Abstract
Lentivirus-derived vectors are very promising gene delivery systems since they are able to transduce nonproliferating differentiated cells, while murine leukemia virus-based vectors can only transduce cycling cells. Here we report the construction and characterization of highly efficient minimal vectors derived from simian immunodeficiency virus (SIVmac251). High-fidelity PCR amplification of DNA fragments was used to generate a minimal SIV vector formed from a 5′ cytomegalovirus early promoter, the 5′ viral sequences up to the 5′ end of gag required for reverse transcription and packaging, the Rev-responsive element, a gene-expressing cassette, and the 3′ long terminal repeat (LTR). Production of SIV vector particles was achieved by transfecting 293T cells with the vector DNA and helper constructs coding for the viral genes and the vesicular stomatitis virus glycoprotein G envelope. These SIV vectors were found to have transducing titers reaching 107 transducing units/ml on HeLa cells and to deliver a gene without transfer of helper functions to target cells. The central polypurine tract can be included in the minimal vector, resulting in a two- to threefold increase in the transduction titers on dividing or growth-arrested cells. Based on this minimal SIV vector, a sin vector was designed by deleting 151 nucleotides in the 3′ LTR U3 region, and this SIV sin vector retained high transduction titers. Furthermore, the minimal SIV vector was efficient at transducing terminally differentiated human CD34+ cell-derived or monocyte-derived dendritic cells (DCs). Results show that up to 40% of human primary DCs can be transduced by the SIV vectors. This opens a new perspective in the field of immunotherapy.
Gene transfer with potential therapeutic applications represents a very important and exciting challenge in biology and medicine. To this end, several generations of retroviral vectors derived from type C retroviruses have been developed that are capable of delivering a gene into many different cell types. For example, MLV-based dicistronic vectors were recently found to efficiently deliver two genes in human multipotent neuronal precursors (9). However, an important limitation of murine leukemia virus (MLV)-based vectors is their inability to deliver a gene into highly differentiated or growth-arrested cells. On the other hand, MLV vectors can be used in cancer gene therapy (17).
Interestingly enough, lentiviruses are able to infect growth-arrested cells (19) and this appears to be under the control of genetic determinants located in the integrase domain and in the vpx gene encoding a highly basic protein. In support of these genetic findings, the integrase and Vpx proteins are present in the viral particle and are thought to drive the nuclear import of the reverse transcription complex, also called the preintegration complex, probably by interacting with components of the nuclear pore complex (13). This route of viral infection, which appears to be unique to lentiviruses in the retrovirus family, has been exploited for the development of lentivirus vectors derived from human immunodeficiency virus type 1 (HIV-1) (29, 34), HIV-2 (2), feline immunodeficiency virus (30), equine infectious anemia virus (24), and more recently simian immunodeficiency virus (SIV) (37). As expected, these lentivirus vectors can achieve gene transfer into growth-arrested and differentiated cells ex vivo and in vivo (28).
Here we report the construction and characterization of several retroviral vectors based on SIVmac251. The minimal SIV vectors contain less than 20% of the original viral sequences, and recombinant viruses produced by 293T cells were found to carry out very efficient gene transfer into both cycling and growth-arrested cell lines. As a first step toward gene transfer applications, we used the minimal SIV vectors to transduce primary human dendritic cells (DCs). The results show that up to 40% of terminally differentiated DCs can be transduced.
MATERIALS AND METHODS
Plasmid DNA construction and amplification.
In plasmid pSIV-TGP, which was constructed by Transgene SA and derives from the SIVmac251 genome (GenBank accession no. M19499), a green fluorescent protein (GFP) expression cassette driven by the early cytomegalovirus (CMV) promoter was inserted in place of the env 5′ region (see Fig. 1) and an early CMV promoter pCMV replaced U3 in the 5′ long terminal repeat (LTR). The pSIV-REV and pMLV-VL30 (GFP) vectors were provided by Transgene SA.
FIG. 1.
Schematic representation of SIV-derived vectors and helper plasmids. pSIV-T0, -T1, -RMES, and -gaMES4sin were constructed as described in Materials and Methods. Viral genes and restriction sites of interest are indicated on the SIV proviral map. gag sequences present in the vector constructs are shown in black. Abbreviations: pCMV, early CMV promoter; LTR SIN, 3′ LTR with U3 partially deleted. Note that nef is nonfunctional in all SIV constructs.
pSIV3+ is a packaging plasmid described elsewhere (29a). Briefly, it derives from SIVmac251 in which the 5′ region from U3 to the major splice donor (nucleotides [nt] 967 to 980) was replaced with the human CMV early promoter and enhancer region. In addition, the 5′ half of the env gene was removed, leaving intact the RRE (Rev-responsive element) and the 5′ and 3′ exons of the tat and rev genes. Furthermore, the 3′ LTR was replaced with a simian virus 40 polyadenylation sequence that deleted the nef gene.
The pSIV-T1 vector contains the complete 5′ encapsidation and dimerization sequence (E/DLS), the first 218 5′ nt of gag, and the last 1,011 3′ nt of pol but out of frame, together with the central polypurine tract (cPPT) and the central termination sequence (CTS). It has been generated after deletion of a 3,114-nt HpaI/DraI fragment from the original vector pSIV-TGP. pSIV-T0 was constructed after deletion of a 4,823-nt KpnI/KpnI fragment from pSIV-TGP, resulting in deletion of the major splice donor and the putative E/DLS sequence while conserving the primer-binding site (PBS).
To construct pSIV-RMES vectors, we used DNA fragments generated by primer-directed high-fidelity PCR amplification of the pSIV-TGP template. The DNA oligonucleotide primers (oligonucleotides 1 to 12) that were utilized for the PCR amplifications are as follows: (5′ to 3′): 1, AGGCCTCGAGTTTTATAAAAGAAAAGGGGG (5′-U3); 2, CCGGTACCATGCTAGGGATTTTCCTGC (3′-U5); 3, AGGCCTCGAGAATTCACTTGTACAGCTCGTC (3′-GFP); 4, GGATCGATCCATTGCATACGTTGTATCCATATC (5′-pCMV); 5, TAGACGCGTGATTGGAGTTGGGAGATTAT (5′-RRE); 6, GGATCGATGGTCCTTTAAGTACTTCTC (3′-RRE); 7, GCTCTAGAATTCCCATTGCATACGTTG (5′-pCMV); 8, GGCACGCGTCCTTTTTAAGAAAACAAAATTAATTAATAATTTTTTCAATTCATCTGCTTTCTTCC (3′-E/DLS); 9, GCCTCGCGATCGCATGAATTTTAAAAGAAGG (5′-cPPT); 10, GCCGTACGCGTGAGCTCTGTAATAGACCCGAA (3′-CTS); 11, TCTGACAGGCCTGACTTGC (3′ in U3); 12, GCAAGTCAGGCCCTGTCAGAACTGCATTTCGCTCTGTA (5′ in U3).
