Procyanidin B1 Promotes PSMC3‐NRF2 Ubiquitination to Induce Ferroptosis in Glioblastoma

ABSTRACT

NRF2 signaling is a crucial antioxidant defense mechanism against ferroptosis in tumors, and targeting NRF2 is essential for tumor therapy. However, the effectiveness of NRF2 inhibitors remains unexplored. The active ingredients of traditional Chinese medicine serve as important sources of NRF2 inhibitors. In this study, we established an intracranial glioblastoma (GBM) orthotopic model and observed the effects of procyanidin B1 on tumor growth and ferroptosis. Using protein‐small‐molecule docking, z‐stack assay of laser confocal imaging, surface plasmon resonance assay, immunoprecipitation, mass spectrometry, and western blotting, we detected the binding between procyanidin B1 and NRF2 and the effect of PSMC3 on the ubiquitin‐dependent degradation of NRF2 in GBM cells. Our results showed that procyanidin B1 acted as a novel NRF2 inhibitor to suppress GBM cell proliferation and prolonged the survival of GBM‐bearing mice; it also mediated the interaction between PSMC3 and NRF2 to promote ubiquitin‐dependent protein degradation of NRF2, which induced ferroptosis in GBM cells. In addition, we found that procyanidin B1 enhanced H₂O₂ accumulation by downregulating NRF2 during ferroptosis in GBM cells. The botanical agent procyanidin B1 induced ferroptosis and exerted anti‐tumor effects through PSMC3‐mediated ubiquitin‐dependent degradation of NRF2 proteins, providing a potential drug candidate for adjuvant therapy in patients with GBM.

Schematic of the study illustrating the advantages of procyanidin B1 in penetrating the blood–brain barrier and its potential in inhibiting glioblastoma (GBM). Mechanistically, procyanidin B1 binds to NRF2 and inhibits its expression through a ubiquitin‐dependent protein catabolic process mediated by PSMC3. Additionally, procyanidin B1 reduces concentrations of NADPH and GSH and induces H₂O₂ overload to increase lipid peroxide levels via downregulation of NRF2. Procyanidin B1 also alters the expression of two key genes, COX2 and SLC7A11, associated with ferroptosis and promotes the key marker (TFR1, the transferrin receptor) of ferroptosis in GBM. BBB: blood–brain barrier; GSH: glutathione; NADPH: nicotinamide adenine dinucleotide phosphate; GBO: glioblastoma organoid; LOOH: lipid hydroperoxide. The Schematic was partly adapted from BioRender.com with permission.

1. Introduction

Gliomas account for approximately 75% of primary central nervous system tumors, of which more than 50% are glioblastomas (GBM) (Lapointe, Perry, and Butowski ²⁰¹⁸). Although significant advancements have been made in surgical technologies and postoperative chemoradiation strategies over the past two decades (Binder and O'Rourke ²⁰²²), patients with GBM rarely experience persistent alleviation due to incomplete surgical ablation, high tumor aggressiveness, elevated rates of recurrence, the hypoxic tumor microenvironment (TME), and chemoradioresistance. Although immunotherapy approaches have shown promise in generating positive therapeutic efficacy in tumors, clinical and preclinical trials of GBM immunotherapies, such as checkpoint inhibitors, tumor vaccines, oncolytic viruses, and chimeric antigen receptor T cells, have identified several obstacles to achieving sustained responses (Binder and O'Rourke ²⁰²²; Caccavano and McBain ²⁰²¹; Fan et al. ²⁰¹⁷; Nozhat et al. ²⁰²³; Wang et al. ²⁰²⁰). The median survival time of patients with GBM is only 14 months after standard treatment (Oliva et al. 2018). Therefore, the development of potential drugs for GBM treatment remains challenging.

The inducible transcription factor NRF2, which is encoded by NFE2L2, is a member of the human cap n′ collar basic‐region leucine zipper transcription factor family, and NRF2 vitality is mainly regulated via the redox sensor protein Kelch‐like ECH‐associated protein 1 (KEAP1), where KEAP1 promotes degradation of NRF2 through the ubiquitin‐proteasome pathway (Dinkova‐Kostova and Copple ²⁰²³). Pharmacological activators of NRF2 have demonstrated protective effects in various non‐neoplastic disease models and have shown benefits in human intervention trials, suggesting that NRF2 is a promising drug target (Cuadrado et al. 2019). Several small‐molecule NRF2 activators are currently undergoing clinical trials. Among these, dimethyl fumarate is used in clinical practice to treat remitting–relapsing multiple sclerosis and psoriasis (Dinkova‐Kostova and Copple ²⁰²³). NRF2 has emerged as a potential target for cancer treatment, prompting extensive efforts to develop therapeutic strategies aimed at inhibiting its pro‐oncogenic role. Preclinical studies have also shown that NRF2 signaling is an important antioxidant defense mechanism against ferroptosis in tumor cells (Sun et al. 2016). Scavenging of ROS is crucial for antioxidant defense in tumor cells, and H₂O₂ is an important component of ROS. H₂O₂ is formed by O₂ ⁻ through the action of SOD1 (Sayin, LeBoeuf, and Papagiannakopoulos ²⁰¹⁹). Excessive accumulation of H₂O₂ promotes the proliferation and invasion of tumor cells (Martinez‐Reyes and Chandel ²⁰²¹). In the presence of iron, H₂O₂ is converted to‐OH through the Fenton reaction, which is then transformed into LOOH in the presence of polyunsaturated fatty acids (Harris and DeNicola ²⁰²⁰). LOOH accumulates on cellular membranes during ferroptosis progression (Harris and DeNicola ²⁰²⁰; Jiang, Stockwell, and Conrad ²⁰²¹; Stockwell ²⁰²²). In GBM, NRF2 is regulated by the APOC1/KEAP1 (Zheng et al. 2022) and P62/SQSTM1 (Yuan et al. 2022) pathways to reduce ferroptosis, thereby providing a potential target for GBM therapy. The development of inhibitors targeting NRF2 to induce ferroptosis by inhibiting antioxidant defenses is therefore critical for GBM therapy.

Numerous studies have provided evidence that traditional Chinese medicine is an important resource for innovative drugs due to its changeable structure (Atanasov et al. 2021), and such resources may benefit tumor therapy. Previous research has demonstrated the potential of procyanidins as anti‐tumor agents (Nandakumar, Singh, and Katiyar ²⁰⁰⁸). The main component of procyanidins, procyanidin B1 directly binds to the Kv10.1 channel to inhibit hepatoma cell evolution (Na et al. 2020). Moreover, procyanidin B1 exerts an antioxidant defense role by reducing total ROS levels. For example, it interferes with lipopolysaccharide‐induced production of ROS to exert anti‐inflammatory effects (Terra et al. 2011) and decreases ROS levels to promote embryonic development (Gao, Jin, Hao, et al. ²⁰²¹; Gao, Yu, Li, et al. ²⁰²¹).

