Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Apr 25.
Published in final edited form as: Cell. 2024 Apr 25;187(9):2129–2142.e17. doi: 10.1016/j.cell.2024.03.017

Generation of rat forebrain tissues in mice

Jia Huang 1,2,10, Bingbing He 1,2,10, Xiali Yang 3,10, Xin Long 4,5,10, Yinghui Wei 2,10, Leijie Li 1,10, Min Tang 6, Yanxia Gao 2, Yuan Fang 2, Wenqin Ying 2, Zikang Wang 2, Chao Li 2, Yingsi Zhou 2, Shuaishuai Li 2, Linyu Shi 7, Seungwon Choi 6, Haibo Zhou 2,*, Fan Guo 4,5,*, Hui Yang 2,*, Jun Wu 1,8,9,11,*
PMCID: PMC11646705  NIHMSID: NIHMS1978914  PMID: 38670071

SUMMARY

Interspecies blastocyst complementation (IBC) provides a unique platform to study development and holds potential to overcome world-wide organ shortages.1 Despite recent successes,24 however, brain tissue has not been achieved through IBC. Here, we developed an optimized IBC strategy based on C-CRISPR,5 which facilitated rapid screening of candidate genes and identified Hesx1 deficiency supported the generation of rat forebrain tissue in mice via IBC. Xenogeneic rat forebrain tissues in adult mice were structurally and functionally intact. Cross-species comparative analyses revealed that rat forebrain tissues developed at the same pace with the mouse host, but maintained rat-like transcriptome profiles. Chimeric rate of rat cells gradually decreased as development progressed, suggesting xenogeneic barriers during mid-to-late prenatal development. Interspecies forebrain complementation opens the door for studying evolutionarily conserved and divergent mechanisms underlying brain development and cognitive function. The C-CRIPSR based IBC strategy holds great potential to broaden the study and application of interspecies organogenesis.

eTOC/In Brief:

An optimized screening platform streamlined the identification of mutations which supported the generation of rat forebrain tissue in mice via interspecies blastocyst complementation

Graphical Abstract

graphic file with name nihms-1978914-f0007.jpg

INTRODUCTION

Advances in interspecies chimeras and blastocyst complementation have offered hope in addressing the global shortage of donor organs and have expanded our understanding of the molecular and cellular mechanisms involved in organogenesis.1 Blastocyst complementation involves injecting chimera-competent donor pluripotent stem cells (PSCs) into mutant host blastocysts, which lack one or more essential genes for the development of a specific organ. Through intra- or inter-species chimera formation, donor PSCs can fill the vacant developmental organ niche and generate organs derived from donor PSCs within the host.6,7 Previous studies have successfully demonstrated intra-species blastocyst complementation for various mouse tissues, including the pancreas, thymus, kidney, heart, liver, lung, germ cells, and forebrain.817 Although limited in scope, several studies have attempted inter-species blastocyst complementation, generating rat pancreas, thymus, hematoendothelial tissues, and germ cells in mice,24,1820 as well as mouse pancreas, kidney, and germ cells in rats.2123 To date, however, inter-species blastocyst complementation has not been achieved for any brain tissues. There is substantial interests in generating brain tissues from one species within another, as this would not only enable in vivo studies of brain development and function in an evolutionary context, but also provide a crucial foundation for addressing ethical concerns surrounding the contribution of human PSCs to animal brains.1

Traditional blastocyst complementation methods typically involve generating and breeding sexually mature gene-edited mice, which is labor-intensive and can take a significant amount of time to determine the viability of a chosen candidate gene for target organ complementation.4,10 To date, no suitable gene(s) have been identified for interspecies neural blastocyst complementation. Screening candidate genes through targeted gene disruption in germline-competent PSCs can be a lengthy process, even for species with short gestation periods and fast sexual maturation (e.g. 10–26 months for mice). This method becomes even more impractical for larger livestock species and non-human primates. In this study, we introduce an optimized blastocyst complementation technique that allows for the efficient screening of candidate genes and streamlines the generation of functional rat embryonic stem cell (rESC)-derived forebrain tissues in mice.

RESULTS

CCBC, an improved blastocyst complementation method

To overcome the limitations associated with existing blastocyst complementation methods, we combined the C-CRISPR approach, which enables rapid screening of candidate genes and one-step generation of complete gene knockout animals with multiple sgRNAs,5 with blastocyst complementation (CCBC) (Figure 1A left). CCBC allows for quick testing whether the target genes are suitable for blastocyst complementation and enables one-step generation of organ-reconstituted chimeras, which is desirable when using large livestock hosts.