All PCR amplifications for vector construction used a high-fidelity polymerase protocol (Boehringer Mannheim). PCRs consisted of 20 cycles in 50 μl as follows: 94°C for 45 s, 50 to 55°C (depending on the primers used) for 45 s, and 72°C (68°C for fragments longer than 1,500 nt) for 1 min. The DNA fragments were gel purified and recovered using the JETSORB protocol (Genomed).
Construction of pSIV-RMES3.
(i) The 3′ PPT LTR was amplified using primers 1 and 2, and the resulting DNA was cut by KpnI and XhoI and inserted into pBlueScript KS+. (ii) The pCMV-GFP cassette was amplified using primers 3 and 4, and the DNA was cut by ClaI and XhoI and inserted into the plasmid generated in step i. (iii) The RRE region was amplified using primers 5 and 6, and the resulting DNA was cut by MluI and ClaI and inserted into the MluI and ClaI sites in the plasmid generated in step ii. (iv) The 5′ pCMV-R-U5-PBS-Leader and the 5′ gag region were amplified using primers 7 and 8, and the DNA was cut by XbaI and MluI and inserted into the XbaI and MluI sites of the plasmid generated in step iii, giving rise to pSIV-RMES3, where 57 nt of the 5′ end of gag are present (Fig. 1). Note that a stop codon has been engineered 15 nt downstream of the AUG translation initiation codon of gag.
To construct pSIV-RMES4, the cPPT-CTS domain was amplified using primers 9 and 10 and the DNA was cut by MluI and PvuI (PacI compatible) and inserted into pSIV-RMES3 digested with MluI and PacI. pSIV-RMES4ΔR derives from pSIV-RMES4, which was cut by ClaI and MluI, Klenow filled, and religated.
The self-inactivating pSIV-gaMES4sin vector was constructed by means of a two-step process. (i) To engineer an inactivated 3′ LTR with a 151-nt deletion encompassing the NF-κB and SP1 binding sites and the TATA box (positions 9778 to 9928 in SIVmac251), two DNA fragments were generated by PCR, one using primers 1 and 11 (deletion in U3) and the other one using primers 12 and 2 (R-U5). The two purified DNAs carrying overlapping sequences were mixed and subjected to a second round of PCR amplification using primers 1 and 2. The 3′ Δ-LTR was then cut by KpnI and XhoI and inserted into pBlueScript KS+ as in step i above. (ii) Next, the 3,122-nt fragment of pSIV-RMES4, between the XbaI and XhoI sites, was inserted into the above plasmid cut by XbaI and XhoI to generate pSIV-gaMES4sin (Fig. 1).
Plasmid DNAs were amplified in Escherichia coli HB101 and purified using Qiagen protocols.
Cell culture and differentiation of human CD34+ cells and monocytes.
HeLa, sMAGI, and 293T cells were cultured at 37°C in an atmosphere of 5% CO2 and in Dulbecco's modified Eagle's medium (Life Technologies-Gibco-BRL) complemented with 10% fetal calf serum (FCS), penicillin (100 IU/ml), streptomycin (100 μg/ml), and l-glutamine (2 mM). The selection medium for sMAGI cells contained hygromycin (50 μg/ml) and G418 (200 μg/ml).
DCs were generated as previously described (4), by culturing human cord blood CD34+ progenitors in the presence of recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF; specific activity, 2 × 106 U/mg; Schering Plough Research Institute) at 100 ng/ml, recombinant human tumor necrosis factor alpha (specific activity, 2 × 107 U/ml; Genzyme Corp.) at 2.5 ng/ml (50 U/ml), and stem cell factor (R&D) at 25 ng/ml of RPMI 1640 medium (Gibco) supplemented with 10% FCS (Eurobio), 10 mM HEPES, 2 mM l-glutamine, 5 × 10−5 M 2-mercaptoethanol, penicillin at 100 U/ml, and streptomycin at 100 μg/ml. Cell populations collected on days 8 to 10 contained 70 to 90% CD1a+ CD80+ DCs and will be referred to as CD34+ cell-derived DCs. The remaining cells consist of undifferentiated precursors and other progenitors, including monocytes and granulocytes (4).
Monocyte-derived DCs were established by culturing peripheral blood monocytes (>90% CD14+) in complete RPMI 1640 medium containing rhGM-CSF (100 ng/ml) and recombinant human interleukin-4 (20 ng/ml; Genzyme Corp.). After 5 days of differentiation, analysis of cell markers showed that 90 to 95% of the cells were CD1a+ CD14−, indicating that most of the cells had entered into a dendritic differentiation pathway.
Production of SIV vectors.
Transfections of cells were performed using the calcium phosphate protocol as previously described (8). For large-scale production, we used the calcium phosphate transfection kit (Gibco-BRL). The pSIV vectors were produced in six-well plates by cotransfecting three different plasmids, a SIV vector (2 μg), the helper pSIV3+ coding for Gag-Pol and the regulatory viral proteins except Env and Nef (1.7 μg), and pVSV-G (0.8 μg), into 293T cells seeded the day before transfection at 3.5 · 105 per well. To transfect cells in 10-cm-diameter dishes, amounts of DNAs and volumes were scaled up sixfold. The medium was replaced after 16 h of incubation. Vector-containing media were collected at 48 h or twice at 40 and 48 h after transfection (for large-scale production), clarified by 5 min of centrifugation at 800 × g, and filtered through a 0.45-μm-pore-size-filter. For high-titer preparations, SIV vectors were concentrated by ultracentrifugation at 50,000 × g for 90 min. The viral pellet was resuspended overnight at 4°C in 50 mM Tris · Cl (pH 8)–130 mM NaCl–1 mM EDTA or in phosphate-buffered saline.
Transduction and calculation of the titer in transducing units.
For transduction assays, HeLa or 293T cells were seeded at 1 × 105 to 3 × 105 per well in 12-well plates the day before transduction. At day 1, the medium was removed and replaced with transduction medium made of 100 μl of vector, 300 μl of serum-free medium, and Polybrene at 6 μg/ml. After 3 h of incubation, 1 ml of complete medium was added. At day 1, cells from three nontransduced wells were trypsinized and fixed to allow calculation of the rate of cell division. At day 3, cells were trypsinized and GFP expression was analyzed by flow cytometry (FACScalibur; Becton-Dickinson).
