Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jan 5.
Published in final edited form as: Eur J Pharmacol. 2024 Nov 17;986:177138. doi: 10.1016/j.ejphar.2024.177138

Modified Lipoprotein-induced sFlt1 Production in Human Placental Trophoblasts is Mediated by Protein Kinase C

Rebecca P Chow 1,2, Jiawu Zhao 2, Yanchun Li 1, Tim M Curtis 2,*, Timothy J Lyons 1,2,3,*, Jeremy Y Yu 1,2,*
PMCID: PMC11634635  NIHMSID: NIHMS2037465  PMID: 39551338

Abstract

Background:

Preeclampsia is prevalent in women with diabetes, but the mechanism is unclear. We previously found that oxidized, glycated lipoproteins robustly upregulated soluble fms-like tyrosine kinase-1 (sFlt1), a key mediator of preeclampsia. Here, we determined the role of protein kinase C (PKC) and its subtypes in sFlt1 regulation in placental trophoblasts, and whether this mechanism might mediate the effect of modified lipoproteins.

Methods:

Cultured human HTR8/SVneo and BeWo trophoblasts were treated with the PKC activator phorbol-12-myristate-13-acetate (PMA) for 24h, ± PKC inhibitors GF109203X (general), Ro31–8220 (PKCα-selective), LY333531 (PKCβ-selective) and rottlerin (PKCδ-selective). The effect of ‘heavily oxidized, glycated’ low-density lipoproteins (HOG-LDL) vs. native LDL (N-LDL), ± high glucose (30 mM), was evaluated in HTR8/SVneo cells. sFlt1 secretion (ELISA), mRNA expression (RT-qPCR), and cellular PKC activity were measured.

Results:

PMA stimulated robust sFlt1 release and mRNA expression in both cell lines; these effects were inhibited by GF109203X, Ro31–8220 and LY333531 in a concentration-dependent manner. Rottlerin inhibited sFlt1 in BeWo, but modestly enhanced it in HTR8/SVneo cells. HOG-LDL enhanced PKC activity vs. N-LDL in HTR8/SVneo cells. Also, HOG-LDL, but not high glucose, significantly increased sFlt1 secretion and mRNA expression; this response was inhibited by GF109203X, Ro31–8220 and LY333531 at concentrations comparable to those that blocked PMA induction of sFlt1.

Conclusion:

Modified lipoproteins upregulate sFlt1 in trophoblasts via a PKC-mediated mechanism, involving at least α and β isoforms. The data suggest potential therapeutic targets to reduce the risk of preeclampsia in women with diabetes.

Keywords: diabetes, lipoprotein, preeclampsia, protein kinase C, sFlt1, trophoblast

1. Introduction

Preeclampsia (PE) is new-onset hypertension with proteinuria, or per more recent criteria, with other organ damage, occurring after 20 weeks of gestation (ACOG, 2013; Brown et al., 2001). It causes perinatal mortality and morbidity, as well as longer-term cardiovascular and metabolic disorders (Feig et al., 2013; Seely et al., 2013). Its prevalence is 3–5% in the general population but is 3–6-fold higher in women with diabetes (Holmes et al., 2013; Powers et al., 2010; Yu et al., 2009). PE remains a challenge: its etiology is illusive, pathogenesis is not fully understood, and there is no reliable therapy. Preventive low-dose aspirin is often given to high-risk women, but efficacy is modest (Askie et al., 2007; Duley et al., 2007; Henderson et al., 2014). New understanding of disease mechanisms is needed to develop effective therapies.

PE stems from underdeveloped uterine spiral arterioles early in pregnancy, later resulting in the placenta undergoing hypoxia and oxidative stress and releasing ‘toxic’ factors into mother’s circulation, eventually damaging vascular endothelia (Roberts and Hubel, 2009). A key circulating factor is soluble fms-like tyrosine kinase-1 (sFlt1), an extracellular fragment of vascular endothelial growth factor (VEGF) receptor 1, generated by alternative splicing (Levine et al., 2004; Naljayan and Karumanchi, 2013). Its excessive levels in maternal blood neutralize VEGF and placental growth factor (PlGF), resulting in deficient angiogenic signaling; the latter leads to generalized endothelial dysfunction and clinical PE. Plasma sFlt1 levels arise weeks before clinical onset (Levine et al., 2004; Naljayan and Karumanchi, 2013; Yu et al., 2009) and correlate with disease severity (Rana et al., 2013). sFlt1 is a potential drug development target (Thadhani et al., 2016; Thadhani et al., 2011).

The mechanism(s) underlying the increased risk for PE in diabetic pregnancy is not fully understood. We previously reported in a prospective study of pregnant women with type 1 diabetes that plasma sFlt1 levels were significantly increased in those who later developed PE, compared with those who remained normotensive (Yu et al., 2009). While we found that sFlt1 concentrations were similar (and similarly predictive of PE) between women with vs without diabetes, other studies suggested a trend towards elevated levels in diabetic women (Cohen et al., 2014; Powers et al., 2010). In contrast, soluble endoglin was elevated in all pregnant women with diabetes, regardless of PE outcome (Yu et al., 2009). We postulated that diabetic milieu may increase the likelihood of an elevation of one soluble anti-angiogenic factor (sFlt1) while promoting a general increase of the other (soluble endoglin), thus providing a ‘fertile soil’ for PE development (Yu et al., 2009).

Some have investigated the effect of hyperglycemia on sFlt1: high glucose generally increases sFlt1 secretion from cultured trophoblasts (Cawyer et al., 2016; Han et al., 2015; Mitsui et al., 2018). Recently, we reported the evidence of oxidized LDL deposition in human preeclamptic placentas; we also showed that ‘highly oxidized, glycated’ LDL (HOG-LDL) significantly enhanced trophoblast expression and release of sFlt1 and impaired placental barrier, suggesting an important role of modified lipoproteins in PE pathogenesis (McLeese et al., 2021). Plasma levels of oxidized LDL are elevated in PE patients both with (Ghaneei et al., 2015) and without diabetes (Arifin et al., 2017; Kim et al., 2007; Uzun et al., 2005; Zhang et al., 2015).

A major cellular mechanism implicated in diabetic vascular complications is protein kinase C (PKC) activation (Brownlee, 2001). Interestingly, PKC modulates sFlt1 expression in endothelial cells and macrophages (Al-Ani et al., 2010; Lee et al., 2008; Raikwar et al., 2013). There is evidence that this mechanism also operates in placental trophoblasts (Jiang et al., 2014b), and Mitsui et al. reported that PKCβ mediated sFlt1 release caused by high glucose (Mitsui et al., 2018). However, it is unclear if PKC also mediates the effect of modified lipoproteins. We aimed to determine the functional involvement of PKC in sFlt1 regulation in trophoblasts, and whether this mechanism might be enhanced by modified lipoproteins.