Figure 1. CCBC facilitates quick genetic screening for neural blastocyst complementation.

Figure 1.

(A) Schematic showing one-step generation specific organ in mice using CCBC and candidate genes for forebrain compensation which involved in regulating Wnt signaling during brain organogenesis.

(B) The efficiency of C-CRISPR-mediated gene knockout in 4-cell mouse embryos. Gene knockout is determined by both PCR and Sanger sequencing. >40bp deletion or frame shift is considered a putative gene knockout.

(C) The percentage of forebrain agenesis after gene knockout in E12.5 mouse embryos. ND, no data.

(D) Representative images showing forebrain agenesis at embryonic day (E) 12.5 in gene knockout mouse embryos. Embryos with forebrain agenesis are marked in yellow *. F, forebrain; M, midbrain; H, hindbrain. Experiments were repeated 3 times independently for each group.

(E) Representative images showing forebrain reconstitution in E12.5 CCBC mouse embryos. Embryos with reconstituted forebrain are marked in yellow*. F, forebrain; M, midbrain; H, hindbrain.

(F) The efficiency of forebrain reconstitution in E12.5 CCBC chimeras.

(G) Images showing newborn Dkk1−/− mice (P0) with or without forebrain reconstitution. Note that the complete allogenic forebrain was only formed in Dkk1−/−+mESCs chimeras but not in Dkk1−/− mice.

(H) Images showing newborn Hesx1−/− mice (P0) with or without brain reconstitution. Note that the forebrain was only formed in Hesx1−/−+mESCs chimera but not in Hesx1−/− mice.

(I) Quantification of forebrain reconstitution efficiency of Dkk1−/−+mESCs and Hesx1−/−+mESCs chimeras at P0.

The transcription factor Pdx1 plays a critical role in pancreatic development: mice lacking Pdx1 do not develop a pancreas and die soon after birth.24 Previous studies have shown that disruption of Pdx1 gene in the host embryos can support mouse-mouse, rat-mouse and mouse-rat pancreas blastocyst complementation.2,4,13,23 Using pancreas as a proof-of-concept, we tested the efficacy and efficiency of CCBC (Figure S1A). We designed 4 sgRNAs that are spaced out 30–55bp apart from each other within the exon 1 of the mouse Pdx1 locus (Figure S1B) and co-injected them with Cas9 mRNA into mouse zygotes. We found Pdx1 was successfully disrupted from all the examined 4-cell embryos using the C-CRISPR approach (Figure S1C). All neonatal Pdx1−/− mice generated using CCBC died within 4 days after birth due to pancreas agenesis (Figures S1D-S1F).

For pancreas blastocyst complementation, 4 gRNAs (100ng/μl) targeting Pdx1 and Cas9 mRNA (80ng/μl) were co-injected into mouse zygotes followed by injection of 8–10 tdTomato labeled mESCs into blastocysts. Among the 37 Pdx1−/− mice that were born, 14 were tdTomato positive among which 13 showed an intact pancreas; the remaining pups displayed pancreatic agenesis (Figures S1G-S1I; Table S1). In contrast to the WT+mESCs chimeras, we found that the pancreas of Pdx1−/−+mESCs were mostly derived from donor mESCs (Figure S1J), consistent with a previous study.4 Immunofluorescence analysis demonstrated that the pancreas of Pdx1−/− +mESCs chimeras contained cells expressing the pancreatic exocrine protein α-AMYLASE and the pancreatic endocrine proteins INSULIN and GLUCAGON, which were completely overlapped with tdTomato signals (Figure S1K).

CCBC facilitates quick genetic screening for neural blastocyst complementation

Leveraging the Cre-DTA (diphtheria toxin A) mediated cell ablation, a recent study harnessed blastocyst complementation for allogenic forebrain organogenesis in mice.10 To date, it remains unknown which gene(s) is suitable to target for use in gene knockout-based forebrain blastocyst complementation. In early vertebrate embryogenesis, head formation is known to depend on the Wnt/β-catenin signaling.2529 To this end, we used C-CRISPR to perform a targeted screen of seven known genes that are implicated in regulating the canonical Wnt signaling during brain development (Figure 1A right).