In this study, we demonstrated that procyanidin B1 was a natural inhibitor of NRF2 that suppressed GBM growth and induced ferroptosis in cells. The binding of procyanidin B1 to NRF2 promoted ubiquitin‐dependent protein degradation of NRF2 through the PSMC3‐NRF2 pathway. Reduced NRF2 expression promoted H₂O₂ accumulation and increased lipid peroxide levels during ferroptosis. As such, we believe that procyanidin B1 may be an important candidate drug for targeting NRF2 in GBM treatment.

2. Materials and Methods

2.1. Tissue Collection and GBM Organoid (GBO) Culture

All GBM samples and associated patient data were collected from the Department of Neurosurgery at Xiangya Hospital, Central South University (CSU). All participants provided written informed consent, and all experiments were approved by the Joint Ethics Committee of the CSU Health Authority. GBO culture has been previously described in detail (Jacob et al. 2020). We minced resected tumors into approximately 0.5–1 mm diameter pieces, transferred them to GBO culture medium in ultra‐low attachment six‐well culture plates, and placed them on an orbital shaker rotating at 120 rpm at 37°C, under 5% CO₂. Detailed information about the patients with GBM included in this analysis is provided in Table 1.

TABLE 1.

Patients with glioblastoma.

Sample	Disease (pathology)	Age (years)	Gender	Operation	Prognosis	MGMT status	IDH status
Sample 1	GBM	46	M	Total resection	Live	+	IDH1/IDH2 wt
Sample 2	GBM	67	M	Total resection	Live	−	IDH1/IDH2 wt
Sample 3	GBM	56	F	Total resection	Live	−	IDH1/IDH2 wt

Abbreviations: F = Female, M = Male.

2.2. Cells

The U251 and GL261 cell lines were procured from the cell banks of the Chinese Academy of Sciences (Shanghai, China), with passage numbers ranging between 10 and 20 (Liu et al. 2023). The bEnd.3 cell lines were provided by Dr. Yang Wang (Deng et al. 2023). These cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin, and streptomycin (100 μg/mL) under a 5% CO₂ atmosphere at 37°C.

2.3. Antibodies and Reagents

Antibodies used included anti‐NRF2 (Abcam; cat, ab31163; lot, GR3248767), anti‐NRF2 (Proteintech; cat, 16396‐1‐AP; lot, 2354154), anti‐KI‐67 (Abcam; cat, ab15580; lot, GR3362242), anti‐SLC7A11 (MedChemExpress; cat, YA006; lot, 267113), anti‐COX2 (Abcam; cat, ab179800; lot, GR222252), and anti‐TFR1 (Abcam; cat, ab214039; lot, GR3235217).

Reagents used included erastin (MedChemExpress, HY‐15763), ferrostatin‐1 (MedChemExpress, HY‐100579), procyanidin B1 (Meilunbio, MB7155‐1, HPLC ≥95%), temozolomide (TMZ; MedChemExpress, HY‐17364), Cell counting kit‐8 (CCK‐8; MedChemExpress, HY‐K0301), Lipofectamine 3000 transfection kit (Thermo, L3000001), calcein/ propidium iodide (PI) cell viability/cytotoxicity assay kit (Beyotime, C2015S), DMEM medium (Gibco, 11965092), FBS (Gibco, A5670701), penicillin and streptomycin (Solarbio, P1400), mRNA reverse transcription kit (Thermo Scientific, K16225), TRIzol reagent kit (Invitrogen, 15596018CN), Amplex Red kit (Beyotime, amplex red kit), Protein A/G Magnetic Beads (MedChemExpress, HY‐K0202), Opti‐MEM medium (Gibco, 31985070), lipid peroxide sensor (LPS; MKBIO, 217075‐36‐0), NADPH assay kit with WST‐8 (Beyotime, S0179), GSH assay kit (Beyotime, S0053), bicinchoninic acid kit (Thermo Fisher Scientific, 23222), Iron ion detection kit (Leagene, TC1015), D‐luciferin, sodium salt (Meilunbio, MB1837), radioimmunoprecipitation assay (RIPA) buffer (Solarbio, R0020), Proease inhibitor cocktail (Solarbio, A8260), and NRF2 protein (MedChemExpress, HY‐P72308).

2.4. In Vitro Blood–Brain Barrier (BBB) Model

An in vitro BBB model was constructed using six‐well transwell plates (Corning, Inc. Corning, NY, USA) using the bEnd.3 cell line. The cells were seeded in six‐well plates and continuously cultured to form monolayers. Once their transendothelial layer resistance exceeded 150 Ω cm², the bEnd.3 monolayers were ready for use in the BBB penetration rate experiments (Cheng et al. 2022; Clark and Davis ²⁰¹⁵).

2.5. CCK‐8 and Half‐Maximal Inhibitory Concentration (IC50) Assays

U251 cells were seeded in 96‐well plates at a density of 1000 cells per well and treated with TMZ and procyanidin B1 for 48 h. The cells were then incubated with 10 μL of CCK‐8 reagent for 1 h. Absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). IC50 values were calculated using the fitting equation of the standard curve for U251 cell viability at different concentrations.

2.6. Live/Dead Cell Staining

Cell death was assessed by labeling cells with calcein‐AM and PI. The cells were cultured in DMEM for 48 h and washed thrice with phosphate‐buffered saline (PBS). The cells were labeled with calcein‐AM and PI, and fluorescence was observed using a fluorescence microscope (Olympus Corp., 163‐0914, Japan). The PI‐positive cells were considered dead.

2.7. Animals and Intracranial Orthotopic Tumor Model

C57BL/6N mice of both sexes, aged 6–8 weeks and with an average weight of 24 g (Hunan Slake Jingda Company), were kept in the Department of Laboratory Animals at CSU under controlled conditions consisting of a 12 h light/dark cycle, a temperature of 20°C, and moderate humidity. The conditions of the experiments complied with international standards for the protection of animals used for scientific purposes and were approved by the Animal Care and Use Committee of Central South University. The mice were anaesthetized by intraperitoneal injection of 2,2,2‐tribromoethanol (20 mL/kg dissolved in 0.9% saline) (Xie et al. 2023). Subsequently, GL261‐luciferase cells (5 × 10⁴ in 4 μL of DMEM) were injected into the striatum in the brain, 1.0 mm anterior and 1.0 mm lateral from the bregma suture and 3.0 mm below the pial surface, using a small animal stereotactic frame and a 26 gauge Hamilton syringe (Hamilton, Reno, NV, USA). After 10 days, bioluminescence radiance was used to assess tumor size. Mice were randomly assigned to the control or treatment groups to ensure experimental robustness. We used the gavage method, an oral administration route (Miguelena Chamorro et al. 2023), to treat GBM‐bearing mice. GL261‐luciferase cells were implanted into the striata of mice for 10 days by gavage at 15 mg/kg daily for 44 days.