Transduction titers (in transducing units per milliliter) were calculated using the percentage of GFP-positive cells, the rate of cell division between the day of transduction and the day of analysis, and the flow of the FACScalibur. Multiple serial dilutions of vector-containing medium (1/10, 1/100, and 1/1,000) were used for the transduction assays, and titers were calculated for linearly correlated values. In addition, experiments were designed to verify the absence of pseudotransduction that could occur using vesicular stomatitis virus glycoprotein G (VSV-G) pseudotyping (21). 293T cells were transfected with increasing amounts of the vector, rev, and envelope plasmids but without the helper construct. Results showed that under these experimental conditions the medium was unable to confer GFP expression on HeLa cells (data not shown). In addition, highly transduced cells were transfected with the VSV-G plasmid but the medium recovered was also unable to confer GFP expression on naive HeLa cells (data not shown).
Transduction of DCs was performed on 2 × 105 cells in a volume of 200 μl composed of the diluted medium-containing vector in 2% FCS–RPMI medium–0.12 μg of Polybrene. After 2 h of incubation at 37°C, the media were transferred to a 12-well plate and complemented with 1 ml of 10% FCS–RPMI 1640 medium in the presence of rhGM-CSF and tumor necrosis factor alpha or rhGM-CSF and interleukin-4 for CD34+ cell-derived and monocyte-derived DCs, respectively. After 5 days of culture, cells were EDTA treated and collected for analysis of GFP expression by fluorescence-activated cell sorter (FACS).
Mobilization of the integrated SIV vector.
pSIV-TGP, pSIV-T1, pSIV-RMES4, and pSIV-gaMES4sin were produced as described above and used to transduce 293T cells. At 48 h later, most of the cells scored positive for GFP expression (>75%). At 72 h after transduction, the same cells were transfected with a mixture containing Tat-encoding plasmid pSIV3+ (1.8 μg), pSIV-Rev (1.5 μg), and pVSV-G (0.5 μg). The culture medium was changed 1 day later and then collected four times at 8-h intervals, filtered, and used to transduce HeLa cells (400 μl of vector in 400 μl of serum-free Dulbecco's modified Eagle's medium with Polybrene at 12 μg/ml). Three days after transduction, HeLa cells were trypsinized and FACS analyzed for GFP expression.
PCR amplification.
To analyze potential transfer of helper functions, 293T cells were transduced with either pSIV-gaMES4sin, pSIV-RMES4, pSIV-T1, or pSIVTGP or left untransduced. For all constructs, transduction efficiencies reached >70% of GFP-positive cells. At 48 h after transduction, 106 cells were trypsinized, pelleted, and resuspended in an excess of lysis buffer containing 50 mM Tris-HCl (pH 8), 30 mM EDTA, 500 mM LiCl, 0.5% sodium dodecyl sulfate, 0.1% β-mercaptoethanol, and proteinase K at 100 μg/ml. After 1 h of incubation at 37°C, lysates were phenol extracted and DNAs were alcohol precipitated. DNAs were resuspended in pure water and handled to avoid contamination. PCR amplifications were performed as follows on 100 or 300 ng (for gag) of DNA: 40 cycles of 45 s at 94°C, 45 s at 55°C, and 45 s at 72°C in a 50 μl volume containing 40 μl of H2O, 5 μl of 10× polymerase buffer (Gibco), 2 μl of 25 mM MgCl2, 0.8 μl of 25 mM deoxynucleoside triphosphate, 5 U of Taq DNA polymerase (Gibco), and 25 pmol of each primer. The primers used were as follows: pCMV-GFP, primers 3 and 4 (detailed in plasmid construction; LTR-E/DLS, 5′-GGCACGCGTCTTCCCTCACAAGACGGAGTTTC and primer 1; gag, 5′-GCAGATGAATTGAAAAAATTAG-3′ and 5′-TTATTATCCCTTCCTGGATAACAAGACAGC-3′.
RCR detection.
To detect a potential replication-competent virus (RCR) in the SIV vector preparation, pSIV-TGP, pSIV-RMES4, and pSIV-gaMES4sin were produced in a six-well plate as already described. Supernatants were clarified and filtered through a 0.45-μm-pore-size filter, and 1 ml of each vector stock was added to 3 × 105 sMAGI cells in a six-well plate. On the same day, a SIVmac251 stock whose titer was predetermined at 3 × 103 infectious units (IU)/ml (on sMAGI cells) was diluted 10 and 100 times and 100 μl of the stock or of each dilution was used to infect 3 × 105 naive sMAGI cells in a six-well plate. Thus, the numbers of infectious units added for each dilution can be estimated to be 300, 30, and 3. After 24 h, infected and transduced cells were washed twice and allow to grow for 1 week. Titers of the three vector stocks and efficiencies of transduction were determined by FACS analysis of sMAGI cells transduced in a control experiment. After 7 days, all sMAGI cells were fixed in phosphate-buffered saline–4% formaldehyde (15 min at 4°C) and stained for β-galactosidase expression (1 h at 37°C). Infection was evident in wells infected with the three dilutions of SIVmac251 as revealed by blue foci of infection. A large number of blue cells were observed upon transduction with pSIV-TGP, which codes for the tat gene, but no blue cells were detected upon transduction with the minimal SIV vectors.
RESULTS
Construction of minimal SIV vectors.
Starting from the SIVmac251V molecular clone, the first SIVmac-derived vector (pSIV-TGP) was constructed by inserting a GFP expression cassette in place of env and by replacing the 5′ LTR U3 region with the CMV early promoter (pCMV). SIV vector production was achieved by cotransfecting pSIV-TGP together with pVSV-G, encoding the VSV-G envelope, into 293T cells. This first SIV vector was found to have GFP transduction titers on the order of 1.4 × 107 transducing units (TU)/ml on HeLa cells (Fig. 1 and 2). The strategy used to engineer a minimal SIV vector was to keep the essential cis elements, i.e., the LTR, the PBS, the E/DLS, the RRE, and the PPT, on the vector construct while segregating the viral helper functions on other constructs (Fig. 1, vector and helper plasmids). Since the E/DLS packaging signal is thought to extend into the 5′ end of gag (22) (33), a functional E/DLS packaging signal was selected by progressively deleting the gag-pol region. Deletion of all but the 5′ 218 nt of gag did not result in serious adverse effects on the transduction titer of the SIV vector (pSIV-T1; Fig. 1 and 2) while removing all of gag and the 3′ 100 nt of the leader caused a 40-fold reduction in the transduction titer (compare pSIV-T0 to pSIV-T1; Fig. 1 and 2). These data indicate that the 3′ end of the leader and the first 5′ nucleotide of gag must be included in a minimal SIV vector since they probably are part of the E/DLS packaging signal. In agreement with this result, in vitro SIV RNA dimerization was found to require sequences located from the PBS to the AUG start codon of gag (data not shown).