All seven selected candidate genes could be efficiently deleted by C-CRISPR (Figure 1B), but only knockout of Dkk1, Hesx1, and Six3 resulted in a forebrain agenesis phenotype (Figures 1C and 1D). Upon injection of mESCs into individual gene-deleted blastocysts, we observed complete allogenic forebrains in Dkk1−/− and Hesx1−/− E12.5 embryos (Figures 1E and 1F). In contrast, mESCs were not able to rescue the forebrain agenesis phenotype in Six3−/− E12.5 embryos (Figures 1E and 1F). Among the 61 Dkk1−/−+mESCs newborn chimeras, we obtained 55 (90.16%) forebrain reconstituted chimeras (Figures 1G and 1I). Among the 68 Hesx1−/−+mESCs newborn chimeras, we obtained 66 (97.06%) forebrain reconstituted chimeras (Figures 1H and 1I). Whole genome sequencing of Hesx1−/− mice (n = 6) showed no off-target effects were detected (Table S2).

To determine the contribution of donor cells in the chimeric forebrains, we injected tdTomato+ mESCs into Hesx1−/− blastocysts expressing EGFP driven by the ubiquitous promoter CAG (Figure 2A), and generated EGFP-tdTomato dual-labelled chimeras (Figure 2B). Analysis of whole brain sagittal slices revealed most, if not all, cells in the cerebral cortex and hippocampus of the Hesx1−/−+mESCs chimeras were tdTomato+, and the proportion of tdTomato+ within forebrain was much higher in Hesx1−/−+mESCs chimeras (~ 100%) than in WT+mESCs chimeras (~50%) (Figures 2C2E, and S2A). The midbrain area unaffected by Hesx1 knockout had a chimeric rate close to 50% (Figures 2E, S2A and S2B). These findings show complete repopulation of the vacant host forebrain niche by donor mESCs. By contrast, Dkk1−/−+mESCs chimeras showed on average 95.93% and 98.76% chimeric rates in the midbrain and cortex while 53.36% in the hippocampus (Figures S2A and S2B). Thus, it appears that Dkk1 is not suitable for forebrain blastocyst complementation. All Hesx1−/−+mESCs and Dkk1−/−+mESCs mice survived to adulthood (Figures 2F and S2C), with brain size comparable to WT-mESCs controls (Figures 2G, 2H, S2D and S2E). Taken together, these results demonstrate the efficacy of using CCBC to screen and identify candidate genes for blastocyst complementation and show the proof-of-concept of targeting Hesx1 for intraspecies functional forebrain complementation in mice.

Figure 2. Intraspecies blastocyst complementation of forebrains in Hesx1−/− mice.

Figure 2.

(A) Schematic for the generation of dual-color-labelled chimeric mice. Red, tdTomato+ donor mESCs; Green, EGFP+ Hesx1−/− host blastocyst.

(B) Representative images of Hesx1−/−+mESCs chimeras at P0.

(C) Representative sagittal brain sections from WT+mESCs (lower, n = 3) and Hesx1−/−+mESCs (upper, n = 4) chimeras. Yellow dashed line, cortex (C); white dashed line, hippocampus (H); orange dashed line, midbrain (M). Scale bars, 1mm.

(D) Representative images showing the contribution of tdTomato+ donor mESCs to the CA1, CA3, cortex and midbrain regions in WT+mESCs (upper, n = 3) and Hesx1−/−+mESCs (lower, n = 4) P0 chimeras. Green, host-derived cells; Red, donor-derived cells; Blue, DAPI-stained nuclei. Scale bars, 100 μm.

(E) Percentages of tdTomato+ donor mouse cells in the CA1, CA3, cortex and midbrain regions in WT+mESCs and Hesx1−/−+mESCs chimeras (n = 3 per group). All values are presented as the mean ± s.e.m.. ***p < 0.001, unpaired t-tests. ns, not significant.

(F) Hesx1−/−+mESCs and WT+mESCs chimeras at the age of 20 months.

(G) Bright-field and fluorescence images showing no obvious difference between the brains of Hesx1−/−+mESCs and WT+mESCs chimeras at 10 weeks of age.

(H) Brain weight of Hesx1−/−+mESCs and WT+mESCs at 10 weeks of age (n = 10 mice per group).