2.8. In Vivo Imaging System (IVIS)

A total of 15 mg/mL of D‐luciferin (sodium salt) was injected intraperitoneally following mouse anaesthetization. Fifteen minutes after the injection, the mice were placed in a live imaging system utilizing excitation light sources to excite the emitted fluorescence and capture and record the emitted light signals within the mouse. Image processing and analysis were performed to quantitatively or qualitatively assess the distribution and intensity of fluorescein sodium within the mice.

2.9. Reverse Transcription‐Quantitative Polymerase Chain Reaction (RT‐qPCR)

Total mRNA was extracted from cells using the TRIzol reagent, with mRNA concentration and purity determined using a Nanodrop2000 microultraviolet spectrophotometer. Total mRNA was reverse‐transcribed into cDNA using a reverse transcription kit, and qPCR was performed using a real‐time fluorescence quantitative instrument (Bio‐Rad, Hercules, CA, USA; 788BR06968). GAPDH was used for standardization. Three independent experiments were performed, and the 2^−∆∆Ct (∆∆Ct = ∆Ct [case] – ∆Ct [control]) method was used to calculate relative mRNA expression levels. Primer sequences used for RT‐qPCR were as follows:

SOD1 Forward: 5′GGTGGGCCAAAGGATGAAGAG 3′;

SOD1 Reverse: 5′CCACAAGCCAAACGACTTCC 3′;

SOD2 Forward: 5′GGAAGCCATCAAACGTGACTT 3′;

SOD2 Reverse: 5′CCCGTTCCTTATTGAAACCAAGC 3′;

NRF2 Forward: 5′TCAGCGACGGAAAGAGTATGA 3′;

NRF2 Reverse: 5′CCACTGGTTTCTGACTGGATGT 3′;

PSMC3 Forward: 5′CCTCTACACGACAGACGTACT 3′;

PSMC3 Reverse: 5′CCTTCACCCGCGAGTCATA 3′;

GAPDH Forward: 5′GGAGCGAGATCCCTCCAAAAT 3′;

GAPDH Reverse: 5′GGCTGTTGTCATACTTCTCATGG 3′.

2.10. Small Interfering RNA (siRNA) Experiment

Transfected U251 cells were at 70%–90% confluency. Lipofectamine 3000 reagent was diluted in Opti‐MEM (2 tubes) and mixed thoroughly, and siRNA was diluted in Opti‐MEM. A DNA premix was prepared and mixed thoroughly. Diluted siRNA (1:1 ratio) was then added to a test tube containing pre‐diluted Lipofectamine 3000, with the mixture allowed to incubate at room temperature for 5 min. siRNA‐lipid complexes were added to the cells, following which cells were incubated at 37°C for 2–4 days. Transfection efficiency was subsequently determined. After verification of silencing of target gene expression by qPCR, subsequent experiments were performed.

2.11. Protein–Small‐Molecule Docking Assay

Autodock Vina 1.2.2, an in silico protein–ligand docking software (http://autodock.scripps.edu), was employed to analyze the binding affinities and modes of interaction between the drug candidates and their targets (Morris, Huey, and Olson ²⁰⁰⁸). The molecular structure of procyanidin B1 was sourced from PubChem (https://pubchem.ncbi.nlm.nih.gov/) (Wang et al. 2017), and 3D coordinates of NRF2 were downloaded from the Protein Data Bank PDB (http://www.rcsb.org/pdb/home/home.do). For the docking analysis, all protein and molecular files were converted into PDBQT format, excluding all water molecules, and polar hydrogen atoms were added. The grid box was centered to cover the domains of each protein and accommodate free molecular movement. The grid box was set to 30 Å × 30 Å × 30 Å, and the grid‐point distance was 0.05 nm.

2.12. Z‐Stack Imaging in Confocal Microscopy

The prepared cell culture sections were observed under a laser scanning confocal microscope (CLSM, Carl Zeiss LSM900, Germany). After setting parameters (laser power, wavelength, and detector gain), the coordinates and depth of the imaging area were established using the microscope software. Subsequently, images were captured at each z plane to obtain 3D structural information and to ensure that the image quality and focus were optimal for each z plane to facilitate accurate 3D reconstructions.

2.13. Surface Plasmon Resonance (SPR) Assays

A CM5 sensor chip on a Biacore T200 SPR instrument (Cytiva, Sweden) was used for protein immobilization and analysis of small‐molecule‐protein interactions. The NRF2 protein was diluted to 10 μg/mL using 10 mM sodium acetate at varying pH values, with pH 4.0 providing the strongest signal. Protein immobilization was performed at a concentration of 30–50 μg/mL at pH 4.0, with a flow rate of 10 μL/min and a temperature of 25°C. Immobilization was achieved using 100 μL NHS, 100 μL EDC, and 150 μL ethanolamine to activate the chip surface. The same solution was used for the reference channel closure. Procyanidin B1 was injected at a contact time of 120 s and dissociation time of 180 s and regenerated using a glycine solution (2.5) for 30 s. Binding characteristics were evaluated using a concentration gradient range of 15.63–0.24 μM. Finally, the binding rate (K _a ) and dissociation rate (K _d ) of the small‐molecule catechin B1 with the protein were calculated using the formula K _D(M) = K _d (1/s)/K _a (1/Ms) based on the binding signal.

2.14. Hematoxylin and Eosin (HE), Immunofluorescence (IF), and Immunohistochemical (IHC) Staining

HE, IF, and IHC staining protocols have been described in detail previously (Feng et al. 2020; Yu et al. ²⁰¹⁷). Imaging was conducted using an Olympus Corp. microscope (Japan, model 163‐0914).

2.15. H₂O₂ Measurements

H₂O₂ levels were measured using an Amplex Red kit. The OxiRed Probe was diluted to 10 μM with PBS, and 1 mL of the OxiRed Probe working solution was added to each well. Cells were incubated at 37°C in the dark for 30 min, then washed thrice with PBS to completely remove any OxiRed Probe that was not absorbed by the cells. H₂O₂ levels in the cells were observed under a fluorescence microscope (Olympus Corp., 163‐0914, Japan), and images were captured.

2.16. Detection of Intracellular LOOH Levels

An LPS was used to measure LOOH levels. The LPS was diluted to 50 mM in serum‐free medium, and cells were incubated with 50 mM LPS at 37°C in the dark for 1 h. Cells were then washed thrice with serum‐free medium and photographed under a fluorescence microscope (Olympus Corp., 163‐0914, Japan).