FIG. 2.
Transduction titers of SIV vectors. All vectors, except the MLV vector and pSIV-TGP, were produced by cotransfection of 293T cells with the indicated vector, pSIV3+, and pVSV-G. Vector-containing supernatants were clarified and diluted before transduction of HeLa cells. To calculate titers and standard deviations, three distinct vector preparations were analyzed. The SIV vector constructs are shown in Fig. 1.
To systematically examine the role of each of the cis elements in the transduction ability of a minimal SIV vector, we used high-fidelity PCR to amplify viral DNA sequences, enabling careful construction of a series of minimal SIV vectors named pSIV-RMES (Fig. 1). The contribution of the 5′ gag sequences was examined by shortening this region from 218 nt to a small number of nucleotides. Results show that it was necessary to include between 32 and 57 nt of the 5′ end of gag to get a high-titer minimal vector (pSIV-RMES4 in Fig. 1 and 2; data not shown).
To evaluate the role of the cPPT, which has been reported to be important for HIV-1 replication (6, 7), the cPPT was not included in the minimal vector construct giving rise to pSIV-RMES3. The cPPT had a small but reproducible positive effect, since its deletion caused a two- to threefold decreased in the vector titer (compare pSIV-RMES3 and pSIV-RMES4; Fig. 1 and 2).
As expected, deletion of the RRE caused a strong reduction in the transduction titer but it was interesting that the titer of pSIV-RMESΔR remained in the range of 106 TU/ml (Fig. 1 and 2).
Although transduction titers may vary, the relative efficiencies of the different SIV vectors were conserved in seven distinct experiments.
Analysis of RCR.
The helper functions encoding the viral genes, the envelope, and the SIV vector are segregated on distinct plasmid constructs (Fig. 1), and this is thought to prevent the generation of replication-competent SIV-derived viruses. However, 293T cells are transfected with large quantities of plasmid DNAs in order to produce large amounts of SIV vector particles and this may be the source of multiple recombination events giving rise to SIV-derived RCRs potentially carrying helper functions.
To first examine the potential transfer of helper sequences into transduced cells, gene amplification assays were performed on transduced 293T cells to look for GFP-encoding, LTR, and gag sequences. After highly efficient transduction with either pSIV-RMES4, pSIV-gaMES4sin, pSIV-T1, or pSIV-TGP, 293T cells were harvested and total DNA was extracted (see Materials and Methods). Specific DNA oligonucleotides were used in order to PCR amplify pCMV-GFP, LTR-E/DLS, and gag sequences (see Materials and Methods). As expected, pCMV-GFP and LTR-E/DLS sequences were amplified in all of the extracts derived from transduced cells (Fig. 3A, lanes 2 to 5), which is in agreement with the transduction results and indicates that reverse transcription and integration did take place. On the other hand, gag sequences were solely amplified after cell transduction with the pSIV-TGP vector containing the gag-pol domain (Fig. 3B, lane 5). gag amplification was still detectable in extracts from cells transduced with a 100-fold dilution of pSIV-TGP (data not shown), indicating that detection of the gag sequence is not an effect of the high titer of the pSIV-TGP stock used to transduce 293T cells. As the 1/100-diluted pSIV-TGP preparation gave 9% GFP-positive cells, the gag PCR assay can detect at least one copy in 10 cells.
FIG. 3.
PCR analysis of SIV-directed gene transfer into 293T cells. Production of pSIV-TGP, pSIV-T1, pSIV-RMES4, and pSIV-gaMES4sin is described in Materials and Methods. Virus-containing supernatants were filtered and used to transduce 293T target cells. Three days after transduction, cells were lysed and genomic DNAs were extracted to perform PCR amplifications. (A) PCR assays performed on DNA extracted from transduced 293T cells that corresponds to the pCMV-GFP expression cassette (1,400 bp) and the 5′ LTR-E/DLS region (1,100 bp). (B) Amplification of gag in transduced cells. The viral supernatants used to transduce 293T cells were pSIV-gaMES4sin (lane 2), pSIV-RMES4 (lane 3), pSIV-T1 (lane 4), and pSIV-TGP (lane 5). As internal controls, PCR assays were performed on nontransduced cells (lane 1) or H2O (lane 6). DNA extracted from every cell population allowed amplification of β-globin (80-bp bands in panel A). (C) PCR assays performed on serial dilutions of control plasmids (pSIV-RMES4 for GFP and pSIV3+ for Gag). Calculated numbers of copies are indicated. Domains subjected to amplification and localization of the primers are depicted. While the GFP and LTR-E/DLS regions were amplified in all of the DNA samples from transduced cells, Gag was detected only in DNA corresponding to cells transduced with pSIV-TGP (B, lane 5). In lane 2, note the 150-nt deletion present only in the LTR DNA from cells transduced with pSIV-gaMES4sin.
To look for the presence of possible RCRs in a vector stock, 106 293T cells were transduced with 1 ml of pSIV-RM4 coding for β-galactosidase. At 24 and 36 h later, the supernatant of the transduced cells was harvested twice (2 × 10 ml at 12-h interval) and added to 106 naive HeLa cells. After 3 days of culture, which should allow the spread of a potential lacZ-carrying RCR, no blue foci were detected in the HeLa culture after 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) staining. As 1 ml of vector preparation was originally used to transduce 293T cells, the titer of a potential lacZ-carrying RCR should be below 1/ml.
Further RCR analysis comes from experiments using sMAGI cells which carry a lacZ gene under the control of the HIV-1 LTR. sMAGI cells are commonly used as an indicators to detect SIV infection (5). sMAGI cells (3 × 105) were transduced with a pSIV-TGP, pSIV-RMES4, or pSIV-gaMES4 vector or left untransduced. Under the same conditions, a SIVmac251 stock whose titer had been predetermined was used to infect sMAGI at different multiplicities of infection (MOIs) (see Materials and Methods for details). After 1 week of culture, blue foci were detected in sMAGI cells infected with SIV even at an MOI of 10−5 (calculated, 1 IU of SIVmac/105 cells), showing that infection was productive. Also, blue cells were detected in cells transduced with pSIV-TGP, which codes for Tat. On the other hand, no sign of infection was detected in sMAGI cells transduced with either pSIV-RMES4 or pSIV-gaMES4 after X-Gal staining. Since the assay using the sMAGI cell line was able to detect an infection initiated by a calculated 3 IU of the wild-type virus, these results show that the titer of a potential RCR carrying the tat gene is below 3/ml of SIV vector preparation. The titer of the pSIV-RMES4 preparation used in this experiment was 9 × 105 TU/ml. Thus, the estimated probability of emergence of a Tat-encoding RCR is around 3 × 10−6.