CCBC enables interspecies neural blastocyst complementation

To determine whether CCBC is applicable to interspecies blastocyst complementation, we first injected 4 sgRNAs (100ng/μl) targeting Pdx1 along with Cas9 mRNA (80ng/μl) into mouse zygotes followed by blastocyst injection of 8–10 tdTomato+ rESCs. Among the 50 rat-mouse chimeras born, we obtained 9 bearing a reconstituted rat pancreas (Figures S3A and S3B). Pancreatic cells in reconstituted Pdx1−/−+rESCs chimeras expressed α-AMYLASE, INSULIN, and GLUCAGON, and were mostly derived from rESCs (Figure S3C), which is consistent with previous reports.2,4 These results show that a xenogeneic rat pancreas can be successfully formed in Pdx1−/− mice by combining C-CRISPR and interspecies blastocyst complementation, demonstrating the utility of the CCBC method for one-step generation of xenogeneic organs and tissues.

To date, interspecies blastocyst complementation has not been reported for any brain tissues. To determine whether rat forebrain tissues can be generated in mice via CCBC, we injected rESCs into Dkk1−/−or Hesx1−/− mouse blastocysts (Figure 3A). Interestingly, Dkk1−/−+rESCs chimera pups (374) were all partially (100%), but fully, forebrain reconstituted (Figures S3D and S3E). In contrast, 417 Hesx1−/−+rESCs chimeras were born, among which 401 were partially forebrain reconstituted (96.16%) and 16 were fully forebrain reconstituted (3.84%) (Figures 3B and S4A). We found that, in the Hesx1−/−+rESCs chimeras, the proportion of tdTomato+ cells were higher in the cortex and hippocampus than in other brain regions and other tissues (Figures 3C3E, and S4B-S4E).

Figure 3. Generation of rat forebrain tissues in mice via interspecies blastocyst complementation.

Figure 3.

(A) Schematic for the generation of rESC-derived forebrain tissues in mice via CCBC.

(B) Representative images of WT+rESCs and Hesx1−/−+rESCs chimeras at the age of P3 and 20 months.

(C) Sagittal brain sections from WT+rESCs (left) and Hesx1−/−+rESCs (right) chimeras at 10 weeks. Yellow dashed line, cortex (C); White dashed line, hippocampus (H); Green dashed line, midbrain (M). Scale bar, 1mm.

(D) Representative images showing the contribution of tdTomato+ rat cells to different brain regions in WT+rESCs and Hesx1−/−+rESCs chimeras (n = 3 per group). Scale bar, 100 μm.

(E) Percentages of tdTomato+ rat cells in the indicated brain regions in WT+rESCs and Hesx1−/−+rESCs chimeras (n = 12 slices per group). Unpaired t-tests.

(F) The axonal projections of neurons from a forebrain region anterior lateral motor cortex (ALM). Note that strong signals were observed in the cortex, thalamus, superior colliculus (SC), and medulla, the known target regions of ALM neuron axons (n = 2 chimeras). Scale bar, 1 mm.

(G) Images from a coronal slice showing that the axon fibers of ALM neurons in the midbrain were positive for both EGFP and tdTomato, suggesting that rESC-derived tdTomato+ neurons send axons to the midbrain. Yellow arrowheads indicate the colocalization of tdTomato and EGFP signals in the axonal fiber. White arrowheads indicate projected host-derived axonal fibers. Scale bar, 10 μm.

(H) Schematic of patch-clamp recordings of cortical neurons of the P14-aged Hesx1−/−+ rESCs chimeras.

(I) A representative image of tdToamto+ rat (*) and tdTomato mouse (#) cortical neurons in the brain slice.

(J) and (K) Action potential firing activities of tdToamto+ and tdTomato cortical neurons induced by a series of step current injections (2 s duration). Representative traces (E) and the quantification of firing rate (F) are shown. ns, not significant; two-way ANOVA with Sidak’s multiple comparison test. All values are presented as the mean ± s.e.m.. **p < 0.01, ***p < 0.001, unpaired t-tests. ns, not significant.

(L) The quantification of input resistance of tdToamto+ and tdTomato cortical neurons. ns, not significant between tdToamto+ (581±37 MΩ) and tdTomato- (556±43 MΩ) cortical neurons; two-tailed unpaired t-test.

(M) The quantification of resting membrane potential of tdToamto+ and tdTomato cortical neurons. ns, not significant between tdToamto+ (−79.4±1.6 mV) and tdTomato- (−81.8±1.3 mV) cortical neurons; two-tailed unpaired t-test. The data are shown as Mean ± SEM.

