a series of ethanol-based solutions. Once fully dehydrated, the scaffolds were coated with a gold layer (Joel Fine Coat, ion sputter for 2 hours) to enhance surface conductivity and then analyzed using scanning electron microscopy (SEM) (Philips XL30; Philips, Netherlands) at an accelerated voltage of 25 kV.

2.5.4. Culture of human limbal epithelial cells

Corneas from cadaver donors were provided by the Iranian eye Bank to obtain limbal biopsies. The procedures were approved by the Ethics Committee at the National Institute for Medical Research Development (IR.NIMAD.REC.1398.363). The average age of the tissue samples was 44 years. To remove the endothelial cell layer, the inner surface of the corneal biopsy was scraped using a No. 21 surgical knife-edge. The limbal ring was isolated by removing excess corneal and scleral tissue. The isolated limbal ring was then sectioned into smaller pieces and cultured in an explant system on either an AM and the Co/SF/PRGF2 scaffold. The cultures were maintained in DMEM medium supplemented with 5% FBS, 2 mm glutamine, and 1% penicillin-streptomycin [37].

2.5.5. Gene expression analysis

The expression of ABCG2 and P63 as putative stem cell markers, and cytokeratin (CK3 and CK12) as differentiation markers, was analyzed using quantitative real-time PCR (qRT-PCR). After 9 days of culture for hWJMSCs and 17 days for limbal stem cells on Co/SF, Co/SF/PRGF, AM, and TCPS groups, RNA was extracted following the manufacturer’s instructions (Favorgen, Taiwan). Total cDNA was synthesized using a cDNA synthesis kit (Vivantis, Malaysia).

qRT-PCR was conducted using a high ROX SYBR Green master mix (Ampliqon, Denmark) in a StepOnePlus™ system (Applied Biosystems, USA). The amplification protocol consisted of 40 cycles at 95°C for 15 seconds, followed by 60°C for 10 minutes. The housekeeping gene GAPDH was used to normalize relative expression levels. Data were analyzed using the comparative CT (ΔΔCT) method to determine relative gene expression [59]. The primer sequences used in this study are listed in Table 1.

Table 1.

Primers sequences used in qRT-pcr analysis.

Gene	Primer sequences 5’-3’
CK3	F: AAGGACCCTCTACGACGCT R: CCAGGTCCAGGGAGCGAT
CK12	F: CTTCACAGAGCGATTACAGCA R: TCCTCAGCAGCTAGTCTCG
ABCG2	F: GCATTTACTGAAGGAGCTGTG R: GACCAGGTTTCATGATCCCA
P63	F: TGACCCTTACATCCAGCGTT R: CTGGAAAACCTCTGGACTGA

2.5.6. Immunostaining

Cells were fixed in cold 4% paraformaldehyde (PFA) (Sigma-Aldrich, USA) for 20 minutes, followed by three washes with PBS. To permeabilize the cells, 0.1% Triton X-100 (Sigma-Aldrich) was applied for 30 minutes. Non-specific binding sites were blocked by incubating the samples with 1% (w/v) BSA in PBS (Sigma-Aldrich, USA) for 40 minutes. The primary antibodies, including BCRP/ABCG2, cytokeratin (CK3/12), and anti-p63, were applied to the samples and incubated overnight at 4°C. The next day, the samples were incubated with the secondary antibody at room temperature for 1 hour. Table 2 lists the details of the antibodies used. Nuclei were stained with DAPI (1 µg/mL; 4′,6-diamidino-2-phenylindole, Sigma-Aldrich, USA) and the samples were examined using fluorescence microscopy (Nikon DIGITAL CAMERA DXm1200F, USA).

Table 2.

Antibodies used in immunofluorescence staining.