2. Materials and Methods

2.1. Human lipoprotein preparation

As previously described (Barth et al., 2007; Yu et al., 2016), freshly pooled plasma was obtained from 3–4 healthy volunteers (age 20–40 years) who were taking neither prescribed medications nor antioxidant supplements. The study was approved by the Institutional Review Board of Medical University of South Carolina and the Research Ethics Committee of Queen’s University Belfast; all donors gave informed consent. Briefly, native LDL (N-LDL; density 1.019–1.063 g/ml) was isolated by sequential ultracentrifugation. Glycated LDL was prepared by incubating N-LDL with 50 mM glucose (37°C, 72h) under antioxidant environment (1 mM diethylenetriaminepentaacetic acid with 270 μM ethylenediaminetetraacetic acid (EDTA)), and then dialyzed to remove the glucose and antioxidants. HOG-LDL was prepared by oxidizing the glycated LDL with 10 μM CuCl2 at 37°C for 24h. After extensive dialysis, HOG-LDL was passed through a 22-μM sterile filter to remove potential aggregates. Lipoprotein preparations were characterized by gel electrophoresis (Paragon LIPO Gel; Beckman, Fullerton, CA, USA), fluorescence at excitation wavelength 360 nM and emission at 430 nM (Fluoro IV fluorometer; Gilford Instruments, Oberlin, OH, USA), and absorbance at 234 nm (Beckman DU-650 spectrophotometer; Beckman, Fullerton, CA, USA), and tested free of endotoxin (Limulus Amebocyte Lysate assay, Lonza, Walkersville, MD, USA). Protein concentrations were determined using a Pierce BCA protein assay (ThermoFisher Scientific, Waltham, MA, USA).

2.2. Cell culture and drug treatment

We included two representative human trophoblast cell lines for experiments with PKC ligands: HTR-8/SVneo is frequently used to simulate villous and extravillous cytotrophoblasts (Graham et al., 1993), and BeWo is a model for villous syncytiotrophoblasts (Wice et al., 1990), the predominant source of sFlt1 from the placenta (Nevo et al., 2006). The lipoprotein experiments were conducted in HTR-8/SVneo cells only, since BeWo cells do not tolerate serum-free culture medium where there are no constitutive serum proteins to interfere with lipoprotein’s effects.

The human trophoblast cell line HTR8/SVneo (a gift from Professor Charles Graham of Queen’s University at Kingston, ON, Canada) was cultured in RPMI 1640 (Gibco, Pittsburgh, PA, USA) supplemented with 10% fetal bovine serum (FBS). The human choriocarcinoma trophoblast cell line BeWo was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA), and maintained in DMEM/F12 (Gibco, Pittsburgh, PA, USA) supplemented with 10% FBS and 1% L-glutamine.

For experiments, HTR8/SVneo and BeWo cells were seeded onto 6-well (3×105 cells/well) or 48-well culture plates (0.6×105 cells/well) to reach an approximately 80–90% confluency overnight in media with 10% FBS. Then, the cells were treated with the PKC activator phorbol-12-myristate-13-acetate (PMA, Sigma, St. Louis, MO, USA) at varying concentrations (0.5–50 nM) for 24h. For the PKC inhibition experiments, cells were pre-treated for 1h with the PKC inhibitors GF109203X (GF109; nonselective), Ro31–8220 (Ro3; PKCα-selective), LY333531 (LY; PKCβ-selective) and rottlerin (Rott; PKCδ-selective) (all from Tocris Bioscience, Minneapolis, MN, USA) before agonist treatments. Separately, HTR8/SVneo cells were treated with human HOG-LDL (100 μg protein/ml) vs. native LDL (N-LDL, 100 μg protein/ml) ± high glucose (30 mM final concentration) in serum-free medium for 24h, with or without 1h pre-treatment of the PKC inhibitors. The drug stock solutions (1 mM) were initially prepared in ethanol, and then serially diluted into the final working concentrations in cell culture medium following the manufacturer’s recommendation; the vehicle itself had no effect on sFlt1 expression or release. The supernatants were collected and centrifuged to remove cell debris, and cell pellets were rinsed with cold phosphate-buffered saline (PBS); all samples were stored at −80°C until analysis.

2.3. Enzyme-linked immunosorbent assay (ELISA)

sFlt1 protein concentrations were measured in cell culture supernatants using a high-sensitivity human VEGF R1/Flt-1 Quantikine ELISA Kit (DVR100C; R&D Systems, Minneapolis, MN, USA), following manufacturer’s instructions. Each sample was analyzed in duplicate. Only data assayed from the same ELISA plate were used for comparison.

2.4. Reverse transcriptase real-time PCR (RT-PCR)

Total RNA was extracted from cell pellets using a RNeasy Mini Kit (Qiagen, Germantown, MD, USA), and 10 μg RNA was reverse-transcribed using the SuperScript II Reverse Transcriptase (Invitrogen, Waltham, MA, USA) per manufacturer’s protocols. Relative gene expressions of the two most dominant sFlt1 isoforms, i13 and e15a, were quantified by RT-PCR. The primers included sFlt1 i13 forward: ACAATCAGAGGTGAGCACTGCAA, sFlt1 i13 reverse: TCCGAGCCTGAAAGTTAGCAA; sFlt1 e15a forward: ACACAGTGGCCATCAGCAGTT, sFlt1 e15a reverse: CCCGGCCATTTGTTATTGTTA; β-actin forward: TGGGACGACATGGAGAAAAT, β-actin reverse: GAGGCGTACAGGGATAGCAC. The PCR experimental conditions were as follows: 95°C for 10min, followed by 40 cycles at 95°C for 15s, 58°C for 30s and 72°C for 30s. Fold changes in gene expression was calculated using the comparative Ct method (2−ΔΔCt), with β-actin as a reference house-keeping gene. Each sample was analyzed in duplicate.

2.5. PKC activity assay

PKC phosphotransferase activity was measured in cell lysates using a PKC kinase activity kit (Enzo Life Science, Farmingdale, NY, USA). This is a solid-phase microtiter plate assay that utilizes a pre-coated specific synthetic peptide as a substrate and a polyclonal antibody that recognizes the phosphorylated substrate. All samples were diluted 5-fold using the provided dilution buffer and loaded into plate wells in duplicate, followed by addition of ATP to initiate the reaction. The reaction was terminated by emptying contents of each well, and the polyclonal antibody was added to the wells and subsequently bound by a peroxidase-conjugated secondary antibody. The assay was completed after addition of tetramethylbenzidine (TMB), with the color intensity read by a microplate reader at the 450 nm wavelength. PKC activity measurements were normalized to the total protein concentration (Pierce BCA protein assay, ThermoFisher Scientific, Waltham, MA, USA) for data analysis.