(N) Single action potential of tdToamto+ and tdTomato cortical neurons was induced by a series of short step current injections (10 ms duration) to determine the rheobase. The quantification of rheobase are shown. ns, not significant between tdToamto+ (208±16.7 pA) and tdTomato- (236±18.8 pA) cortical neurons; two-tailed unpaired t-test.

To evaluate the function of the neurons derived from rESCs, we first injected AAV8-hSyn-EGFP into the anterior lateral motor cortex (ALM) of the Hesx1−/−+rESCs forebrain. Consistent with a previous report,30 we found that EGFP+ axons sent axon projections from ALM to thalamus, superior colliculus and medulla areas in the midbrain and brain stem (Figures 3F and 3G), demonstrating that rESC-derived forebrain neurons sent projections to other brain regions. We also performed electrophysiological recording of neurons in the Hesx1−/−+rESCs chimeras. To distinguish mouse and rat neurons, we co-injected Cas9 mRNA and Hesx1 gRNAs into mouse zygotes constitutively expressing EGFP, which is followed by blastocyst injection of tdTomato-labeled rESCs (Figure S4F). Among the 956 injected blastocysts that were transferred, we successfully generated 8 postnatal chimeras expressing both EGFP and tdTomato. Of these, two survived to postnatal day 14 (P14) (Figure S4G). We extracted the forebrains from two P14 chimeras and performed whole-cell patch-clamp recordings on tdTomato+ (rat) and tdTomato (Hesx1−/− mouse) neurons in cortical slices (Figures 3H and 3I). Our results showed that, in the chimeras, both rat and mouse cortical neurons were capable of generating action potential firing following current injections in a current amount-dependent manner (Figures 3J and 3K). Furthermore, intrinsic physiological properties, including the input resistance (Figure 3L), resting membrane potential (Figure 3M), and rheobase (minimum current required to induce action potential firing) (Figures 3N and S4H) were not significantly different between the two cell types (Figures 3L3N). These results suggest that both types of neurons have comparable membrane excitability.

To investigate if rat and mouse neurons form synaptic connections in Hesx1−/−+rESCs chimeras, we performed immunostaining to identify the synaptic pre-membrane (Syn: Cy5) and post-membrane (PSD-95: blue) in the dual-color chimeras (Hesx1−/− mouse: EGFP, Rat: tdTomato). In our analysis of neighboring rat-mouse neuronal cell pairs, we observed pairs showing signals for both synaptic pre-membrane and post-membrane, located in close proximity to each other (Figure S4I). Similarly, intraspecies synaptic connections were evident between Hesx1−/− mouse neurons (Figure S4J) and rat neurons (Figure S4K) in the chimeras. There was no discernible difference in synaptic formation between neurons of either the same species or different species (Figure S4L).

Taken together, these results demonstrate that Hesx1−/− mouse blastocysts provide a developmental niche amenable to the formation of functional rat forebrain tissues from donor rESCs.

Forebrains reconstituted in intra- or interspecies chimeras are structurally and functionally normal

All Hesx1−/−+rESCs chimeras survived to adulthood showed a body weight curve comparable to that of WT+mESCs and Hesx1−/−+mESCs chimeras (Figure 4A). The structural integrity of rat or mouse forebrain tissues generated in mice was assessed by layer-specific immunocytochemical marker staining. The cortex layer V and hippocampus of WT+mESCs, Hesx1−/−+mESCs and Hesx1−/−+rESCs chimeras contained cells expressing the neural marker Ctip2 (Figure 4B). And both the thickness and cell density of various layers of the cerebral cortex and the hippocampus appeared similar among Hesx1−/−+rESCs, WT+mESCs and Hesx1−/−+mESCs chimeras (Figures 4C4E). These results are consistent with previous observations that body size and xenogeneic organ size matched with the host species in interspecies chimeras.2,4,23

Figure 4. Reconstituted forebrains of intra- or interspecies chimeras are structurally and functionally normal.

Figure 4.

(A) Body weight curves of Hesx1−/−+rESCs, Hesx1−/−+mESCs and WT+mESCs chimeras. (n = 10 per group).

(B) Representative images of sections from the somatosensory cortex and the hippocampus stained with Ctip2 and DAPI from WT+mESCs (left), Hesx1−/−+mESCs (middle) and Hesx1−/−+rESCs (right) chimeras at P7. Scale bar, 100 μm.

(C) Widths of somatosensory cortex layers in WT+mESCs (blue, n = 3), Hesx1−/−+mESCs (red, n = 5), or Hesx1−/−+rESCs (black, n = 5) chimeras at P7.