2.17. NADPH and Glutathione (GSH) Assays

U251 cells were seeded in six‐well plates and cultured for 48 h. The cells were gently collected and permeabilized using 0.5% Triton X‐100, following which cell lysates were centrifuged, and NADPH and GSH levels were determined using appropriate measurement kits. NADPH and GSH levels were measured at absorbances of 450 and 412 nm, respectively, using a spectrophotometer (Thermo Fisher Scientific OyRatastie 2, F1‐01620 Vantaa, Finland). Absorbance values were substituted into the standard curve‐fitting equation to calculate the concentration of each sample.

2.18. Iron Ion Detection

Cells were cultured for 48 h, and proteins were extracted. Protein concentration was determined using the bicinchoninic acid method, while iron levels in the samples were determined using an iron ion detection kit. The reagents were added in accordance with the manufacturer's instructions, following which samples were mixed gently at 37°C for 10 min. Absorbance was measured at 562 nm using a spectrophotometer. Finally, plasma and serum Fe (mM/L) levels were measured as follows: [Fe] = [A sample−(A serum blank × 0.970)]/A standard × 35.8.

2.19. Western Blot

U251 cells were lysed in RIPA buffer containing a complete protease inhibitor cocktail. Samples of lysed proteins and immunoprecipitated proteins were separated using sodium dodecyl sulfate (SDS)‐polyacrylamide gel electrophoresis, then transferred onto polyvinylidene difluoride membranes. Nonspecific binding sites on the membrane were blocked with 5% skim milk resolved in TBST (Tris‐buffered saline and Tween‐20). Incubation overnight at 4°C with primary antibodies against NRF2, PSMC3, GAPDH, ubiquitin, TFR1, COX2, and SLC7A11 allowed selective binding to the target protein. Membranes were then incubated with secondary antibodies after washing with TBST for 2 h at room temperature. Protein gel images were visualized using a chemiluminescence imaging system and captured with ImageLab software (Bio‐Rad, California, USA).

2.20. Immunoprecipitation (IP)

Protein collection methods were described in Section 2.18. After incubating cell homogenates with the anti‐NRF2 antibody overnight at 4°C, the antigen–antibody complex was immunoprecipitated using A/G agarose beads for 1 h at room temperature. Beads were then washed with lysis buffer and eluted with SDS loading buffer by boiling for 5 min at 100°C. Finally, the proteins of interest in the supernatant were analyzed using liquid chromatography–mass spectrometry (LC–MS) and western blotting.

2.21. LC–MS and Modification Analysis

Protein samples were digested in solution following the procedure described by Wisniewski et al. (2009). Peptide fractions were reconstituted in ddH₂O containing 0.1% formic acid and injected into a NanoViper C18 trap column. Separation was performed online using an UltiMate 3000 RSLC nanosystem. Tandem MS data were acquired using a Thermo Fisher Q Exactive Plus instrument. Key acquisition parameters included an elution gradient of 5%–38% solvent B over 60 min, charge states 2 to 5 for fragmentation and dynamic exclusion for 25 s during data acquisition. The MS/MS data were analyzed using a Thermo Proteome Discoverer for protein identification and quantification. A search against the Homo sapiens database allowed for a 1.0% local false discovery rate at the peptide level, with up to two missed cleavages. Key modifications included acetyl (Protein N‐term), deamidated (NQ), oxidation (M), acetyl/+42.011 Da (K), methyl/+14.016 Da (K, R), phospho/+79.966 Da (S, T, Y), and ubiquitin (GG)/+114.043 Da (K) as variable modifications and carbamidomethylation of cysteine as a fixed modification. The precursor and fragment mass tolerances were set at 10 ppm and 0.05 Da, respectively.

2.22. Statistical Analysis

Data were derived from the mean of at least three independent experiments and analyzed using SPSS Statistics 19 (IBM, Armonk, NY, USA). Student's t‐test was used to evaluate differences between two groups; one‐way analysis of variance was used to detect differences between multiple groups; and the Kaplan–Meier method was used to determine the survival curves of the intracranial GBM orthotopic model mice. Quantitative analysis of RT‐qPCR and western blot images from the control groups was standardized to 1.0, which improved data comparability and enhanced the reliability of the results. All data were presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

3. Results

3.1. Procyanidin B1 Is a Potential Inhibitor of NRF2 in GBM

To prompt the development of a candidate drug that inhibits NRF2 for GBM therapy, we first searched for traditional Chinese medicines targeting NRF2 from SymMap (Wu et al. 2019) and found that suoluozi (buckeye seed) had a high possibility of NRF2 targeting (Figure 1A) and was one of the main sources of procyanidin B1. Therefore, we focused on procyanidin B1, an effective anti‐tumor component of suoluozi. First, 0.1% dimethyl sulfoxide (DMSO), the vehicle for procyanidin B1, had no effect on the cell proliferation and the expression level of NRF2 in U251 cells (Figure S1A–C). Considering that TMZ is used as a canonical chemotherapeutic drug after surgery in patients with GBM, we selected TMZ as a positive control. Using an in vitro BBB model, we tested the BBB penetration rate of procyanidin B1 and found that it reached 43.57%; however, the BBB penetration rate of TMZ was 38.22% (Figure 1B), a result that was consistent with previous findings (Feng et al. 2020). Subsequently, we detected the effects of procyanidin B1 and TMZ on GBM cells and obtained the IC50 of procyanidin B1 and TMZ on U251 and GL261 cells, respectively. Moreover, the IC50 value of procyanidin B1 for non‐tumor cells (bEnd.3 cells) was considerably lower than that for GBM cells (Figure 1C,D). Using a live/dead cell double‐staining kit with calcein‐AM/PI to measure cell viability, we determined that procyanidin B1 (394 μM) increased the dead cell rate of GBM cells only when at the same concentration as the IC50 value (394 μM) (Figure S1D–F).

FIGURE 1.