2.6. Cell viability assay

Cell viability was determined in 96-well culture plates (1000 cells/well) at approximately 80–90% confluency. After 24h treatment with PMA or HOG-LDL (vs. N-LDL), in the presence or absence of the PKC inhibitors, 10 μl of the Cell Counting Kit-8 solution (CCK-8; Dojindo, Rockville, MD, USA) was added into each well. The plate was then incubated at 37°C for 30mins in dark, with the absorbance (450nm) subsequently measured by a microplate reader.

2.7. Data analysis

Data are expressed as means ± SEM. Data normality was evaluated, and statistical significance was determined by Student t-test, or one- and two-way ANOVA followed by Dunnett’s or Bonferroni post-hoc test as appropriate (Prism 8, GraphPad Software, San Diego, CA, USA). P ≤ 0.05 was considered significant. IC50 and EC50 values were estimated by Prism 8.

3. Results

3.1. PMA increased sFlt1 protein release and mRNA expression in trophoblasts

We first evaluated the concentration-response relationship for the PKC activator, PMA, on the secretion of sFlt1 from cultured HTR8/SVneo and BeWo cells. PMA treatment for 24h significantly enhanced sFlt1 release in both cell lines in a concentration-dependent manner, reaching a plateau after approximately 5 nM concentration (Fig. 1A, B). The mean EC50 was 1.6 nM for HTR8/SVneo (Fig. 1C) and 2.4 nM for BeWo (Fig. 1D). Consistent with the protein levels, mRNA expression for the two predominant sFlt1 isoforms, i13 and e15a, also increased over 2-fold in HTR8/SVneo cells after 24h PMA (5 nM) treatment (Fig. 1E). However, the mRNA expression was not significantly increased at 24h in BeWo (Fig. 1F). We therefore determined the time-course changes of sFlt1 mRNA expression (Fig. 1E–F): PMA (5 nM) elicited a more sustained effect in HTR8/SVneo than BeWo cells, and the responsive isoform in BeWo was primarily sFlt1 i13 while e15a exhibited minimal change. Based on these findings, we chose the 5 nM PMA concentration (which elicited a near-maximal response) for the subsequent experiments.

Figure 1. Effects of PMA on sFlt1 protein release and mRNA expression in cultured trophoblasts.

Figure 1.

Open in a new tab

HTR8/SVneo (A) and BeWo cells (B) were treated with the PKC activator, PMA (0.5–50 nM, 24h); supernatant sFlt1 concentrations were measured by ELISA. Half maximal effective concentrations (EC50) of PMA in HTR8/SVneo (C) and BeWo (D) were determined. Expression of sFlt1 mRNA isoforms i13 and e15a was determined at 3, 6 and 24h following PMA treatment (5 nM) in HTR8/SVneo (E) and BeWo (F). Data are presented as means ± SEM, n = 3 independent experiments, each in duplicate. One-way ANOVA followed by Dunnett’s test. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. vehicle control (0 nM) or time zero.

3.2. PMA-induced sFlt1 protein release and mRNA expression were inhibited by PKC inhibitors concentration-dependently

To confirm the role of PKC and its isoforms on PMA-induced sFlt1in HTR8/SVneo cells, we pre-treated the cells with the PKC inhibitors GF109203X (general PKC inhibitor), Ro31–8220 (PKCα-selective), LY333531 (PKCβ-selective) and rottlerin (PKCδ-selective) at six concentrations for 1h, followed by 5 nM PMA treatment for 24h (i.e., total inhibitor treatment for 25h). Overall, GF109203X (Fig. 2A), Ro31–8220 (Fig. 2B) and LY333531 (Fig. 2C) antagonized PMA-induced sFlt1 release in a concentration-dependent manner, at potencies of 105 nM (Fig. 2E), 1.4 μM (Fig. 2F), and 31.3 nM (Fig. 2G), respectively (P < 0.0001 for all inhibitors, one-way ANOVA vs. PMA treatment alone). However, rottlerin did not exhibit any inhibitory effect, but on the contrary increased PMA-induced sFlt1 release at 300–3000 nM concentrations (Fig. 2D, H). No statistically significant changes in cell viability were observed in these experiments, although there appeared to be a trend of inhibition at higher concentrations of Ro31–8220 (Supplementary Fig. S1).

Figure 2. Effects of PKC inhibitors on PMA-elicited sFlt1 release in cultured HTR8/SVneo cells.

Figure 2.

Open in a new tab

Cells were pre-treated with the PKC inhibitor (A) GF109203X (GF109, general PKC inhibitor), (B) Ro31–8220 (Ro3, PKCα selective), (C) LY333531 (LY, PKCβ selective) and (D) rottlerin (Rott, PKCδ selective) at six concentrations for 1h, followed by PMA treatment (5 nM) for 24h. Supernatant sFlt1 concentrations were measured by ELISA. IC50 and EC50 values (E-H) were calculated. Data are presented as means ± SEM, n = 3 independent experiments, each in duplicate. One-way ANOVA followed by Dunnett’s test. *P < 0.5 and ***P < 0.001 vs. non-PMA-treated control (C); ΦP < 0.05, ΦΦP < 0.01 and ΦΦΦP < 0.001 vs. PMA treatment alone.

In BeWo cells, we tested the effect of PKC inhibitors at their IC50 or EC50 concentrations as determined above. A shown in Supplementary Fig. S2A, GF109203X (105 nM), Ro31–8220 (1.4 μM) and LY333531 (30 nM) all significantly reduced PMA-elicited sFlt1 release, and there was a trend of reduction by rottlerin (240 nM). However, Ro31–8220 at 1.4 μM exhibited an inhibitory effect on cell viability (Fig. S2B). Further concentration-response experiments showed that rottlerin modestly inhibited sFlt1 secretion in BeWo cells (Fig. S2C), in contrast to HTR8/SVneo cells (Fig. 2).

We queried the gene expression profile of PKCα, PKCβ and PKCδ in both HTR8/SVneo and BeWo cells using the Gene Expression Omnibus (GEO) database. The results from 12 independent studies per cell line are summarized in Supplementary Fig. S3A–B. Overall, the relative gene expression was PKCβ << PKCδ < PKCα in HTR8/SVneo cells. In BeWo cells there was a trend of lower expression of PKCβ than PKCα, but the expression of both isoforms was substantially lower than that of PKCδ.