(D) Widths of the dentate gyrus (DG), CA3, and CA1 regions in WT+mESCs (blue, n = 3), Hesx1−/−+mESCs (red, n = 5), or Hesx1−/−+rESCs (black, n = 5) chimeras at P7.

(E) Quantitative analysis of cell density of different brain regions of Hesx1−/−+mESCs and Hesx1−/−+rESCs chimeras at the age of 8 weeks (n = 3 per group).

(F) Total distance travelled in the open-field assay for WT+rESCs (gray), Hesx1−/−+mESCs (green), and Hesx1−/−+rESCs (orange) chimeras. n = 16 chimeras for the WT+mESCs and Hesx1−/−+mESCs groups; n = 10 chimeras for the Hesx1−/−+rESCs group.

(G) Left. Mean path length to the platform for WT+rESCs (gray), Hesx1−/−+mESCs (green), and Hesx1−/−+rESCs (orange) chimeras in the learning trials of Morris water maze task. Right. Mean time spent in the target quadrant in the target quadrant for WT+rESCs (gray), Hesx1−/−+mESCs (green), and Hesx1−/−+rESCs (orange) chimeras in test trials of Morris water maze task. n = 16 chimeras for the WT+mESCs and Hesx1−/−+mESCs groups; n = 8 chimeras for the Hesx1−/−+rESCs group.

(H) Percentage of freezing of WT+rESCs, Hesx1−/−+mESCs, and Hesx1−/−+rESCs chimeras in the contextual fear conditioning test. n = 16 chimeras for the WT+mESCs and Hesx1−/−+mESCs groups; n = 10 chimeras for the Hesx1−/−+rESCs group. All values are presented as the mean ± s.e.m.. **p < 0.01, ***p < 0.001, unpaired t-tests. ns, not significant.

We also assessed cognitive functions using behavioral tests known to depend on intact forebrain function, which include the Morris water maze, Open-field assay, and Contextual fear conditioning.3133 We observed no differences in performance between WT+mESCs, Hesx1−/− +rESCs and Hesx1−/−+mESCs chimeras (Figures 4F4H) as well as between WT+mESCs and Dkk1−/−+mESCs chimeras (Figures S2F-S2I), for any of these tests, suggesting normal functions of the reconstituted forebrains.

Xenogeneic barriers during mid-to-late stage of embryonic development

Whole embryos sections of embryos at different stages of development were performed to monitor the dynamic donor rat cell contribution in Hesx1−/−+rESCs embryos and fetuses. In agree with a previous report,34 we observed that as the development progressed, the overall chimeric contribution of rat cells in mouse fetuses gradually decreased from ~60% to about 20% by E17.5, and the rat chimeric level in the forebrain also decreased from 90–100% to ~60% by E15.5 (Figures 5A5C). These results suggest an interspecies barrier from mid-to-late gestation stages between rats and mice, and to enable full forebrain complementation of Hesx1−/− mouse by rat cells, method(s) to overcome chimeric rate reduction during this developmental period need to be considered.35,36

Figure 5. The dynamic donor rat cell contribution in Hesx1−/−+rESCs embryos and fetsues.

Figure 5.

(A) Representative fluorescent images of different tissue sections in Hesx1−/−+mESCs and Hesx1−/−+rESCs fetuses at E12.5 and E15.5. Scale bars, 100 μm.

(B) and (C) Contribution of rESCs in the whole body (B) and the forebrain (C) of the Hesx1−/−+mESCs and Hesx1−/−+rESCs chimeras (n = 5 for each group). All values are presented as the mean ± s.e.m.. *p < 0.05, **p < 0.01, ***p < 0.001, unpaired t-tests. ns, not significant.

Cell autonomous and non-cell autonomous effects in forebrain reconstituted rat-mouse chimeras

We studied the brain development pace in WT (mouse), Hesx1−/− (mouse), Hesx1−/−+mESCs (mouse-mouse chimera), Hesx1−/−+rESCs (rat-mouse chimera) and WT (rat) embryos at E9.5 and E11.5 (n = 3 for each group) (Figure 6A). H&E-staining identified prosencephalon (PRO), mesencephalon (MS), rhombencephalon (RHO) in E9.5 mouse and E11.5 rat embryos, reflecting a ~2 days delay in developmental timing in rats. At E11.5, mouse PRO expands into the telencephalon (T) and the diencephalon (D), the MS remains unchanged, and the RHO becomes the metencephalon (MT) and myelencephalon (MY).37 Intriguingly, Hesx1−/−+rESCs embryos exhibited the same pace of brain development to WT and Hesx1−/−+mESCs mice. These results suggest, similar to body and organ size, development of the rat brain tissues in rat-mouse chimeras is synchronized with the mouse host.