Efficacy of procyanidin B1 on glioblastoma (GBM). (A) Traditional Chinese medicines targeting NRF2 were obtained from the SymMap database. Line thickness represents the possibility value of targeting p value <0.05. (B) Blood–brain barrier (BBB) permeability of temozolomide (TMZ) and procyanidin B1 was determined using an in vitro BBB model. (C and D) Quantification of half maximal inhibitory concentration (IC50) in the U251, GL‐261, and bEnd.3 cells with procyanidin B1 and TMZ treatment. (E) Quantitative analysis of NRF2 mRNA levels in U251 cells with procyanidin B1 or vehicle treatment. (F) Representative western blotting and quantitative analysis of NRF2 protein levels in U251 cells with procyanidin B1 or vehicle. (G) Schematic illustration of procyanidin B1 therapeutic schedule in an orthotopic GBM model. (H) Bioluminescence images in GBM‐bearing mice model using an IVIS (n = 6 mice/group). (I) Survival curve of tumor‐bearing mice with procyanidin B1 or PBS treatment (n = 6 mice/group). (J) Quantification of bioluminescence images in the GBM‐bearing mice treated with procyanidin B1 at day 0 and day 44. (K) HE staining in the brain of GBM‐bearing mice (n = 3 samples/group). Scale bar = 0.50 cm. (L and M) Representative immunostaining and quantitative analysis of KI67⁺ cells in GBM‐bearing mice treated with PBS or procyanidin B1 (n = 3 samples/group). Left scale bar = 0.20 cm. Right scale bar = 50 μm. Data are presented as the mean ± SEM. All experiments were conducted at least in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

Expression of NRF2 in U251 cells was detected after treatment with procyanidin B1 at a concentration of 394 μM. IF, RT‐qPCR and western blotting analyses revealed significantly reduced NRF2 expression following procyanidin B1 treatment (Figures 1E,F and S1G), indicating that procyanidin B1 is a potential botanical agent for GBM treatment that inhibits NRF2. These results suggest that procyanidin B1 improved BBB permeability and inhibited the production of GBM cells.

To investigate the therapeutic potential of procyanidin B1 against GBM in live animals, we established an orthotopic xenograft model by injecting GL261‐Luc‐GFP cells into the corpus striata of C57BL/6N mice (Figure 1G,H). After 10 days, we observed tumor formation and measured tumor size using an IVIS. Mice were randomly divided into two groups, consisting of a control group (n = 6) and a procyanidin B1 group (n = 6) that received daily oral administration of normal saline or normal saline with procyanidin B1 at a dose of 15 mg/kg for 44 days (Figure 1G). Mice in the control group died naturally beginning on day 30 after administration, with all having succumbed by day 44. In the procyanidin B1 group, however, 50% of mice survived until day 54 (Figure 1H). Survival analysis revealed that the procyanidin B1 group had a significantly higher survival rate than that of the control group (p < 0.05) (Figure 1I). Compared to that at day 0, IVIS detection showed a significant reduction in tumor size on day 44 in the procyanidin B1 group (p < 0.01) (Figure 1J). Three mice from the procyanidin B1 group were euthanized on day 54; histological staining with HE (Figure 1K) demonstrated that they had markedly smaller tumors, while immunostaining revealed reduced expression levels of the proliferating antigen KI‐67 (Figure 1L,M) compared with those in the control group, in which all mice died between days 30–44. These findings indicated that procyanidin B1 inhibited GBM growth in vivo.

3.2. Procyanidin B1 Binds to NRF2 and Downregulates NRF2 by Ubiquitin‐Dependent Protein Catabolic via PSMC3 in GBM Cells

We evaluated the affinity of procyanidin B1 for NRF2 using a molecular docking analysis, the results of which showed that procyanidin B1 binds to NRF2 through hydrophobic interactions, hydrogen bonds, and π‐cation interactions. Procyanidin B1 had a low binding energy of −7.677 kcal/mol (Figure 2A), indicating highly stable binding. To verify whether procyanidin B1 binds to NRF2, we constructed plasmids expressing NRF2 labeled with EGFP (pCDNA3‐EGFP‐C4‐NRF2), and the NRF2 labeled EGFP was introduced in U251 cells through liposome transfection. The cells were subsequently treated with procyanidin B1 linked with CY5 at the hydroxyl end (Figure S2A). We performed z‐stack confocal imaging to detect colocalization at the spatial level. The z‐stack imaging results showed that procyanidin B1 colocalized with NRF2 protein at the 3D and 2D levels (XZ, ZY, and XY axes) (Figure 2B,C). Notably, despite the presence of NRF2 in both the nucleus and cytoplasm of U251 cells, procyanidin B1 mainly colocalized with NRF2 in the cytoplasm. To test the affinity of procyanidin B1 for NRF2 at the molecular level, we conducted SPR assays. We calculated the binding rate (K _a ) and dissociation rate (K _d ) and normalized the affinity (K _D ) of NRF2 and proanthocyanidin B1 at different concentrations, with the results suggesting the presence of a strong affinity (1.9 μM) between procyanidin B1 and NRF2, as well as a concentration dependence (Figure 2D). Taken together, these findings indicated that procyanidin B1 binds directly to NRF2 in U251 cells.

FIGURE 2.

Procyanidin B1 binds to NRF2 in U251 cells. (A) Molecular docking analysis shows the binding configurations and interactions of procyanidin B1 with NRF2 (binding energy = −7.677 kcal/mol). (B) 3D tomography with z‐stack imaging (0° rotation) in confocal microscopy after treating with procyanidin B1 (linked with CY5) for 48 h at 394 μM in U251 cells with transfected pCDNA3‐EGFP‐C4‐NRF2 plasmid (scale bar = 25 μm). (C) Images depicting maximum intensity projection in 2D‐XY (scale bar = 25 μm). (D) Kinetics fit curve of the affinity between procyanidin B1 and NRF2 protein by surface plasmon resonance (SPR). All experiments were conducted at least in triplicate.

To explore the mechanism by which procyanidin B1 downregulates NRF2 expression, we collected U251 cells from mice in both the control and procyanidin B1 treated groups and lysed them under nondenaturing conditions. Diluted cell lysates were subjected to IP using anti‐NRF2 antibodies followed by LC–MS (Figure S2B). We identified 753 proteins in control mouse cells and 624 proteins in procyanidin B1‐treated mouse cells (Figure 3A). We further analyzed protein modifications of NRF2 and observed acetylation, ubiquitination, phosphorylation, and methylation in the control group. Studies have shown that ubiquitination, acetylation, methylation, and phosphorylation of proteins affect their stability and activity (Polevoda and Sherman 2007; Shoba et al. ²⁰²²; Wu et al. ²⁰²³). MS results showed that the changes in NRF2 protein modifications following procyanidin B1 treatment included an increase in acetylation sites from one to two, an increase in methylation sites from one to three, a decrease in phosphorylation sites from one to zero, and an increase in ubiquitination sites from 1 to 5 (Figure 3B). Furthermore, Gene Ontology analysis indicated that ubiquitination‐mediated degradation was the enriched signaling pathway for proteins specifically expressed following procyanidin B1 treatment (Figures 3C and S2C). Therefore, we focused on the ubiquitination of NRF2.

FIGURE 3.