3.3. Modified LDL increased PKC activity and enhanced sFlt1 protein release and mRNA expression, which were attenuated by PKC inhibition

We determined whether HOG-LDL would modulate PKC activity in HTR8/SVneo cells. As shown in Fig. 3, N-LDL did not change PKC activity relative to the vehicle control, but HOG-LDL significantly enhanced PKC activity by 50% vs. N-LDL (both at 100 μg protein/ml).

Figure 3. Relative PKC activity in HTR8/SVneo cells after treatment with HOG- vs. N-LDL.

Figure 3.

Open in a new tab

PKC activity was measured in cell lysates from cultured HTR8/SVneo cells treated with HOG- vs. N-LDL (both at 100 μg protein/ml) and vehicle for 24h. Data are presented as means ± SEM, n = 3 independent experiments, each in duplicate. One-way ANOVA followed by Dunnett’s test. **P < 0.01 vs. N-LDL and vehicle control.

To determine whether diabetes-relevant stimuli would upregulate sFlt1 via the PKC pathway, HTR8/SVneo cells cultured in the serum-free medium were treated with HOG-LDL vs. N-LDL (100 μg protein/ml, 24h), in the presence and absence of high glucose (i.e., final glucose concentration in the culture medium was 30 mM). HOG-LDL induced robust sFlt1 release and mRNA expression, and these were reduced by pre-treatment with 5 μM GF109203X (Fig. 4A, C–D). High glucose did not significantly affect cell viability (Fig. 4B), sFlt1 protein release, or sFlt1 mRNA expression (Fig. 4A, C–D), nor did it alter the effect of HOG-LDL.

Figure 4. Effects of PKC inhibition on sFlt1 secretion from HTR8/SVneo cells induced by HOG-LDL ± high glucose.

Figure 4.

Open in a new tab

Cells were pre-treated with the general PKC inhibitor GF109203X (GF109, 5 μM) or vehicle 1h prior to the treatment of HOG- vs. N-LDL (100 μg protein/ml, 24 h), with or without the presence of high glucose (total final concentration 30 mM). (A) sFlt1 concentration was measured by ELISA. (B) Cell viability was determined by the CCK-8 assay. (C-D) Gene expression of the sFlt1 isoforms i13 and e15a was quantified by RT-PCR. Data are presented as means ± SEM, n = 3 independent experiments, each in duplicate. One-way ANONA followed by Dunnett’s test or two-way ANOVA followed by Bonferroni’s test. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. N-LDL and vehicle control; +P < 0.05 and ++P < 0.01 vs. HOG-LDL in the absence of high glucose.

3.4. Concentration-dependent inhibition of HOG-LDL-elicited sFlt1 release from HTR8/SVneo cells by PKC inhibitors

To further evaluate the PKC-mediated mechanism and the isoforms involved in HOG-LDL-elicited sFlt1 release in HTR8/SVneo trophoblasts, we established the concentration-response relationship for the PKC inhibitors. GF109203X (Fig. 5A), Ro31–8220 (Fig. 5B) and LY333531 (Fig. 5C) all antagonized HOG-LDL-induced sFlt1 release in a concentration-related fashion, with mean IC50 values at 121 nM, 0.3 μM and 35 nM, respectively (Figs. 5D–F). These cellular inhibitory potencies were consistent with those against PMA-induced sFlt1 release (Table 1).

Figure 5. Concentration-dependent reduction of HOG-LDL-elicited sFlt1 release from cultured HTR8/SVneo cells by PKC inhibitors.

Figure 5.

Open in a new tab

Cells were pre-treated with (A) GF109203X (GF109, general PKC inhibitor), (B) Ro31–8220 (Ro3, PKCα selective) or (C) LY333531 (LY, PKCβ selective) at six concentrations for 1h, followed by treatment with 100 μg/ml HOG-LDL vs. N-LDL for 24h. Supernatant sFlt1 concentrations were measured by ELISA. IC50 values (D-F) were calculated. Data are presented as means ± SEM, n = 3 independent experiments, each in duplicate. One-way ANOVA followed by Dunnett’s test. *P < 0.5, **P < 0.01 and ***P < 0.001 vs. N-LDL and vehicle control (C); ΦP < 0.05, ΦΦP < 0.01 and ΦΦΦP < 0.001 vs. HOG-LDL.

Table 1.

Comparison of mean IC50 values for PKC inhibitors in inhibiting PMA- and HOG-LDL-elicited sFlt1 release from HTR8/SVneo cells

IC50 against PMA-induced sFlt1 release (nM) IC50 against HOG-LDL-induced sFlt1 release (nM)
GF109203X 105 121
Ro31-8220 1400 300
LY333531 31.3 35.3
Open in a new tab

Values summarized from Figures 2 and 5.

4. Discussion

We report that PKC activation promoted sFlt1 protein release and mRNA expression in both HTR8/SVneo and BeWo trophoblasts, and these effects were inhibited by the PKC inhibitors GF109203X, Ro31–8220 and LY333531. Rottlerin however exhibited differential effects on the two cell lines, modestly enhancing sFlt1 release in the former while suppressing its release in the latter. HOG-LDL robustly stimulated sFlt1 protein and mRNA expression in HTR8/SVneo cells, and this effect was attenuated by GF109203X, Ro31–8220 and LY333531 at inhibitory potencies comparable to those against PMA-induced sFlt1 responses. Additionally, PKC activity was elevated in HTR8/SVneo cells following exposure to HOG-LDL. The data suggest that modified lipoproteins may promote the release of the anti-angiogenic factor sFlt1 and hence PE development via a PKC-mediated mechanism.

PKC is well known to play an important role in diabetic vascular complications (Brownlee, 2001): its abnormal activation leads to a variety of consequences such as blood flow abnormalities, VEGF overexpression, vascular leakage, neovascularization, inflammation and oxidative stress, any of which may contribute to the development of diabetic retinopathy and nephropathy. Similar mechanisms may also be implicated in PE. Thus, serum from women with PE activates PKC in cultured human umbilical artery endothelial and smooth muscle cells, resulting in an increase in permeability, inflammation, intracellular calcium, and collagen turnover (Haller et al., 1998; Jiang et al., 2010; Jiang et al., 2014a). Higher concentrations of phosphorylated PKCα, βII and δ have been reported in placentas from term pregnancies with vs. without PE, while phosphorylated PKCα and βII appeared to be reduced in placentas of pre-term pregnancies with vs. without PE (Shu et al., 2014). Intriguingly, there is evidence that activation of PKC can increase the expression and release of sFlt1, an anti-angiogenic factor, in vascular endothelial cells and macrophages (Al-Ani et al., 2010; Lee et al., 2008; Raikwar et al., 2013). Although sFlt1 is produced by extra-placental tissues such as vascular cells and macrophages, the primary source of elevated circulating sFlt1 during pregnancy, especially in women with PE, is thought to be the placenta. So far, there have been limited studies on the role of PKC in regulation of sFlt1 in trophoblasts. Jiang et al. (Jiang et al., 2014b) reported that choline deficiency in HTR8/SVneo cells led to higher levels of PKC isoforms, together with an increased sFlt1 expression; these effects were partially normalized by the broad-spectrum PKC inhibitor GF109203X (1 μM). Mitsui et al. (Mitsui et al., 2018) found that high glucose-induced sFlt1 upregulation was suppressed by the PKCβ inhibitor LY333531 at 200 nM in BeWo cells; however, no other PKC isoforms were investigated in their study.