Construction of a minimal self-inactivating SIV vector.
Due to the reverse transcription process, replication of the SIV vector will regenerate two copies of the 3′ LTR and both of them will be integrated into the host genome. The presence of such possibly functional LTRs in the cellular genome has raised concerns regarding abnormal gene expression driven by the LTR in transduced cells. This prompted us to generate a minimal SIV vector with a large deletion in the 3′ LTR U3 domain, which encompasses the binding sites for the Elf-1, NF-κB, and SP1 transcription factors and the TATA box (Fig. 4), which are essential for SIV transcription (31). Deletion of this 151-nt region was carried out as described in Materials and Methods and enabled construction of the minimal pSIV-gaMES4sin vector. This minimal SIV sin vector was found to have a high transduction titer on HeLa cells (2 × 106 TU/ml; Fig. 2) and was able to carry out gene transfer in growth-arrested cells with an efficiency comparable to that of other SIV vectors (see Fig. 6; compare pSIV-T1, pSIV-RMES4, and pSIV-gaMES4sin).
FIG. 4.
Representation of the SIVmac core enhancer region and flanking sequences. The SIVmac251 sequence is in the GenBank database (accession no. M19499). The major functional elements of the core enhancer and flanking sequences have homology with the same genetic domain of SIVmac239 (31). Purine-rich regions PuB1 and PuB2 were deduced by homology with HIV-2 (18). Important binding motifs are boxed and arrows show the sin deletion (positions 334 to 485).
FIG. 6.
SIV vector transduction of proliferating and growth-arrested human cells. SIV vectors were produced as indicated in Materials and Methods. The vector-containing medium was filtered and added to proliferating 293T cells (filled bars) or to 293T cells γ irradiated at 4,000 rads the day before use (open bars). Two days after transduction, cells were trypsinized and analyzed by FACS (see Materials and Methods). Percentages of GFP-positive cells are indicated. As expected, the MLV vector (pMLV-VL30) was unable to transduce growth-arrested cells. This result and the relative efficiencies with which SIV vectors transduced arrested HeLa cells were reproducible in three separate experiments.
To verify that the SIV sin vector was indeed a self-inactivating vector, we performed mobilization assays to examine the ability of Tat to transactivate the LTR in cells transduced either with the SIV sin vector or the parental SIV vector (pSIV-gaMES4sin or pSIV-RMES4, respectively; also, Fig. 3, lanes 2 and 3) or with pSIV-TGP or the pSIV-T1 vector (Fig. 1). Transduced cells were cotransfected with the helper constructs pSIV3+, pSIV-REV, and pVSV-G (Fig. 1 and Materials and Methods). Medium was then collected at 12-h intervals and put four times onto naive HeLa cells. Results show that vector mobilization was very high with the pSIV-TGP and pSIV-T1 vectors, low with pSIV-RMES4, and close to zero with the SIVsin vector (Fig. 5). On the basis of FACS analysis, the sin deletion reduces mobilization by a factor of 200 in comparision with pSIV-RMES4 and 1,500 in comparison with pSIV-T1.
FIG. 5.
Mobilization of the integrated SIV vector. Mobilization of either pSIV-TGP, pSIV-T1, pSIV-RMES4, or pSIV-gaMES4sin was carried out as described in Materials and Methods. Briefly, 293T cells transduced with the indicated vector were cotransfected with pSIV3+, pSIV-Rev, and pVSV-G. Media of transduced and transfected cells were used to transduce naive HeLa cells. GFP expression in HeLa cells was analyzed by FACS 72 h after transduction. Note the high levels of mobilization obtained for pSIV-TGP and pSIV-T1 (91 and 74%, respectively). Mobilization of the integrated pSIV-RMES4 vector was drastically reduced (10% of GFP-positive cells) and <0.1% for the pSIV-gaMES4sin vector.
Transduction of growth-arrested human cells.
One major interest in developing lentivirus vectors resides in their ability to transduce growth-arrested cells, and this paves the way to a large number of gene transfer applications impossible to achieve with MLV-derived vectors. A useful protocol by which to examine the ability of lentivirus vectors to transduce growth-arrested cells is to γ irradiate the target cells in order to block them in the G2 phase (19). To validate the present SIV vectors for the transduction of growth-arrested cells, 293T cells were γ irradiated 1 day before transduction and then GFP gene transfer by the SIV vectors was measured as before (see Materials and Methods) and compared to that obtained with an MLV vector under the same conditions. Figure 6 reports the percentages of cell transduction obtained with the SIV and MLV vectors. Clearly, the transduction efficiencies of the SIV vectors on growth-arrested cells are comparable to the values obtained on proliferating cells (Fig. 6). On the other hand, transduction with the MLV vector was high on cycling 293T cells but about 100-fold lower on arrested cells (Fig. 6).
Similar data were obtained upon transduction of growth-arrested HeLa cells and medulloblastoma-derived DEV cells (14) with the minimal SIV vectors (data not shown). Taken together, these findings indicate that the E/DLS packaging sequence is critical for the transduction of arrested cells (Fig. 6, compare pSIV-T0, pSIV-T1, and pSIV-RMES4) while the cPPT does not appear to be a major determinant (Fig. 6, compare pSIV-RMES4 and pSIV-RMES3).
Transduction of CD34+ cell- and monocyte-derived human DCs.
DCs are of great interest for gene transfer, since as antigen-presenting cells they are key actors in the immune response (3). DCs are found in many nonlymphoid tissues such as the skin and mucosa but remain difficult to isolate. In cell cultures, DCs can be established from CD34+ progenitor cells or from peripheral blood monocytes by culturing the purified precursors in the presence of a cocktail of cytokines (4, 35). As MLV vectors require cell division to achieve gene transfer, MLV vector-directed transduction into DCs was performed first on CD34+ progenitors prior to interleukin-directed differentiation (26, 27, 32).
To explore the possibility that the minimal SIV vectors could efficiently transduce DCs and to compare the influence of the differentiation pathway on transduction efficiency, terminally differentiated DCs were established in vitro from CD34+ progenitors or from peripheral blood monocytes after culture with an appropriate combination of cytokines. Both differentiation pathways led to the obtention of 70 to 90% CD1a+ CD14− DCs which were transduced with either vector pSIV-RMES4 or pMLV-VL30 at two MOIs. Transduction efficiencies were recorded as percentages of GFP-expressing cells.