Antibodies	Dilution	Source	Cat #
Anti-p63	1/300	Abcam	ab97865
Anti-Cytokeratin (CK3/12)	1/100	Abcam	ab68260
Anti-BCRP/ABCG2	1/100	Abcam	ab24115
Anti-BCRP/ABCG2	1/300	Abcam	ab229193
Secondary antibody Goat F(ab) Anti-Mouse IgG H&L	1/1000	Abcam	Ab30829
Secondary antibody Donkey Anti-Rabbit IgG H&L	1/1000	Abcam	ab150068
Secondary antibody Donkey Anti-Rat IgG H&L	1/1000	Abcam	ab150155

2.6. Statistical analysis

The gene expression analysis was evaluated using REST 2009 (Qiagen, Germany). The reported data were expressed as means ± standard deviation (SD). The means between multiple groups were compared using one-way and two-way ANOVA (Graph Pad Prism 4.0, US). Statistical significance was considered to be present at p < 0.05.

3. Results and discussion

The total protein released from Co/SF hydrogel scaffolds with different concentrations of PRGF was monitored for 14 days in PBS at 37°C using the BCA assay. Figure 2 illustrates the cumulative release profile of PRGF. All groups exhibited an initial burst release of approximately 30% on the first day, followed by a controlled release of PRGF over the duration of the study. By the end of the 14-day period, the maximum cumulative releases observed were 78%, 82%, and 86%, corresponding to PRGF concentrations of 16 μg/mL (PRGF1), 28 μg/mL (PRGF2), and 47 μg/mL (PRGF3), respectively. All time points for PRGF1, PRGF2, and PRGF3 were performed in triplicates. However, in some cases, the standard deviations (SDs) are present but appear to be hidden behind the data markers due to their small size, making them less visible in the figure.

Figure 2.

Cumulative release pattern of PRGF from Co/SF/PRGF scaffolds: (a) the percentage of cumulative release was monitored for up to 336 hours (14 days) after scaffold placement in PBS. The maximum release at the end of the 14-day period was found to be 78% (PRGF1), 82% (PRGF2), and 86% (PRGF3). (b) The cumulative protein concentration at day 14 is shown. In the PRGF1, PRGF2, and PRGF3 samples, approximately 16 μg/mL, 28 μg/mL, and 47 μg/mL of protein were released from the scaffolds, respectively. Notably, the initial PRGF load in the PRGF1, PRGF2, and PRGF3 samples was 20 μg/mL, 35 μg/mL, and 55 μg/mL, respectively.

According to the phenotypic observations in Figure 3(a), the isolated WJMSCs at the first passage exhibited a heterogeneous population. However, at the third passage, elongated fibroblast-like MSCs became the dominant population of cultured cells (Figure 3(b)). As indicated in Figure 3(c), no karyotypic anomalies were detected in the MSC populations. Flow cytometry analysis showed that these cells lacked the expression of CD34 (hematopoietic stem cell antigen), CD31, and CD45 (leukocyte common antigen), while being positive for MSC markers such as CD90 (Thy-1), CD44, CD105 (SH2, endoglin), CD166, and CD73 (SH3), as shown in Figure 3(d).

Figure 3.

WJMSC isolation and characterization: (a) WJMSCs at the first passage and (b) Third passage, showing a transition from a heterogeneous to a dominant elongated fibroblast-like population. (c) Karyotype analysis of WJMSCs showing no anomalies. (d) Flow cytometry analysis of WJMSCs indicating positive expression for CD90, CD44, CD105, CD166, and CD73, and negative expression for CD34, CD31, and CD45. (e) Cell viability on hydrogel scaffolds and TCPS, assessed over a 14-day culture period. (f) Phase contrast and SEM images of hWJMSCs cultured on Co/SF/PRGF2 scaffolds at 3 days (i, ii) and 7 days (iii, iv) post-seeding, and on Co/SF scaffolds at 3 days (v, vi) and 7 days (vii, viii) post-seeding. (g) Phase contrast and SEM images of hWJMSCs cultured on AM at 3 days (a, b) and 7 days (c, d) post-seeding, and acellular AM (e, f).