We showed that PMA enhanced sFlt1 release from both HTR8/SVneo and BeWo cells in a concentration-dependent fashion, reaching a maximum of 3 and 4.6-fold, respectively, an effect greater than that elicited by hypoxia (Zhao et al., 2021). The EC50 values (1.6–2.4 nM) were in agreement with the single-digit nM potency reported in the literature (Castagna et al., 1982). PMA also increased sFlt1 mRNA expression. Interestingly, while HTR8/SVneo cells exhibited upregulation of both sFlt1 i13 and e15a transcripts at 24h, only the expression of i13, but not e15a, was enhanced in BeWo cells and in these cells, the effect was transient with a complete recovery to the basal level after 24h. A similar transient temporal effect of PMA on sFlt1 i13 expression was previously reported in human umbilical vein endothelial cells (Raikwar et al., 2013).

We further confirmed the involvement of PKC using pharmacologic inhibitors. GF109203X, Ro31–8220 and LY333531 are ATP-competitive PKC inhibitors. Toullec et al. (Toullec et al., 1991) showed that GF109203X had a Ki of 14 nM in competition with ATP and exhibited a similar range of potencies towards PKC subtypes in enzymatic assays; however, its cellular IC50 in platelets varied from 190 to 910 nM depending on the agonists and endpoint readouts studied. With relevance to sFlt1, only one study has examined the concentration-response relationship thus far: GF109203X inhibited lipopolysaccharides (LPS)-stimulated sFlt1 secretion in cultured murine macrophages with an IC50 above 500 nM (Lee et al., 2008), higher than that in our study. Ro31–8220 has a 5 nM IC50 for PKCα in enzymatic assays; although its modest selectivity (3–5-fold over the other PKC subtypes) (Wilkinson et al., 1993) may not be sufficient for subtype differentiation in cellular studies, we nevertheless included it in the analysis. In line with our present data, Ro31–8220 has been previously shown to modulate biological effects at cellular IC50 values of 1 μM (McKenna and Hanson, 1993) and 2.5–5 μM (Shen and Glazer, 1998). LY333531 (Ruboxistaurin) was previously in development as a potential therapy for diabetic retinopathy; it has a nanomolar potency on PKCβ and over 60-fold selectivity vs. PKCα (Jirousek et al., 1996). It has IC50 values of 320 nM and 210 nM in a rat brain PKC assay and a plasminogen activator assay in endothelial cells, respectively (Jirousek et al., 1996). Therefore, our finding of a high cellular potency (31.3 nM) of LY333531 in trophoblasts supports a role of PKCβ; this is in line with an earlier report that LY333531 (200 nM) abrogated the sFlt1 response evoked by high glucose in trophoblasts (Mitsui et al., 2018). Besides its effect on sFlt1, PKCβ has been implicated in autophagy, another contributing mechanism in PE (Zhao et al., 2020).

It is surprising that rottlerin did not inhibit, but instead enhanced, PMA-induced sFlt1 at 0.3–3 μM concentrations in HTR8/SVneo cells. Rottlerin has an IC50 of 3–6 μM for PKCδ and a selectivity over 5–17 fold than of other PKC family members (Gschwendt et al., 1994). Previously, this concentration range has been shown to inhibit LPS-induced sFlt1 response in cultured murine macrophages (Lee et al., 2008), suggesting possible tissue- or species-specific differences. In this study, we used relatively low concentrations (up to 3 μM) to maintain selectivity. However, it has been reported that rottlerin has multiple off-target effects independent of PKCδ, including uncoupling mitochondrial oxidative phosphorylation, activating AMPK, increasing potassium channel activity, and interacting with some other enzymes and kinases (Soltoff, 2007). Nevertheless, whichever the underlying mechanism is involved, the apparent differential effects of rottlerin in the two trophoblast cell types are intriguing and require further investigation.

We examined the PKC isoform gene expression profile in HTR8/SVneo and BeWo trophoblasts in the GEO datasets. Overall, PKCβ exhibited the lowest expression in both cell lines, whereas the expression of PKCδ was substantially higher than both PKCα and PKCβ in BeWo cells. Whether this gene expression pattern is related to the differential PKCδ effects and the relative potencies of PKC isoform-selective inhibitors in sFlt1 modulation in the two cell lines requires further investigation.

We confirmed our recent finding that HOG-LDL robustly stimulates sFlt1 release and mRNA expression from HTR8/SVneo cells (McLeese et al., 2021). With regard to high glucose, we previously observed that it did not significantly affect sFlt1, but instead augmented HOG-LDL’s effect (McLeese et al., 2021). However, high glucose appeared to have a minimal effect in our present study, possibly due to the short (i.e., 24h) incubation duration. Overall, these data suggest a potentially more critical role for modified lipoproteins than hyperglycemia in PE development. It is important to note that the cellular IC50 values for GF109203X and LY333531 in antagonizing HOG-LDL-induced sFlt1 release were almost identical to those evoked by PMA, supporting the contention that PKC and its β subtype mediate the sFlt1 response from both stimuli. Ro31–8220 exhibited a modestly higher (4.7-fold) potency in trophoblasts in exposure to HOG-LDL than PMA, suggesting an involvement of PKCα.

We also showed, for the first time, that modified LDL enhanced PKC activity in trophoblasts. Together, these findings are consistent with our working hypothesis that extravasated modified plasma lipoproteins may be an underappreciated, ‘hidden’ mechanism to promote the development of diabetic vascular complications, including PE (McLeese et al., 2021; Yu and Lyons, 2013). We have previously observed the deposition of apoB-100, ox-LDL and ox-LDL immune complexes in the retinal tissue even before the onset of clinical retinopathy and thereafter in greater amounts commensurate with disease severity (Fu et al., 2014; Wu et al., 2008). Recently, we reported that such a mechanism also occurs in the placenta and mediates the upregulation of anti-angiogenic factors in PE (McLeese et al., 2021). Our data therefore provide a plausible cellular mechanism. While much focus in research addressing the high risk for PE in diabetes has been on high glucose (Cawyer et al., 2016; Han et al., 2015; Mitsui et al., 2018), evidence from our recent diabetic retinopathy work supports a possibly more significant role of modified lipoproteins as ‘secondary mediators’ (i.e., consequences of hyperglycemia and vascular leakage) in the pathogenesis of diabetic complications (Yu et al., 2016).