As shown in Table 1, pSIV-RMES4 transduced DCs established from either CD34+ progenitors or monocytes with similar efficiencies, resulting in around 20% GFP+ cells at an MOI of 1. Raising the MOI to 6 allowed the transduction of as much as 40% of the DCs, showing that SIV vector transduction is dose dependent. Alternatively, monocyte-derived DCs, which comprise a homogeneous population of 90% of nondividing CD14− CD1a+ cells, were highly restrictive to transduction performed with the MLV vector, confirming that gene transfer mediated by this vector requires cell division. It can be noted that the MLV vector was able to transduce about 7% of all CD34+ cell-derived DCs, but increasing the MOI to 6 with the MLV vector did not improve the transduction of CD34+ cell-derived DCs (Table 1). This finding is compatible with the percentage of CD14+ cells remaining in this population, which corresponds to dividing precursors.
TABLE 1.
Transduction of CD34+ cell-derived and monocyte-derived DCs with a minimal SIV vector or an MLV vectora
| Vector (MOI) | % Transduction of target cells
|
|
|---|---|---|
| CD34+ cell-derived DCs | Monocyte-derived DCs | |
| R-MES4 (1) | 19 | 23 |
| R-MES4 (6) | 39.9 | NDb |
| MLV (1) | 7.7 | 0.3 |
| MLV (6) | 7.8 | 0.4 |
Terminally differentiated DCs were established from CD34+ progenitors or CD14+ monocytes as described in Materials and Methods. After differentiation, transduction of the DCs was performed with the pSIV-RMES4 vector or an MLV vector using two different MOIs. All vectors pseudotyped with VSV-G were produced on 293T cells, and their titers were determined on HeLa cells. Five days posttransduction, DCs were collected and analyzed by FACS for GFP expression. Percentages of GFP-positive DCs are shown. Note that at an MOI of 6, about 40% of CD34+ cell-derived DCs were transduced.
ND, not done.
To verify that transduction by an SIV vector did not alter expression of DC phenotypic markers, transduced DCs were analyzed for the expression of CD1a and CD80. As reported in Table 2, the expression patterns of these phenotypic markers were not affected upon transduction with minimal SIV vectors.
TABLE 2.
Analysis of phenotypic markers after transduction of CD34+ cell-derived or monocyte-derived DCs with a minimal SIV vectora
| Phenotypic marker(s) | % of cells with phenotypic marker(s)
|
|
|---|---|---|
| CD34+ cell-derived DCs | Monocyte-derived DCs | |
| CD1a+ | 88.5 | 96 |
| CD80+ | 96.5 | 98 |
| GFP | 20.5 | 26.5 |
| GFP+ CD1a+ | 90 | 98 |
| GFP+ CD1a− | 10 | 2 |
| GFP+ CD80+ | 96 | >99 |
| GFP+ CD80− | 4 | <1 |
Expression of CD1a and CD80 was analysed 4 days after transduction of monocyte-derived or CD34+ cell-derived DCs with the pSIV-RMES4 vector at an MOI of 1. Nontransduced DCs were used as a control. Results are given for DCs treated with a mouse CD1a phycoerythrin-conjugated antibody and a mouse CD80 phycoerythrin-conjugated antibody. Percentages of GFP-positive and marker-positive and -negative DCs are shown.
DISCUSSION
The data reported here summarize our efforts to construct minimal SIV vectors capable of delivering a gene into simian or human cells in culture. To this end, we took advantage of our growing knowledge of SIV genetic structure and replication (10) and results show that cis elements and trans-acting factors can be segregated while preserving their functions. Regarding lentivirus vector development for gene transfer and biological safety concerns, it should be pointed out that SIVmac provides a very interesting and useful animal model for investigating pathogenesis and prevention of HIV-1 infection (10). It should also be noted that our minimal SIV vector expressing system does not code for the Env and Nef proteins that are required for SIV replication and pathogenesis in rhesus macaques, the natural host of SIVmac (11, 16).
By means of a systematic approach using high-fidelity PCR amplification to generate specific SIV DNA sequences, we have been able to construct the minimal vectors SIV-RMES3 and SIV-RMES4, which combine small size and the ability to efficiently transfer a gene to cells in culture. As observed for other lentivirus vectors, the minimal and efficient SIV-RMES vectors contain 20% or less of the original SIV sequences. Interestingly, the functional E/DLS packaging sequence present in SIV-RMES vectors does not extend more than 57 nt into gag (Fig. 1 and 2). This situation is actually much different from that of MLV-based vectors, in which an efficient E/DLS packaging sequence contains 400 to 500 nt of the 5′ gag region (1). This feature of minimal lentivirus vectors should minimize possible recombination events between the vector and helper RNAs and thus improve their biological safety. In agreement with this notion, the pSIV-T1 and minimal pSIV-RMES4 vectors were unable to transfer gag-pol sequences into target cells, as measured by PCR amplification (Fig. 3).
To further improve the predictive safety of the minimal pSIV-RMES vector, essential cis transcription elements, such as the binding sites for the Elf-1, NF-κB, and SP1 transcription factors and the TATA box, have been deleted from the 3′ LTR (Fig. 4). Vector mobilization assays showed that this U3 deletion completely prevented LTR-driven transcription of the integrated SIV sin vector (Fig. 5). At the same time, the sin vector pSIV-gaMES4 was still very efficient on both cycling and growth-arrested cells (Fig. 6).
As opposed to that of MLV-derived vectors, the production of large amounts of SIV vectors, and of lentivirus vectors in general, suffers from the fact that no high-producer helper cell lines are available. This is thought to be due, at least in part, to the presence of toxic viral regulatory proteins, such as Rev, which is essential for vector and helper function expression (23, 25). Other viral factors, such as Vif and Vpr, may also interfere with the establishment of efficient producer helper cell lines, but our preliminary data indicate that they are dispensable for SIV vector production (29a). Large amounts of specific lentivirus vectors will most probably be required for biomedical purposes but at the same time will necessitate established and well-characterized cell lines providing in trans all of the necessary packaging functions, and this is why the development of inducible SIV helper and producer cell lines is in progress.
DCs are present in lymphoepithelial tissues, including the mucosa and skin, and are mandatory not only for the initiation of the primary immune response to invasive pathogens but also in the control and maintenance of tolerance (36). Immunotherapy using DCs has been shown to induce immunity against tumors (38, 39) and can be envisioned as a strategy to treat autoimmune disease and to induce transplantation tolerance.
Previous studies have shown that a VSV-G-pseudotyped HIV-1 vector could transduce proliferating CD34+ progenitors (20). However, no evidence that a lentivirus vector could transfer a gene into mature nondividing DCs has been reported. We show here that the minimal SIV vector is highly efficient at delivering a gene into terminally differentiated human DCs derived from two distinct differentiation pathways. Transduction gave rise to up to 40% transduced DCs while preserving the viability and expression of DC-specific molecules, including CD1a, and of the costimulatory molecule CD80 (Table 2).