The cell proliferation rate of hWJMSCs in response to PRGF released from the scaffolds (Co/SF/PRGF1, Co/SF/PRGF2, and Co/SF/PRGF3) was evaluated using the MTT assay (Figure 3(e)). The Co/SF/PRGF2 scaffold showed the highest cell survival rate and the optimal dose for promoting cell proliferation, making it the preferred scaffold for further study. Notably, the cell proliferation rate on day 7 was greater than on day 3. Additionally, cells cultured on the Co/SF/PRGF2 scaffold exhibited higher proliferation on both days 3 and 7 compared to cells on the Co/SF scaffold without PRGF. By day 7, hWJMSCs displayed a heterogeneous morphology on the PRGF-containing scaffold, whereas a homogeneous morphology was observed on the scaffold without PRGF, suggesting that the PRGF-containing scaffold influenced the cells’ differentiation process. The phase contrast and electron microscopy images confirmed each other (Figure 3(f)).

Furthermore, hWJMSCs were cultured on an AM, and Figure 3(g) depicts the population and morphology of the hWJMSCs on the AM on days 3 and 7 post-seeding. Based on the phase-contrast and SEM images shown in Figures 3(f,g), it can be observed that the proliferation rate of hWJMSCs seeded on the Co/SF/PRGF2 scaffold after 3 and 7 days was comparable to the proliferation rate of cells seeded on the AM.

Figure 4(a) demonstrates the morphology of LESCs on the hydrogel scaffolds at days 3, 10, and 17 after seeding. The LESCs adhered well to the scaffolds and exhibited a cuboidal morphology. The microscopic images and karyotype analysis revealed no abnormalities in the LESC population, as shown in Figures 4(b,c).

Figure 4.

Phase contrast images of LESCs explants from limbus on Co/SF/PRGF2 (a-c) and AM (d-f) on days 3 (a and d), 10 (b and e) and 17 (c and f). Limbal stem cells (red arrow) and cells with morphology changes during differentiation into corneal epithelial-like cells (blue arrow) (A). (B) Microscopic image showing the 46 chromosomes of individual human LESCs.(C) karyotype image displaying the 46 chromosomes of individual human LESCs.

qRT-PCR analysis revealed a significant increase in the expression of both p63 (approximately 2-fold) and ABCG2 (approximately 3-fold) genes – markers of putative LESCs – at the mRNA level in hWJMSCs cultured on Co/SF/PRGF2 and AM, compared to the control group (TCPS) (Figure 5(a)). Moreover, specific CEC markers, CK3 and CK12, exhibited a significant increase in mRNA levels in both the AM and Co/SF/PRGF2 groups compared to TCPS (***p ≤ 0.001). A moderate increase in the expression of these markers was also observed in the Co/SF scaffold group compared to TCPS, likely due to the air-lifting culture technique used on the scaffold.

Figure 5.

The relative mRNA expression of P63, ABCG2, CK3, and CK12 during CEC trans-differentiation from WJ-MSCs as measured by real-time PCR. The Co/SF/PRGF2 scaffold and AM groups exhibited higher gene expression levels compared to other groups 9 days after seeding hWJMSCs on Co/SF, Co/SF/PRGF2, AM, and control (TCPS) (a). P63, ABCG2, CK3, and CK12 gene expression at the mRNA level was evaluated by real-time PCR 17 days after explant culture of LESCs on Co/SF, Co/SF/PRGF2, AM, and control group (TCPS) (b). Values represent the mean ± SD of N = 3 replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. Immunostaining was performed on WJ-MSCs and LESCs cultured on Co/SF/PRGF2 scaffolds, AM, and TCPS during their differentiation into CECs. The analysis examined the expression of p63, ABCG2, CK3/12 (red color), and the nucleus (blue color) in WJ-MSCs (c). For LESCs, p63 (red color), ABCG2, CK3/12 (green color), and the nucleus (blue color) were analyzed (d).