The strengths of this study include the detailed characterization of pharmacologic concentration response relationships and selection of the submaximal concentrations for the stimulus agents. The study, however, has some limitations. First, interpretation of our data is complicated by the drug selectivity and the potency differences caused by experimental conditions such as cell-free vs. cellular systems, different cell and tissue types, as well as different stimuli and endpoint readouts. We tried to circumvent these drawbacks by establishing concentration-response relationships, which allowed for calculation of drug potencies in comparison with the published data. Our EC50 and IC50 data are in general consistent with the literature. Second, our investigation of the PKC subtypes was not exhaustive, due to the lack of highly selective agents.

In summary, we found that PKC exerts robust upregulation of sFlt1 release and expression in two culture models of human placental trophoblasts. This effect involves PKCα and β in both. Further, we show that the activation of PKC in trophoblast cells occurs in response to modified lipoprotein (HOG-LDL), explaining the effect of HOG-LDL on sFlt1 release. We conclude that, analogous to their effects in the diabetic retina, extravasation and modification of lipoproteins may promote the development, and contribute to the high prevalence, of PE in women with diabetes.

Supplementary Material

1

Acknowledgements

The authors are grateful to Professor Charles Graham (Queen’s University at Kingston, Canada) for providing the HTR8/SVneo cell line.

Funding support

This work was supported by a PhD scholarship to RPC from the Queen’s University Belfast, grant #R01HD096501 from the NIH/NICHD, and grant #0703-03 from the Saving Lives at Birth (a partnership between the United States Agency for International Development, the Norwegian Ministry of Foreign Affairs, the Bill & Melinda Gates Foundation, Grand Challenges Canada and the Department for International Development of United Kingdom). The content is the sole responsibility of the authors and does not necessarily represent the official views of the funding agencies.

Abbreviations:

ELISA

enzyme-linked immunosorbent assay

FBS

fetal bovine serum

HOG-LDL

heavily oxidized, glycated low-density lipoproteins

LPS

lipopolysaccharides

N-LDL

native low-density lipoproteins

PBS

phosphate-buffered saline

PKC

protein kinase C

PlGF

placental growth factor

PMA

phorbol-12-myristate-13-acetate

sEng

soluble endoglin

sFlt1

soluble fms-like tyrosine kinase-1

VEGF

vascular endothelial growth factor

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of competing interest

The authors declare that there is no duality of interest associated with this manuscript.

Declaration of generative AI and AI-assisted technologies in the writing process

No generative artificial intelligence (AI) and AI-assisted technologies were used in the writing process of this manuscript.