Monocyte-derived DCs are highly phagocytic compared to CD34+ cell-derived DCs (15), which are more efficient at inducing antigen presentation and T-cell activation. (12). The observations that transduction efficiencies were similar in monocyte-derived DCs and CD34+ cell-derived DCs and that an MLV vector was unable to transduce monocyte DCs indicate that transduction results from infection and not from phagocytosis. Moreover, these data suggest that the SIV vector may be valuable in vivo to target DCs of epithelial tissues and mucosa specialized in antigen processing, as well as DCs in secondary lymphoid organs specialized in T-cell priming. Finally, since the SIV vector is able to deliver genes without transferring the viral sequence, it is not supposed to elicit an immune response in the host. This advantage should allow repeated transductions with a limited risk of development of immunity to the vector. Minimal SIV vectors may thus open new avenues in many clinical applications requiring antigen targeting into DCs, such as antitumor therapy or vaccination.
ACKNOWLEDGMENTS
This work was supported by INSERM, ANRS, Transgene SA, MGEN, and the European Community (contract BMH4-CT96-0675).
We thank J. Mullins for the infectious molecular clone SIVmac251. Thanks to Dider Trono for the gift of 293T cells and to the various hospitals in Lyon for kindly providing human cord blood.
REFERENCES
- 1.Adam M A, Miller A D. Identification of a signal in a murine retrovirus that is sufficient for packaging of nonretroviral RNA into virions. J Virol. 1988;62:3802–3806. doi: 10.1128/jvi.62.10.3802-3806.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Arya S K, Zamani M, Kundra P. Human immunodeficiency virus type 2 lentivirus vectors for gene transfer: expression and potential for helper virus-free packaging. Hum Gene Ther. 1998;9:1371–1380. doi: 10.1089/hum.1998.9.9-1371. [DOI] [PubMed] [Google Scholar]
- 3.Banchereau J, Steinman R M. Dendritic cells and the control of immunity. Nature. 1998;392:245–252. doi: 10.1038/32588. [DOI] [PubMed] [Google Scholar]
- 4.Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature. 1992;360:258–261. doi: 10.1038/360258a0. [DOI] [PubMed] [Google Scholar]
- 5.Chackerian B, Haigwood N L, Overbaugh J. Characterization of a CD4-expressing macaque cell line that can detect virus after a single replication cycle and can be infected by diverse simian immunodeficiency virus isolates. Virology. 1995;213:386–394. doi: 10.1006/viro.1995.0011. [DOI] [PubMed] [Google Scholar]
- 6.Charneau P, Alizon M, Clavel F. A second origin of DNA plus-strand synthesis is required for optimal human immunodeficiency virus replication. J Virol. 1992;66:2814–2820. doi: 10.1128/jvi.66.5.2814-2820.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Charneau P, Clavel F. A single-stranded gap in human immunodeficiency virus unintegrated linear DNA defined by a central copy of the polypurine tract. J Virol. 1991;65:2415–2421. doi: 10.1128/jvi.65.5.2415-2421.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chen C, Okayama H. High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol. 1987;7:2745–2752. doi: 10.1128/mcb.7.8.2745-2752.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Derrington E A, Lopez-Lastra M, Chapel-Fernandez S, Cosset F L, Belin M F, Rudkin B B, Darlix J L. Retroviral vectors for the expression of two genes in human multipotent neural precursors and their differentiated neuronal and glial progeny. Hum Gene Ther. 1999;10:1129–1138. doi: 10.1089/10430349950018120. [DOI] [PubMed] [Google Scholar]
- 10.Desrosiers R C. Non-human primate models for AIDS vaccines. AIDS. 1995;9:S137–S141. [PubMed] [Google Scholar]
- 11.Desrosiers R C, Lifson J D, Gibbs J S, Czajak S C, Howe A Y, Arthur L O, Johnson R P. Identification of highly attenuated mutants of simian immunodeficiency virus. J Virol. 1998;72:1431–1437. doi: 10.1128/jvi.72.2.1431-1437.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ferlazzo G, Wesa A, Wei W Z, Galy A. Dendritic cells generated either from CD34+ progenitor cells or from monocytes differ in their ability to activate antigen-specific CD8+ T cells. J Immunol. 1999;163:3597–3604. [PubMed] [Google Scholar]
- 13.Fouchier R A, Malim M H. Nuclear import of human immunodeficiency virus type-1 preintegration complexes. Adv Virus Res. 1999;52:275–299. doi: 10.1016/s0065-3527(08)60302-4. [DOI] [PubMed] [Google Scholar]
- 14.Giraudon P, Bernard A, Malcus C, Dufay N, Desgranges C, Belin M F. Retroviral infection (HTLV-I) induces cytokine-regulated immunomodulation and cytotoxicity of medulloblastoma cells. J Neuropathol Exp Neurol. 1995;54:165–174. doi: 10.1097/00005072-199503000-00003. [DOI] [PubMed] [Google Scholar]
- 15.Herbst B, Kohler G, Mackensen A, Veelken H, Mertelsmann R, Lindemann A. CD34+ peripheral blood progenitor cell and monocyte derived dendritic cells: a comparative analysis. Br J Haematol. 1997;99:490–499. doi: 10.1046/j.1365-2141.1997.4283238.x. [DOI] [PubMed] [Google Scholar]
- 16.Kestler H W d, Mori K, Silva D P, Kodama T, King N W, Daniel M D, Desrosiers R C. Nef genes of SIV. J Med Primatol. 1990;19:421–429. [PubMed] [Google Scholar]
- 17.Klatzmann D, Valery C A, Bensimon G, Marro B, Boyer O, Mokhtari K, Diquet B, Salzmann J L, Philippon J. A phase I/II study of herpes simplex virus type 1 thymidine kinase “suicide” gene therapy for recurrent glioblastoma. Study Group on Gene Therapy for Glioblastoma. Hum Gene Ther. 1998;9:2595–2604. doi: 10.1089/hum.1998.9.17-2595. [DOI] [PubMed] [Google Scholar]