In contrast, downregulation of p63 (p ≤ 0.01) and ABCG2 (p ≤ 0.01) genes was observed in LESCs cultured on the Co/SF/PRGF2 and AM groups compared to TCPS. However, LESCs cultured on the Co/SF/PRGF2 scaffold and AM showed significantly higher expression levels of CK3 and CK12 compared to the TCPS group (Figure 5(b)).

During differentiation, notable morphological changes were observed in hWJMSCs, as shown in Figure 5(c). After differentiation, the cells exhibited a morphology resembling epithelial-like cells. A significant increase in the expression of protein markers p63 (nuclear expression) and ABCG2 (cytoplasmic expression) was also observed in MSCs as they differentiated into epithelial cells [63].

p63 and ABCG2 proteins were well expressed in hWJMSCs cultured on PRGF-containing scaffolds and AM 9 days after culture. The observed expression in the Co/SF/PRGF2 scaffold can be attributed to the release of PRGF, while in the AM group, it is likely due to the presence of growth factors and cytokines in the membrane. In contrast, the TCPS group, which lacks differentiating factors, showed very low expression levels of these proteins. The expression of p63 and ABCG2 in hWJMSCs cultured on the Co/SF/PRGF2 scaffold was comparable to that observed in the AM group. hWJMSCs seeded on PRGF-containing scaffolds and AM demonstrated higher expression of CK3 and CK12 proteins, which are specific markers of epithelial cells, compared to the TCPS group.

It is important to note that ABCG2 and p63 are markers of LESCs. As LESCs migrate toward the central cornea and transform into transient amplifying cells, their stem cell markers gradually decrease and eventually disappear. However, CK3 and CK12, which are specifically expressed in CECs, serve as key markers of CECs [64]. Immunostaining was performed on LESCs cultured on Co/SF/PRGF2 scaffolds, AM, and TCPS. After 14 days of culture, the p63 marker was not expressed in the scaffold and AM groups, but it was well expressed in the TCPS group. Furthermore, the expression of ABCG2 was higher in the TCPS group compared to the scaffolds containing PRGF and AM. Conversely, CK3 and CK12 markers showed much stronger expression in the Co/SF/PRGF2 scaffold and AM groups than in the TCPS group. These findings suggest that LESCs cultured on PRGF-containing scaffolds and AM differentiated into CECs, leading to reduced expression of p63 and ABCG2 protein markers, while CK3 and CK12 expression increased in comparison to the TCPS group (Figure 5(d)) [40].

In chronological order, re-epithelialization is the initial step in corneal tissue regeneration. This process is initiated by the activation of migration, proliferation, and differentiation of adjacent epithelial cells. The release of growth factors from the epithelium itself, lacrimal glands, and keratocytes triggers and regulates this process [65]. The components involved in corneal wound healing include those with stimulatory effects, such as EGF, PDGF, TGF-β, and fibronectin, as well as those with suppressive effects, such as HGF [66]. Autologous platelet-rich plasma, known as PRGF-Endoret, can produce various growth factor-enriched formulations, including a collyrium, which may be useful in treating many disorders [67]. PRGF-Endoret has demonstrated therapeutic potential for tissue regeneration in various medical fields, including dental implantology, dentistry, sports medicine, orthopedics, ophthalmology, and dermatology [68–70]. Anitua et al. examined the effects of PRGF on human CECs. Their studies demonstrated that PRGF promotes faster cell proliferation and accelerates wound repair, as evidenced by the fact that the rate of wound closure in CECs treated with PRGF-Endoret formulations is twice as high [68].