Data Availability

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

References

  1. ACOG, 2013. Hypertension in Pregnancy, Report of the American College of Obstetricians and Gynecologists’ Task Force on Hypertension in Pregnancy. Obstet Gynecol 122, 1122–1131. [DOI] [PubMed] [Google Scholar]
  2. Al-Ani B, Hewett PW, Cudmore MJ, Fujisawa T, Saifeddine M, Williams H, Ramma W, Sissaoui S, Jayaraman PS, Ohba M, Ahmad S, Hollenberg MD, Ahmed A, 2010. Activation of proteinase-activated receptor 2 stimulates soluble vascular endothelial growth factor receptor 1 release via epidermal growth factor receptor transactivation in endothelial cells. Hypertension 55, 689–697. [DOI] [PubMed] [Google Scholar]
  3. Arifin R, Kyi WM, Che Yaakob CA, Yaacob NM, 2017. Increased circulating oxidised low-density lipoprotein and antibodies to oxidised low-density lipoprotein in preeclampsia. J Obstet Gynaecol 37, 580–584. [DOI] [PubMed] [Google Scholar]
  4. Askie LM, Duley L, Henderson-Smart DJ, Stewart LA, 2007. Antiplatelet agents for prevention of pre-eclampsia: a meta-analysis of individual patient data. Lancet 369, 1791–1798. [DOI] [PubMed] [Google Scholar]
  5. Barth JL, Yu Y, Song W, Lu K, Dashti A, Huang Y, Argraves WS, Lyons TJ, 2007. Oxidised, glycated LDL selectively influences tissue inhibitor of metalloproteinase-3 gene expression and protein production in human retinal capillary pericytes. Diabetologia 50, 2200–2208. [DOI] [PubMed] [Google Scholar]
  6. Brown MA, Lindheimer MD, de Swiet M, Van Assche A, Moutquin JM, 2001. The classification and diagnosis of the hypertensive disorders of pregnancy: statement from the International Society for the Study of Hypertension in Pregnancy (ISSHP). Hypertens Pregnancy 20, IX–XIV. [DOI] [PubMed] [Google Scholar]
  7. Brownlee M, 2001. Biochemistry and molecular cell biology of diabetic complications. Nature 414, 813–820. [DOI] [PubMed] [Google Scholar]
  8. Castagna M, Takai Y, Kaibuchi K, Sano K, Kikkawa U, Nishizuka Y, 1982. Direct activation of calcium-activated, phospholipid-dependent protein kinase by tumor-promoting phorbol esters. J Biol Chem 257, 7847–7851. [PubMed] [Google Scholar]
  9. Cawyer C, Afroze SH, Drever N, Allen S, Jones R, Zawieja DC, Kuehl T, Uddin MN, 2016. Attenuation of hyperglycemia-induced apoptotic signaling and anti-angiogenic milieu in cultured cytotrophoblast cells. Hypertens Pregnancy 35, 159–169. [DOI] [PubMed] [Google Scholar]
  10. Cohen AL, Wenger JB, James-Todd T, Lamparello BM, Halprin E, Serdy S, Fan S, Horowitz GL, Lim KH, Rana S, Takoudes TC, Wyckoff JA, Thadhani R, Karumanchi SA, Brown FM, 2014. The association of circulating angiogenic factors and HbA1c with the risk of preeclampsia in women with preexisting diabetes. Hypertens Pregnancy 33, 81–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Duley L, Henderson-Smart DJ, Meher S, King JF, 2007. Antiplatelet agents for preventing pre-eclampsia and its complications. Cochrane Database Syst Rev, CD004659. [DOI] [PubMed] [Google Scholar]
  12. Feig DS, Shah BR, Lipscombe LL, Wu CF, Ray JG, Lowe J, Hwee J, Booth GL, 2013. Preeclampsia as a risk factor for diabetes: a population-based cohort study. PLoS Med 10, e1001425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu D, Yu JY, Wu M, Du M, Chen Y, Abdelsamie SA, Li Y, Chen J, Boulton ME, Ma JX, Lopes-Virella MF, Virella G, Lyons TJ, 2014. Immune complex formation in human diabetic retina enhances toxicity of oxidized LDL towards retinal capillary pericytes. J Lipid Res 55, 860–869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ghaneei A, Yassini S, Ghanei ME, Shojaoddiny-Ardekani A, 2015. Increased serum oxidized low-density lipoprotein levels in pregnancies complicated by gestational diabetes mellitus. Iran J Reprod Med 13, 421–424. [PMC free article] [PubMed] [Google Scholar]
  15. Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N, Lala PK, 1993. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 206, 204–211. [DOI] [PubMed] [Google Scholar]
  16. Gschwendt M, Muller HJ, Kielbassa K, Zang R, Kittstein W, Rincke G, Marks F, 1994. Rottlerin, a novel protein kinase inhibitor. Biochem Biophys Res Commun 199, 93–98. [DOI] [PubMed] [Google Scholar]
  17. Haller H, Hempel A, Homuth V, Mandelkow A, Busjahn A, Maasch C, Drab M, Lindschau C, Jüpner A, Vetter K, Dudenhausen J, Luft FC, 1998. Endothelial-cell permeability and protein kinase C in pre-eclampsia. Lancet 351, 945–949. [DOI] [PubMed] [Google Scholar]
  18. Han CS, Herrin MA, Pitruzzello MC, Mulla MJ, Werner EF, Pettker CM, Flannery CA, Abrahams VM, 2015. Glucose and metformin modulate human first trimester trophoblast function: a model and potential therapy for diabetes-associated uteroplacental insufficiency. Am J Reprod Immunol 73, 362–371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Henderson JT, Whitlock EP, O’Connor E, Senger CA, Thompson JH, Rowland MG, 2014. Low-dose aspirin for prevention of morbidity and mortality from preeclampsia: a systematic evidence review for the U.S. Preventive Services Task Force. Ann Intern Med 160, 695–703. [DOI] [PubMed] [Google Scholar]
  20. Holmes VA, Young IS, Patterson CC, Maresh MJ, Pearson DW, Walker JD, McCance DR, 2013. The role of angiogenic and antiangiogenic factors in the second trimester in the prediction of preeclampsia in pregnant women with type 1 diabetes. Diabetes Care 36, 3671–3677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jiang R, Teng Y, Huang Y, Gu J, Li M, 2010. Protein kinase C-alpha activation induces NF-kB-dependent VCAM-1 expression in cultured human umbilical vein endothelial cells treated with sera from preeclamptic patients. Gynecol Obstet Invest 69, 101–108. [DOI] [PubMed] [Google Scholar]
  22. Jiang R, Teng Y, Huang Y, Gu J, Ma L, Li M, Zhou Y, 2014a. Preeclampsia serum-induced collagen I expression and intracellular calcium levels in arterial smooth muscle cells are mediated by the PLC-γ1 pathway. Exp Mol Med 46, e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jiang X, Jones S, Andrew BY, Ganti A, Malysheva OV, Giallourou N, Brannon PM, Roberson MS, Caudill MA, 2014b. Choline inadequacy impairs trophoblast function and vascularization in cultured human placental trophoblasts. J Cell Physiol 229, 1016–1027. [DOI] [PubMed] [Google Scholar]
  24. Jirousek MR, Gillig JR, Gonzalez CM, Heath WF, McDonald JH 3rd, Neel DA, Rito CJ, Singh U, Stramm LE, Melikian-Badalian A, Baevsky M, Ballas LM, Hall SE, Winneroski LL, Faul MM, 1996. (S)-13-[(dimethylamino)methyl]-10,11,14,15-tetrahydro-4,9:16, 21-dimetheno-1H, 13H-dibenzo[e,k]pyrrolo[3,4-h][1,4,13]oxadiazacyclohexadecene-1,3(2H)-d ione (LY333531) and related analogues: isozyme selective inhibitors of protein kinase C beta. J Med Chem 39, 2664–2671. [DOI] [PubMed] [Google Scholar]
  25. Kim YJ, Park H, Lee HY, Ahn YM, Ha EH, Suh SH, Pang MG, 2007. Paraoxonase gene polymorphism, serum lipid, and oxidized low-density lipoprotein in preeclampsia. Eur J Obstet Gynecol Reprod Biol 133, 47–52. [DOI] [PubMed] [Google Scholar]
  26. Lee MC, Wei SC, Tsai-Wu JJ, Wu CH, Tsao PN, 2008. Novel PKC signaling is required for LPS-induced soluble Flt-1 expression in macrophages. J Leukoc Biol 84, 835–841. [DOI] [PubMed] [Google Scholar]