Figure 6. Cell autonomous and non-cell autonomous effects in forebrain reconstituted rat-mouse chimeras.

Figure 6.

(A) Representative H&E staining images of WT (mouse), Hesx1−/− (mouse), Hesx1−/−+mESCs (chimera), Hesx1−/−+rESCs (chimera) and WT (rat) embryos at E9.5 and E11.5 (n = 3 for each group). prosencephalon (PRO), mesencephalon (MS), rhombencephalon (RHO), telencephalon (T), diencephalon (D), metencephalon (MT) and myelencephalon (MY). Scale bars, 300 μm.

(B) Schematic overview of single-cell RNA-seq analysis of forebrains tissues from Hesx1−/−+rESCs chimeras (n = 3), WT rat (n = 1), and WT mouse (n = 1) at P0.

(C) Boxplot showing UMI counts derived from the mouse genome and rat genome, among cells in WT mouse, WT rat and putative mouse or rat cells in the chimera.

(D) Uniform manifold approximation and projection (UMAP) visualization of single cells that were analyzed based on both their gene expression and species origin. Homologous genes between mice and rats were used for the analysis. Single cell data from WT mouse, WT Rat and Chimeras were used to perform integrative analysis for identifying rat cells and mouse cells in the WT mouse, WT Rat and Hesx1−/−+rESCs chimeras, respectively.

(E) Visualization of UMAP showing integrated analysis cells in WT mouse, WT Rat and Hesx1−/−+rESCs chimeras. Cells are as color-coded by cell type. EXs, excitatory neuron; INs, inhibitory neurons; OPCs, oligodendrocyte progenitor cells; NSCs, neural stem cells.

(F) Principal component 1 (PC1) vs. PC2 of the principal component analysis (PCA) of EXs(NEUROD6,RND2,SEMA3C) and INs(DLX1,HTR3A) cells in WT mouse, WT rat and Hesx1−/−+rESCs chimeras. Cells from WT mouse, WT rat, and chimeras are as color-coded. The putative species origins are as shape coded.

(G) Heatmaps showing Pearson correlations between cells of the indicated sources. Pearson correlation was calculated based on the normalized gene expression levels.

(H) The heatmap shows the differentially expressed genes (DEGs) between Chimera_mouse cells and WT mouse cells, Chimera_Rat cells and WT rat cells in different cell types. EXs, excitatory neuron; INs, inhibitory neurons; OPCs, oligodendrocyte progenitor cells; NSCs, neural stem cells. The expression levels of the top 30 highly expressed genes in each cell type were presented.

(I) and (J) Gene Ontology (GO) enrichment analysis of DEGs in Chimera_mouse cells and WT mouse cells, Chimera_Rat cells and WT rat cells among all the excitatory neurons (EXs Total) and inhibitory neurons (INs Total). The top 10 significantly enriched pathways of DEGs were showed.