V. Freire et al. compared the effects of three blood derivatives – AS2, PRP, and PRGF – on human CECs. Notably, all three preparations contained significant levels of fibronectin. During the healing process, fibronectin/fibrinogen receptors increase in epithelial cells as they migrate across a bare wound [71]. Therefore, the high concentrations of fibronectin in these blood derivatives could facilitate cell migration. Additionally, it has been shown that migrating cells express high levels of the EGF receptor [72]. As a result, the relatively high EGF levels in PRGF may contribute to enhanced wound healing.

hMSCs cultured with PRGF have been examined for its impact on hMSC growth and mineralization. hMSC proliferation significantly increased when PRGF was added to osteogenic induction medium (OIM). Additionally, PRGF enhanced the alkaline phosphatase activity of hMSCs. In hMSCs treated with PRGF, von Kossa and Alizarin Red S staining showed intense mineral deposition. Taken together, these results clearly suggest that PRGF can stimulate bone tissue formation [73]. To promote fibroblast proliferation and migration, Piran et al. developed a three-layered scaffold using the electrospinning method and integrated PRGF. Cell quantification experiments revealed that cells cultured on the three-layered scaffold proliferated at a higher rate than those cultured on a PLLA scaffold. Furthermore, cell migration analysis showed significant migration toward the three-layered scaffold within 48 to 72 hours, followed by a decrease in the migration rate [74].

Shams et al. successfully developed a multilayered film using gelatin fibers containing PRGF for the inner layer, resembling a central strip, and polyurethane-cellulose acetate (PU-CA) fibers for the outer layers. Fluorescence imaging revealed significantly more migratory cells on the PRGF-containing film compared to the PU-CA film. Additionally, the PRGF-containing film exhibited higher expression of reporter genes associated with cell migration compared to the PU-CA film [59]. In medical research, hydrogel films are a commonly used type of hydrogel with applications in soft tissue engineering, drug delivery, and wound healing. These films can be effectively sutured to fit the dimensions of the injured tissue and seamlessly integrate with the surrounding biological tissues [75]. The variation observed among different PRGF batches (PRGF1, PRGF2, and PRGF3) was due to differences in the initial concentration of PRGF. To address this, we adjusted and standardized the concentration by diluting the PRGF with PBS, ensuring comparable conditions across all batches. This allowed us to maintain consistency in the experimental conditions.

In this study, PRGF was cross-linking onto the Co/SF scaffold. To assess cell proliferation and differentiation, WJMSCs cultured on the scaffold. The outcomes were then compared with those obtained from cultured LSCs on AM.

The results from the MTT assay demonstrated that the proliferative response of cells exposed to PRGF was dose-dependent. In contrast, WJMSCs cultured on PRGF1 and PRGF2 scaffolds proliferated at higher rates than those cultured on the Co/SF scaffold and TCPS (*p ≤ 0.05). The number of active cells on the PRGF3 scaffold was lower than on the other scaffolds (*p ≤ 0.05, **p ≤ 0.01). Additionally, the active cell counts in all groups increased between days 3 and 7, but the number of viable cells decreased after day 7.

LSCs and WJMSCs cultured on the Co/SF/PRGF2 scaffold exhibited heterogeneous morphology, consisting of a subpopulation of small cells arranged in compact colonies. This subpopulation may include cells with a less differentiated phenotype, potentially serving as a cellular source for epithelial renewal. These cultures also contained large, flattened cells, likely indicating a more differentiated phenotype. These observations are consistent with earlier reports [76,77] suggesting that the differentiation of cultured corneal cells results in cell flattening and the formation of large epithelial sheets with enhanced intercellular communication. The ability of WJMSCs to modulate the immune system and evade immune detection makes them particularly promising for allogeneic transplantation therapies [78,79]. Furthermore, compared to MSCs derived from bone marrow, placenta, adipose tissue, and cord blood, WJMSCs exhibit better isolation feasibility and a higher capacity for proliferation [79,80].