NRF2 expression is downregulated by procyanidin B1 through ubiquitin‐dependent protein degradation via PSMC3 in U251 cells. (A) Venn diagram illustrating interactions between proteins and NRF2 as detected by IP and LC–MS analysis in U251 cells treated as indicated. (B) LC–MS analysis showing NRF2 protein modification sites. (C) Gene ontology analysis depicting the enrichment of BP pathways using the specific proteins associated with procyanidin B1 treatment. (D) STRING analysis showing proteins interacting with NRF2 and proteins associated with ubiquitin‐dependent protein degradation. (E) U251 cells were treated with procyanidin B1 or vehicle, followed by IP using an anti‐NRF2 antibody and probed with an anti‐PSMC3 antibody. (F) Scatterplots of correlations between PSMC3 expression and NRF2 expression in glioblastoma (GBM) sample of The Cancer Genome Atlas data (Agilent‐4502A) (R = −0.24, p = 0). (G) Quantitative analysis of PSMC3 mRNA levels in U251 cells treated as indicated. (H) Representative western blotting and quantitative analysis of NRF2 protein levels in U251 cells treated as indicated. (I) U251 cells were treated as indicated, then treated further with 10 μM of MG132 for 6 h. NRF2 was immunoprecipitated using an anti‐NRF2 antibody and probed with an anti‐ubiquitin (UB) antibody; siPSMC3 represents PSMC3 knockdown in U251 cells. BP, biological process; GO, Gene Ontology; IP, immunoprecipitation; LC–MS, liquid chromatography–mass spectrometry; STRING, Search Tool for the Retrieval of Interacting Genes/proteins; WB, western blot. Data are presented as the mean ± SEM. All experiments were conducted at least in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

STRING software analysis revealed an interaction between NRF2 and proteins involved in the “proteasome‐mediated ubiquitin‐dependent protein catabolic process”, indicating a potential interaction involving NRF2 with PSMA5, PSMC3, and PSMD4 (Figure 3D). The diluted cell lysates were subjected to IP using normal IgG or anti‐NRF2 antibodies, followed by immunoblotting with antibodies against PSMA5, PSMC3, and PSMD4. PSMC3 was uniquely expressed in the procyanidin B1 group (Figures 3E and S2D), and PSMC3 is a subunit of the proteasome which mediates the ubiquitin‐dependent protein catabolic process. We analyzed the correlation between PSMC3 and NRF2 in patients with GBM from The Cancer Genome Atlas database and found a significant negative correlation between NRF2 and PSMC3 expression (Figure 3F). To determine whether procyanidin B1 promotes the ubiquitination of NRF2 via its interaction with PSMC3, we performed RT‐qPCR, western blotting, and IP in U251 cells with procyanidin B1 and PSMC3 knockdown. PSMC3 knockdown rescued NRF2 expression induced by procyanidin B1 (Figure 3G,H), indicating that PSMC3 promotes degradation of NRF2 during procyanidin B1 treatment. Results of experiments to ascertain whether degradation of NRF2 was due to ubiquitination suggested that procyanidin B1 treatment significantly promotes NRF2 ubiquitination and that PSMC3 rescues ubiquitylation of NRF2 (Figure 3I).

3.3. Procyanidin B1 Induces Ferroptosis via NRF2 Downregulation in GBM Cells

The iron ion assay showed that procyanidin B1 treatment increased divalent iron ion levels in U251 cells, which was consistent with the effects of the classical ferroptosis inducer erastin. TFR1 expression was upregulated in U251 cells after treatment with procyanidin B1. Procyanidin B1 also downregulated the expression of the ferroptosis suppressor SLC7A11 and upregulated the expression of the ferroptosis driver COX2 in U251 cells. The lipid peroxidation rate was upregulated in U251 cells following procyanidin B1 treatment. In addition, the ferroptosis inhibitor ferrostatin‐1 rescued procyanidin‐B1‐induced ferroptosis in U251 cells (Figures 4A–E and S3A). To determine whether NRF2 acts as a regulator of procyanidin B1‐induced ferroptosis in U251 cells, we performed an siRNA‐mediated knockdown of NRF2. The results showed that iron ion levels, TFR1 expression, SLC7A11 expression, COX2 expression, and lipid peroxidation were consistent with those in U251 cells treated with procyanidin B1 (Figures 4F–K and S3B).

FIGURE 4.

Downregulation of NRF2 by procyanidin B1 promotes ferroptosis in U251 cells. (A) Fe²⁺ levels in U251 cells with the treatment indicated as determined by iron ion detection. (B) Representative western blotting and quantitative analysis of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells with the treatment indicated. (C and D) Immunostaining quantification of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells with the treatment indicated. (E) Representative images and quantitative analysis of LOOH levels in U251 cells with the treatment indicated. (F) Fe²⁺ levels in U251 cells with procyanidin B1 treatment and NRF2 overexpression as determined by iron ion detection. (G) Representative western blotting and quantitative analysis of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells after procyanidin B1 treatment and NRF2 overexpression. (H and I) Immunostaining quantification of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells with procyanidin B1 treatment and NRF2 overexpression. (J and K) Representative images and quantitative analysis of LOOH levels in U251 cells with procyanidin B1 treatment and NRF2 overexpression. (L) Iron ion detection showed the Fe2⁺ levels with procyanidin B1 treatment and NRF2 knockdown in U251 cells. (M) Representative western blotting and quantitative analysis of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells with procyanidin B1 treatment and NRF2 knockdown. (N and O) Immunostaining quantification of TFR1, SLC7A11, and COX‐2 protein levels in U251 cells after procyanidin B1 treatment and NRF2 knockdown. (P) Representative images and quantitative analysis of LOOH levels in U251 cells after procyanidin B1 treatment and NRF2 knockdown. OE‐NRF2 represents NRF2 overexpression achieved by transfection with the pCMV‐NRF2‐3×Myc‐Neo plasmid. siNRF2 represents NRF2 knockdown achieved by siRNA transfection. Scale bar = 25 μm. IF, immunofluorescence; LOOH, lipid hydroperoxide; WB, Western blotting. Data are presented as the mean ± SEM. All experiments were conducted in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

In addition, U251 cells transfected with an overexpression plasmid (pCMV‐NRF2‐3×Myc‐Neo) after treatment with procyanidin B1 exhibited lower rates of lipid peroxidase production and iron ion, COX2, and TFR1 expression. They also showed higher SLC7A11 expression compared with their levels in U251 cells treated with procyanidin B1 (Figures 4L–P and S3C). Overall, the evidence strongly indicates that procyanidin B1 induces ferroptosis by downregulating the expression of NRF2 in U251 cells.