  27. Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF, Schisterman EF, Thadhani R, Sachs BP, Epstein FH, Sibai BM, Sukhatme VP, Karumanchi SA, 2004. Circulating angiogenic factors and the risk of preeclampsia. N Engl J Med 350, 672–683. [DOI] [PubMed] [Google Scholar]
  28. McKenna JP, Hanson PJ, 1993. Inhibition by Ro 31–8220 of acid secretory activity induced by carbachol indicates a stimulatory role for protein kinase C in the action of muscarinic agonists on isolated rat parietal cells. Biochemical Pharmacology 46, 583–588. [DOI] [PubMed] [Google Scholar]
  29. McLeese RH, Zhao J, Fu D, Yu JY, Brazil DP, Lyons TJ, 2021. Effects of modified lipoproteins on human trophoblast cells: a role in pre-eclampsia in pregnancies complicated by diabetes. BMJ Open Diabetes Res Care 9 (1), e001696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mitsui T, Tani K, Maki J, Eguchi T, Tamada S, Eto E, Hayata K, Masuyama H, 2018. Upregulation of angiogenic factors via protein kinase C and hypoxia-induced factor-1alpha pathways under high-glucose conditions in the placenta. Acta Med Okayama 72, 359–367. [DOI] [PubMed] [Google Scholar]
  31. Naljayan MV, Karumanchi SA, 2013. New developments in the pathogenesis of preeclampsia. Adv Chronic Kidney Dis 20, 265–270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nevo O, Soleymanlou N, Wu Y, Xu J, Kingdom J, Many A, Zamudio S, Caniggia I, 2006. Increased expression of sFlt-1 in in vivo and in vitro models of human placental hypoxia is mediated by HIF-1. Am J Physiol Regul Integr Comp Physiol 291, R1085–1093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Powers RW, Jeyabalan A, Clifton RG, Van Dorsten P, Hauth JC, Klebanoff MA, Lindheimer MD, Sibai B, Landon M, Miodovnik M, 2010. Soluble fms-like tyrosine kinase 1 (sFlt1), endoglin and placental growth factor (PlGF) in preeclampsia among high risk pregnancies. PLoS One 5, e13263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Raikwar NS, Liu KZ, Thomas CP, 2013. Protein kinase C regulates FLT1 abundance and stimulates its cleavage in vascular endothelial cells with the release of a soluble PlGF/VEGF antagonist. Exp Cell Res 319, 2578–2587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rana S, Schnettler WT, Powe C, Wenger J, Salahuddin S, Cerdeira AS, Verlohren S, Perschel FH, Arany Z, Lim KH, Thadhani R, Karumanchi SA, 2013. Clinical characterization and outcomes of preeclampsia with normal angiogenic profile. Hypertens Pregnancy 32, 189–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Roberts JM, Hubel CA, 2009. The two stage model of preeclampsia: variations on the theme. Placenta 30 Suppl A, S32–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Seely EW, Rich-Edwards J, Lui J, Nicklas JM, Saxena A, Tsigas E, Levkoff SE, 2013. Risk of future cardiovascular disease in women with prior preeclampsia: a focus group study. BMC Pregnancy Childbirth 13, 240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shen L, Glazer RI, 1998. Induction of apoptosis in glioblastoma cells by inhibition of protein kinase C and its association with the rapid accumulation of p53 and induction of the insulin-like growth factor-1-binding protein-3. Biochem Pharmacol 55, 1711–1719. [DOI] [PubMed] [Google Scholar]
  39. Shu C, Liu Z, Cui L, Wei C, Wang S, Tang JJ, Cui M, Lian G, Li W, Liu X, Xu H, Jiang J, Lee P, Zhang DY, He J, Ye F, 2014. Protein profiling of preeclampsia placental tissues. PLOS ONE 9, e112890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Soltoff SP, 2007. Rottlerin: an inappropriate and ineffective inhibitor of PKCdelta. Trends Pharmacol Sci 28, 453–458. [DOI] [PubMed] [Google Scholar]
  41. Thadhani R, Hagmann H, Schaarschmidt W, Roth B, Cingoez T, Karumanchi SA, Wenger J, Lucchesi KJ, Tamez H, Lindner T, Fridman A, Thome U, Kribs A, Danner M, Hamacher S, Mallmann P, Stepan H, Benzing T, 2016. Removal of soluble fms-like tyrosine kinase-1 by dextran sulfate apheresis in preeclampsia. J Am Soc Nephrol 27, 903–913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Thadhani R, Kisner T, Hagmann H, Bossung V, Noack S, Schaarschmidt W, Jank A, Kribs A, Cornely OA, Kreyssig C, Hemphill L, Rigby AC, Khedkar S, Lindner TH, Mallmann P, Stepan H, Karumanchi SA, Benzing T, 2011. Pilot study of extracorporeal removal of soluble fms-like tyrosine kinase 1 in preeclampsia. Circulation 124, 940–950. [DOI] [PubMed] [Google Scholar]
  43. Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, et al. , 1991. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J Biol Chem 266, 15771–15781. [PubMed] [Google Scholar]
  44. Uzun H, Benian A, Madazli R, Topcuoglu MA, Aydin S, Albayrak M, 2005. Circulating oxidized low-density lipoprotein and paraoxonase activity in preeclampsia. Gynecol Obstet Invest 60, 195–200. [DOI] [PubMed] [Google Scholar]
  45. Wice B, Menton D, Geuze H, Schwartz AL, 1990. Modulators of cyclic AMP metabolism induce syncytiotrophoblast formation in vitro. Exp Cell Res 186, 306–316. [DOI] [PubMed] [Google Scholar]
  46. Wilkinson SE, Parker PJ, Nixon JS, 1993. Isoenzyme specificity of bisindolylmaleimides, selective inhibitors of protein kinase C. Biochem J 294 (Pt 2), 335–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wu M, Chen Y, Wilson K, Chirindel A, Ihnat MA, Yu Y, Boulton ME, Szweda LI, Ma JX, Lyons TJ, 2008. Intraretinal leakage and oxidation of LDL in diabetic retinopathy. Invest Ophthalmol Vis Sci 49, 2679–2685. [DOI] [PubMed] [Google Scholar]
  48. Yu JY, Du M, Elliott MH, Wu M, Fu D, Yang S, Basu A, Gu X, Ma JX, Aston CE, Lyons TJ, 2016. Extravascular modified lipoproteins: a role in the propagation of diabetic retinopathy in a mouse model of type 1 diabetes. Diabetologia 59, 2026–2035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yu JY, Lyons TJ, 2013. Modified lipoproteins in diabetic retinopathy: a local action in the retina. J Clin Exp Ophthalmol 4(6), 314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yu Y, Jenkins AJ, Nankervis AJ, Hanssen KF, Scholz H, Henriksen T, Lorentzen B, Clausen T, Garg SK, Menard MK, Hammad SM, Scardo JC, Stanley JR, Dashti A, May K, Lu K, Aston CE, Wang JJ, Zhang SX, Ma JX, Lyons TJ, 2009. Anti-angiogenic factors and pre-eclampsia in type 1 diabetic women. Diabetologia 52, 160–168. [DOI] [PubMed] [Google Scholar]
  51. Zhang Y, Ye Y, Wang Y, Chen W, 2015. Inhibition of lectin-like oxidized low-density lipoprotein receptor 1 protects against plasma/hypoxia-mediated trophoblast dysfunction associated with preeclampsia. Gynecol Obstet Invest 79, 90–96. [DOI] [PubMed] [Google Scholar]
  52. Zhao H, Gong L, Wu S, Jing T, Xiao X, Cui Y, Xu H, Lu H, Tang Y, Zhang J, Zhou Q, Ma D, Li X, 2020. The inhibition of protein kinase C β contributes to the pathogenesis of preeclampsia by activating autophagy. EBioMedicine 56, 102813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhao J, Chow RP, McLeese RH, Hookham MB, Lyons TJ, Yu JY, 2021. Modelling preeclampsia: a comparative analysis of the common human trophoblast cell lines. FASEB Bioadv 3, 23–35. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS2037465-supplement-1.docx (3.1MB, docx)

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

RESOURCES