- 18.Leiden J M, Wang C-Y, Petryniak B, Markovitz D M, Nabel G J, Thompson C B. A novel Ets-related transcription factor, Elf-1, binds to human immunodeficiency virus type 2 regulatory elements that are required for inducible trans activation in T cells. J Virol. 1992;66:5890–5897. doi: 10.1128/jvi.66.10.5890-5897.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lewis P F, Emerman M. Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus. J Virol. 1994;68:510–516. doi: 10.1128/jvi.68.1.510-516.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li X, Mukai T, Young D, Frankel S, Law P, Wong-Staal F. Transduction of CD34+ cells by a vesicular stomatitis virus protein G (VSV-G) pseudotyped HIV-1 vector. Stable gene expression in progeny cells, including dendritic cells. J Hum Virol. 1998;1:346–352. [PubMed] [Google Scholar]
- 21.Liu M L, Winther B L, Kay M A. Pseudotransduction of hepatocytes by using concentrated pseudotyped vesicular stomatitis virus G glycoprotein (VSV-G)-Moloney murine leukemia virus-derived retrovirus vectors: comparison of VSV-G and amphotropic vectors for hepatic gene transfer. J Virol. 1996;70:2497–2502. doi: 10.1128/jvi.70.4.2497-2502.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Luban J, Goff S P. Mutational analysis of cis-acting packaging signals in human immunodeficiency virus type 1 RNA. J Virol. 1994;68:3784–3793. doi: 10.1128/jvi.68.6.3784-3793.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mabrouk K, Van Rietschoten J, Vives E, Darbon H, Rochat H, Sabatier J M. Lethal neurotoxicity in mice of the basic domains of HIV and SIV Rev proteins. Study of these regions by circular dichroism. FEBS Lett. 1991;289:13–17. doi: 10.1016/0014-5793(91)80898-d. [DOI] [PubMed] [Google Scholar]
- 24.Mitrophanous K, Yoon S, Rohll J, Patil D, Wilkes F, Kim V, Kingsman S, Kingsman A, Mazarakis N. Stable gene transfer to the nervous system using a non-primate lentiviral vector. Gene Ther. 1999;6:1808–1818. doi: 10.1038/sj.gt.3301023. [DOI] [PubMed] [Google Scholar]
- 25.Miyazaki Y, Takamatsu T, Nosaka T, Fujita S, Martin T E, Hatanaka M. The cytotoxicity of human immunodeficiency virus type 1 Rev: implications for its interaction with the nucleolar protein B23. Exp Cell Res. 1995;219:93–101. doi: 10.1006/excr.1995.1209. [DOI] [PubMed] [Google Scholar]
- 26.Mortarini R, Anichini A, Di Nicola M, Siena S, Bregni M, Belli F, Molla A, Gianni A M, Parmiani G. Autologous dendritic cells derived from CD34+ progenitors and from monocytes are not functionally equivalent antigen-presenting cells in the induction of melan-A/Mart-1(27-35)-specific CTLs from peripheral blood lymphocytes of melanoma patients with low frequency of CTL precursors. Cancer Res. 1997;57:5534–5541. [PubMed] [Google Scholar]
- 27.Movassagh M, Baillou C, Cosset F L, Klatzmann D, Guigon M, Lemoine F M. High level of retrovirus-mediated gene transfer into dendritic cells derived from cord blood and mobilized peripheral blood CD34+ cells. Hum Gene Ther. 1999;10:175–187. doi: 10.1089/10430349950018977. [DOI] [PubMed] [Google Scholar]
- 28.Naldini L. Lentiviruses as gene transfer agents for delivery to non-dividing cells. Curr Opin Biotechnol. 1998;9:457–463. doi: 10.1016/s0958-1669(98)80029-3. [DOI] [PubMed] [Google Scholar]
- 29.Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, Gage F H, Verma I M, Trono D. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263–267. doi: 10.1126/science.272.5259.263. [DOI] [PubMed] [Google Scholar]
- 29a.Nègre D, Mangeot P E, Duisit G, Blanchard S, Vidalain P O, Leissner P, Winter A J, Rabourdin-Combe C, Mehtali M, Moullier P, Darlix J-L, Cosset F-L. Characterization of novel lentiviral vectors derived from simian immunodeficiency virus that efficiently transduce mature dendritic cells. 2000. Gene Ther., in press. [DOI] [PubMed] [Google Scholar]
- 30.Poeschla E M, Wong-Staal F, Looney D J. Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors. Nat Med. 1998;4:354–357. doi: 10.1038/nm0398-354. [DOI] [PubMed] [Google Scholar]
- 31.Pöhlmann S, Flöss S, Ilyinskii P O, Stamminger T, Kirchhoff F. Sequences just upstream of the simian immunodeficiency virus core enhancer allow efficient replication in the absence of NF-κB and Sp1 binding elements. J Virol. 1998;72:5589–5598. doi: 10.1128/jvi.72.7.5589-5598.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Reeves M E, Royal R E, Lam J S, Rosenberg S A, Hwu P. Retroviral transduction of human dendritic cells with a tumor-associated antigen gene. Cancer Res. 1996;56:5672–5677. [PubMed] [Google Scholar]
- 33.Richardson J H, Child L A, Lever A M. Packaging of human immunodeficiency virus type 1 RNA requires cis-acting sequences outside the 5′ leader region. J Virol. 1993;67:3997–4005. doi: 10.1128/jvi.67.7.3997-4005.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Richardson J H, Kaye J F, Child L A, Lever A M. Helper virus-free transfer of human immunodeficiency virus type 1 vectors. J Gen Virol. 1995;76:691–696. doi: 10.1099/0022-1317-76-3-691. [DOI] [PubMed] [Google Scholar]
- 35.Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med. 1994;179:1109–1118. doi: 10.1084/jem.179.4.1109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sallusto F, Lanzavecchia A. Mobilizing dendritic cells for tolerance, priming, and chronic inflammation. J Exp Med. 1999;189:611–614. doi: 10.1084/jem.189.4.611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Schnell T, Foley P, Wirth M, Munch J, Uberla K. Development of a self-inactivating, minimal lentivirus vector based on simian immunodeficiency virus. Hum Gene Ther. 2000;11:439–447. doi: 10.1089/10430340050015905. [DOI] [PubMed] [Google Scholar]
- 38.Song W, Kong H L, Carpenter H, Torii H, Granstein R, Rafii S, Moore M A, Crystal R G. Dendritic cells genetically modified with an adenovirus vector encoding the cDNA for a model antigen induce protective and therapeutic antitumor immunity. J Exp Med. 1997;186:1247–1256. doi: 10.1084/jem.186.8.1247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Specht J M, Wang G, Do M T, Lam J S, Royal R E, Reeves M E, Rosenberg S A, Hwu P. Dendritic cells retrovirally transduced with a model antigen gene are therapeutically effective against established pulmonary metastases. J Exp Med. 1997;186:1213–1221. doi: 10.1084/jem.186.8.1213. [DOI] [PMC free article] [PubMed] [Google Scholar]