We successfully isolated and cultured human WJMSCs, meeting the fundamental criteria for human MSCs [81]. These criteria include plastic-adherent cells expressing CD105, CD90, CD44, CD166, and CD73, but not CD31, CD34, or CD45 [79,82]. MSC transplantation has been shown to successfully repair damaged corneal surfaces in rabbits [83], mice [84], rats [82], and humans [85], However, instead of transdifferentiating into different cell types, MSCs primarily function by suppressing inflammation and angiogenesis [86,87]. Specifically, rat corneas transplanted with MSCs do not express CK3 or CK12, markers of corneal epithelial differentiation [86,88], indicating that the potential for MSC transdifferentiation in animal studies remains uncertain.

Several in vitro studies have explored methods for generating CECs from MSCs, such as co-culturing with LESCs [89], CECs [90,91], or using conditioned media derived from limbal explants [92]. These techniques involve cultivating signal-producing cells, which carry the risk of contamination or disease transmission. Additionally, the co-culture method requires expensive materials, and the medium compositions used in these approaches are often unclear and uncontrolled. Other researchers have used defined media to generate CECs from BM-MSCs and conjunctival MSCs [90,93–95]. In our study, we sought to determine the best procedure for in vitro differentiation of WJMSCs into CECs. To achieve this, the optimal dose of PRGF was loaded onto the Co/SF scaffold, successfully inducing the differentiation of WJMSCs into CECs.

ABCG2 is a well-known marker for many stem cell lines [96] including human UC-MSCs [97–99], rat BM-MSCs [100], and human dental pulp-MSC [83]. In this study, human WJMSCs exhibited low levels of ABCG2 expression, which increased following differentiation (***p ≤ 0.001). Additionally, studies have shown that ABCG2 expression is elevated in human iPSC-derived cells [101] and ADSCs [92]. ABCG2 and p63 are considered markers of LESCs. In the current study, p63 was upregulated (***p ≤ 0.001) in a manner similar to that observed in CECs derived from human iPSCs [102], ESCs [103], and rabbit ADSCs [92]. Furthermore, CK3 and CK12, which are co-expressed in mature CECs, showed increased gene and protein expression (***p ≤ 0.001), consistent with findings from other studies [104].

4. Conclusion

The Co/SF scaffold enriched with PRGF demonstrated synergistic effects on proliferation and differentiation. By optimizing the PRGF concentration, we observed enhanced stem cell proliferation, sustained stemness, and successful differentiation of WJMSCs into CECs. The Co/SF/PRGF scaffold showed comparable characteristics to acellular AM, offering a promising platform for stem cell culture and transplantation in corneal therapies. Furthermore, based on the gene expression profiles, WJMSCs represent a viable alternative cellular source to limbal epithelial cells for treating LSCD.

Funding Statement

This article was not funded.

Article highlights

• The Collagen/Silk Fibroin (Co/SF) scaffold was engineered to provide a supportive microenvironment for stem cell growth and differentiation, leveraging the bioactive properties of PRGF.

• The scaffold enriched with Platelet-Rich Growth Factor (PRGF) enhanced the proliferation, maintenance, and differentiation of Wharton’s jelly-derived mesenchymal stem cells (WJMSCs) into corneal epithelial cells (CECs).

• The PRGF enhanced the proliferation rates of both WJMSCs and LESCs in a concentration-dependent manner.

• Real-time PCR and immunostaining techniques confirmed the successful differentiation of WJMSCs into corneal epithelial-like cells, with a significant up-regulation of P63, ABCG2 and CK3/12.

Author contributions

Bahareh Pourjabbar: Conceptualization, methodology, investigation, writing – original draft, and review and editing.

Forough Shams: methodology, data analysis.

Alireza Baradaran-Rafii: Conceptualization, methodology, and supervision.

Saeed Heidari Keshel: Conceptualization, methodology, and supervision.

Esmaeil Biazar: Conceptualization, methodology, project administration.

Disclosure statement

The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.

No writing assistance was utilized in the production of this manuscript.

Ethical disclosure

The authors state that they have obtained appropriate institutional review board approval (#IR.NIMAD.REC.1398.363) and/or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations.

In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.