3.4. Procyanidin B1 Promotes H₂O₂ Accumulation via NRF2 During Ferroptosis in GBM Cells

The molecular mechanism of ferroptosis relies on the balance between oxidative damage and antioxidant defense (Kuang et al. 2020). H₂O₂ overload promotes oxidative damage during ferroptosis. We found that treatment with procyanidin B1 increased H₂O₂ levels in U251 cells, consistent with the effect of erastin, a ferroptosis inducer. Elevated H₂O₂ levels induced by procyanidin B1 were reversed by ferrostatin‐1, a ferroptosis inhibitor, indicating that procyanidin B1 promotes H₂O₂ accumulation during ferroptosis in U251 cells (Figure 5A and S3D). Procyanidin B1 treatment did not increase the expression of SOD1 and SOD2 (Figure 5B) but enhanced GSH and NADPH levels in U251 cells (Figure 5C), suggesting that procyanidin B1 does not increase H₂O₂ production but promotes scavenging of H₂O₂. To determine the role of NRF2 in regulating the scavenging of H₂O₂ by induced procyanidin B1 in U251 cells, we first overexpressed or knocked down NRF2 in U251 cells and then measured H₂O₂, GSH, and NADPH levels with or without procyanidin B1 treatment. The results showed that NRF2 knockdown increased H₂O₂, GSH, and NADPH levels, which was consistent with the results of procyanidin B1 treatment in U251 cells. Overexpression of NRF2 rescued the higher levels of H₂O₂ and lower GSH and NADPH levels induced by procyanidin B1. These results suggest that procyanidin B1 leads to dysfunctional scavenging of H₂O₂ through downregulation of NRF2 (Figure 5D–H and S3E, F).

FIGURE 5.

Procyanidin B1 promotes the accumulation of H₂O₂ via NRF2 downregulation in U251 cells during ferroptosis. (A) Quantitative analysis of H₂O₂ levels in U251 cells with the treatment indicated. (B) Quantitative analysis of SOD1 and SOD2 mRNA levels in U251 cells treated with procyanidin B1 or vehicle. (C) Quantitative analysis of GSH and NADPH levels in U251 cells treated with procyanidin B1 or vehicle. (D) Quantitative analysis of H₂O₂ levels in U251 cells with procyanidin B1 treatment and NRF2 overexpression. (E) Quantitative analysis of GSH and NADPH levels in U251 cells after procyanidin B1 treatment and NRF2 overexpression. (F) Quantitative analysis of H₂O₂ levels in U251 cells after procyanidin B1 treatment and NRF2 knockdown. (G and H) Quantitative analysis of GSH and NADPH levels in U251 cells after procyanidin B1 treatment and NRF2 knockdown. OE‐NRF2 represents NRF2 overexpression achieved by transfection with the pCMV‐NRF2‐3×Myc‐Neo plasmid. siNRF2 represents NRF2 knockdown achieved by siRNA transfection. GSH, glutathione; NADPH, nicotinamide adenine dinucleotide phosphate. Data are presented as the mean ± SEM. All experiments were conducted in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

3.5. Procyanidin B1 Induces Ferroptosis via Downregulating NRF2 Expression in Patient‐Derived GBO and Intracranial GBM Orthotopic Mouse Models

The patient‐derived GBO model is a high‐fidelity model that provides insights into the biology of the complex tumor‐TME multicellular network and allows for more efficacious integration of novel drug therapies into clinical practice (Binder and O'Rourke ²⁰²²; Jacob et al. ²⁰²⁰). We established a GBO biobank using tumor tissues from patients with GBM (Figure 6A). To ensure that procyanidin B1 or PBS could penetrate the center of the GBOs, we added PBS or 394 μM procyanidin B1 to the GBO medium and injected 5 μL of PBS or 394 μM procyanidin B1 into the center of the GBOs using a microinjection technique (Figure 6B). Pathological sections were processed after treatment for 48 h, and the histological features of each GBO were characterized by pathologists (Figure 6C). IF staining revealed a significant reduction in NRF2 and KI‐67 expression following procyanidin B1 treatment (Figure 6D,E), suggesting that procyanidin B1 inhibits NRF2 expression and cell proliferation in GBOs. Moreover, IF and IHC staining indicated that procyanidin B1 downregulated SLC7A11 and increased COX2 and TFR1 expression (Figure 6F,G). Consistent results were obtained for the expression of TFR1, SLC7A11, and COX2 in intracranial GBM orthotopic mouse models using IF and IHC staining (Figure S1H–J). These results provide strong evidence that procyanidin B1 induces ferroptosis in GBO and GBM‐bearing mice by inhibiting NRF2 expression.

FIGURE 6.

Procyanidin B1 inhibits tumor growth and induces ferroptosis by downregulating NRF2 in glioblastoma organoids (GBO). (A) Schematic diagram illustrating the GBO biobank, and GBOs thawed from the biobank and cultured for 3 days. (B) Schematic diagram illustrating GBOs treated with procyanidin B1 or PBS. (C) Representative HE staining images of GBOs treated with procyanidin B1 or PBS (scale bar = 200 μm). (D and E) Representative immunostaining and quantitative analysis of NRF2⁺ and KI‐67⁺ cells in GBOs treated with PBS or procyanidin B1 (scale bar = 50 μm). (F) Representative immunostaining and quantitative analysis of TFR1 signal intensity in GBOs treated with PBS or procyanidin B1 (scale bar = 25 μm). (G) Representative immunohistochemistry staining and quantitative analysis of SLC7A1⁺ and COX‐2⁺ cells in GBOs treated with PBS or procyanidin B1 (scale bar = 200 μm). Data are presented as the mean ± SEM. All experiments were conducted in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001, ns: p ≥ 0.05.

4. Discussion

Here, we demonstrate for the first time that procyanidin B1 is a novel NRF2 inhibitor that promotes the ubiquitin‐dependent protein catabolism of NRF2 through the interaction between NRF2 and PSMC3, which induces ferroptosis in glioblastoma.

In contrast to the multitude of agents that function as NRF2 activators, few NRF2 inhibitors have been demonstrated. The development of NRF2 inhibitors has been hampered by the fact that the mechanism of NRF2 inhibition is unclear or nonspecific (Pouremamali et al. 2022). Reported NRF2 inhibitors include brusatol (BRU), luteolin (3′,4′,5,7‐tetrahydroxyflavone [LUT]), trigonelline (TRG), ascorbic acid (vitamin C, L‐ascorbic acid, AscA [AA]), retinoic acid (RA), and chrysin (5,7‐dihydroxy‐2‐phenyl‐4H‐chromen‐4‐one [CHR]). TRG, BRU, LUT, and CHR have been shown to inhibit NRF2, but their specificity and precise mechanisms remain poorly understood (Chian et al. 2014; Gao et al. ²⁰¹³; Olayanju et al. ²⁰¹⁵; Shin et al. ²⁰¹⁸). AA and RA are also known to impede NRF2 expression by affecting its transcription (Zhu et al. 2016), but the results of several studies suggest that they may be NRF2 activators. We found that procyanidin B1 directly binds to the NRF2 protein and further promotes NRF2‐PSMC3 interaction, resulting in the ubiquitin‐mediated degradation of NRF2. These results highlight the advantages of using procyanidin B1 to inhibit NRF2 production. PSMC3, a subunit of the 26S proteasome, plays a crucial role in protein homeostasis via the ubiquitination machinery, thereby regulating various cellular processes (Collins and Goldberg 2017; Pickart ²⁰⁰⁴). PSMC3 is involved in NRF2 ubiquitination degradation under procyanidin B1 treatment conditions. Our findings revealed a novel function involved in NRF2 degradation. Moreover, we also found that PSMA5, a subunit of the 20S proteasome, can bind to NRF2 under both procyanidin B1 treatment and untreated conditions. However, further research is needed to confirm that the PSMA5‐NRF2 interaction mediates the ubiquitination degradation of NRF2. In short, the PSMC3‐NRF2 regulation pathway represents a potential alternative to the KEAP1‐NRF2 regulation pathway for promoting NRF2 degradation via the ubiquitin‐proteasome pathway.

A series of in vitro and in vivo experiments demonstrated that procyanidin B1 inhibited NRF2 expression and induced ferroptosis in GBM. Consistent with the results of a previous study on ferroptosis criteria (Stockwell 2022), the findings presented here indicated that procyanidin B1 augments COX2 levels and reduces SLC7A11 levels through downregulation of NRF2. This suggests that procyanidin B1 alters the expression of key genes (COX2 and SLC7A11) associated with ferroptosis. Furthermore, downregulation of NRF2 due to the presence of procyanidin B1 also promoted TFR1 expression (the transferrin receptor) and LOOH, implying that procyanidin B1 is a key marker of ferroptosis. We also found that procyanidin B1 promoted overloading of H₂O₂ by downregulating NRF2 expression, which was not affected by the peroxidases SOD1 and SOD2, suggesting that procyanidin B1 does not promote H₂O₂ production. While assessing whether the H₂O₂ overload triggered by procyanidin B1 was due to dysfunctional H₂O₂ scavenging, we found that procyanidin B1 reduced NADPH and GSH levels by downregulating NRF2 expression, which, in turn, interfered with H₂O₂ scavenging. It would appear then that procyanidin B1 promotes overloading of H₂O₂ by impeding scavenging through suppression of NRF2 expression during ferroptosis. Thus, because procyanidin B1 induced ferroptosis and exerted anti‐tumor effects through inhibition of NRF2 expression, it holds considerable potential as a candidate treatment for adjuvant GBM therapy. Additionally, Soo et al. classified ferroptosis into therapeutically induced ferroptosis and pathological ferroptosis in tumors (Yeon Kim et al. 2024). Pathological ferroptosis promotes GBM progression and leads to poor outcomes (Lu et al. 2024; Yee et al. ^{2022, 2020}), whereas therapeutically induced ferroptosis is beneficial for GBM therapy. Multiple ferroptosis inducers, including TMZ and radiation, have been investigated for enhancing GBM therapies (Yeon Kim et al. 2024; Zhuo et al. ²⁰²²). Ferroptosis has immunosuppressive properties and promotes immunotherapy resistance in patients with GBM (Dang et al. 2022; Liu et al. ²⁰²²). For instance, Liu et al. indicated that ferroptosis inhibition enhances the synergistic therapeutic outcome of GBM in immune checkpoint blockade therapy (Liu et al. 2022). Further investigations are warranted to gain a better understanding of the precise role ferroptosis plays in GBM progression within the complex TME, which would be beneficial for combination therapy targeting the ferroptosis pathway.

Procyanidin B1 is found in various fruits, vegetables, nuts, and seeds, especially grape seeds (Yamakoshi et al. 2002). High‐speed countercurrent chromatography and the macropore resin adsorption (Fu et al. 2022) are effective methods for large‐scale extraction of procyanidin B1. Moreover, Na et al. (2020) reported that procyanidin B1 suppresses HepG2 cell proliferation and migration at concentrations ranges of 0–500 μM without significant toxicity (Na et al. 2020). Lei et al. reported that procyanidin B1 induced a 52.3% ± 5.0% HCT‐116 cell death at 172.85 μM after treatment for 24 h without significant toxicity (Lei et al. 2023). In this study, the IC50 value of procyanidin B1 on U251 cells was 394 μM. At this concentration, procyanidin B1 exhibited no cytotoxic effects on bEnd.3 cells, indicating its safety in nontumor cells. Thus, we conducted in vitro experiments with procyanidin B1 at nontoxic concentrations to ensure the authenticity of the results and the reliability of the conclusions. Preclinical animal studies have highlighted the anti‐tumor properties and nontoxicity of procyanidin B1. For example, Na et al. using a hepatoma mouse model, observed no change in body weight at doses up to 15 mg/kg delivered through a subcutaneous injection every 3 days for 30 days (Na et al. 2020). Similarly, Lei et al. reported no change in body weight in a colon cancer mouse model treated with a high dose (60 mg/kg) by gavage every other day for 18 days (Lei et al. 2023). Based on the conversion table provided by Nair and Jacob (2016), we estimated the human equivalent dose of procyanidin B1 to be 1.22 mg/kg based on the 15 mg/kg dose used in the mouse model in our experiments, which may be beneficial for subsequent clinical treatment with procyanidin B1. Although, procyanidin B1 has demonstrated advantages in GBM therapy in animal studies, clinical evidence for its use in the treatment of GBM remains lacking. Further trials are needed to evaluate the clinical efficacy of procyanidin B1 in GBM.

This study reports for the first time that procyanidin B1 promotes the interaction between NRF2 and PSMC3 to increase ubiquitin‐dependent protein degradation of NRF2 and enhance the overload of H₂O₂, which induces ferroptosis in glioblastoma. Our study provides the evidence for procyanidin B1 as a novel NRF2 inhibitor to be adjuvant drugs for GBM therapy.

Author Contributions

Wei Gao: data curation, formal analysis, methodology, project administration, software, validation, visualization, writing – original draft. Yuan Li: data curation, investigation, methodology. Xiang Lin: investigation, methodology, software, validation. Kun Deng: conceptualization, investigation. Xinmiao Long: resources, software, visualization. Danyang Li: supervision, validation, visualization. Meng Huang: resources, software. Xiangyu Wang: resources, validation. Yucong Xu: formal analysis, supervision, validation. Xiaoling She: investigation, project administration. Minghua Wu: conceptualization, funding acquisition, project administration, supervision, validation.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1:Supporting Information.

Data Availability Statement

Others can access the data supporting the findings of the paper from the correspondence author. The data must be obtained through a Material Transfer Agreement (MTA).