To study the transcriptomic states of rESC-derived neurons, we isolated single cells using vibratome sections prepared from the cortex and hippocampus of Hesx1−/−+rESCs chimeras, WT mouse and WT rat at the age of P0 and subjected them to single-cell RNA-seq (scRNA-seq) (Figure 6B). Feature-barcode matrices of mouse and rat were separated based on reference mouse and rat genome. For each cell, the number of counts from the part of mouse and rat matrices were calculated respectively. Cells with counts 10-fold more from the rat than the counts from mouse were defined as putative rat cells (Figures 6C and 6D). Then, we identified different neuronal subtypes based on the expression of known markers (Figure S5A). We conducted 40× read depth DNA sequencing analysis on the cortex and hippocampus cells isolated from the Hesx1−/−+rESCs chimeras, which confirmed that Hesx1 was successfully disrupted in the mouse cells (Figure S5B). scRNA-seq analysis revealed that rESCs generated various types of neurons in the chimeric forebrain including excitatory neurons, inhibitory neurons, glial cells, and others (n = 3 for Hesx1−/−+rESCs chimeras, n = 1 for WT mouse and WT rat) (Figures 6E and S5C). Employing markers that are uniquely expressed in various brain regions, we spatially annotated rat and mouse cells within the forebrain of the chimeric specimens (Figure S5D). Intriguingly, the bulk of the rat-derived cells contributed to the neurons within the hippocampal region (Figure S5D). We quantified the percentage of different cell subpopulations in rats, mice, and rat-mouse (Hesx1−/−+rESCs) chimeras. The results showed that both mouse and rat cells in the chimeras generated cell subpopulations at comparable proportions to control WT mice and rats. Interestingly, the cell subpopulations and proportions of mouse and rat cells in the chimera closely resembled those in WT mice and WT rats, respectively (Figure S5E). We next performed comparative transcriptomic analysis of neurons from rat-mouse chimeras, as well as from WT rats and mice. Our analysis revealed that rESC-derived neurons in rat-mouse chimeras transcriptomically resembled WT rat neurons while the expression profiles of host Hesx1−/− mouse neurons were similar to WT mouse neurons, suggesting cell autonomous rather than non-cell autonomous mechanisms dictate overall neuronal transcriptomic signatures in rat-mouse chimeras (Figures 6F, 6G, S6A and S6B).

To study how mouse microenvironment may affect donor rat cells, and vice versa, we compared the differentially expressed genes (DEGs) between the cells in chimeras and those in WT mice and rats (Figure 6H and Table S3). While the overall expression pattern was similar across various neuronal subtypes, some DEGs were identified (Figure 6H and Table S3). Gene Ontology (GO) analysis revealed that the DEGs in excitatory neurons (EXs) and inhibitory neurons (INs) were associated with axonogenesis, forebrain development, regulation of neurogenesis, among others (Figures 6I and 6J; Table S4). We explored the regulation status of these Top GO pathways through Gene Set Enrichment Analysis (GSEA). The results revealed that axonogenesis, forebrain development, regulation of neurogenesis pathways are significantly activated in mouse cells of the Hesx1−/−+rESCs chimeras when compared to those in WT mouse for both EXs and INs (Figure S5F). And the TOP GO pathways significantly activated in rat cells of the Hesx1−/−+rESCs chimeras when compared to those in WT rat included regulation of neuron differentiation, telencephalon development, and axonogenesis for EXs (Figure S5G). Moreover, we conducted CellPhoneDB (v5.0.0) analysis to explore potential cell-cell interactions between mouse and rat cells in the Hesx1−/−+rESCs chimeras. This analysis predicted several ligand-receptor interactions (Figure S6C), which might explain how host Hesx1−/− mouse cells influence donor rat cells, and vice versa, aiding their survival and differentiation in the forebrain.

Taken together, our findings demonstrate non-cell autonomous mechanisms determine the size and development time while cell autonomous mechanism shapes the overall transcriptomic landscape of rat forebrain tissues in mice generated via interspecies blastocyst complementation.

DISCUSSION

In summary, we have developed an efficient and rapid one-step C-CRISPR-based blastocyst complementation (CCBC) platform, which revealed that Hesx1 knockout in mouse blastocysts supported the generation of forebrain tissue from both mouse and rat ESCs. It is important to note that, while Dkk1 knockout facilitated the formation of a functional forebrain derived from mESCs, it did not yield the same results with rESCs. Dkk1-null mice exhibited agenesis phenotypes in both the forebrain and midbrain,28 indicating that rESCs were unable to compensate for the more extensive developmental defects present in Dkk1−/− embryos compared to Hesx1−/− embryos. These results underscore the significance of thoroughly screening and validating candidate genes’ suitability for creating organ-complemented interspecies chimeras.

We anticipate that the CCBC platform can be broadly applied to a wide range of organs, paving the way for utilizing large animals as hosts in blastocyst complementation experiments involving human cells. This approach has the potential to greatly expand our understanding of organ development, regeneration, and diseases, as well as address the global shortage of donor organs for transplantation. Despite the promising potential of CCBC, our study revealed that the chimeric rate of rESC-derived cells in mice gradually decreased as development progressed. This suggests the existence of additional xenogeneic barriers6,34,38,39 during mid-to-late prenatal development, which could impede the successful generation of chimeric organisms. Consequently, developing effective strategies to improve chimeric rates at mid-to-late gestation stages will be key to unlocking the full potential of CCBC. A recent development in this field is a cell competitive niche complementation strategy that utilizes Igf1r-null mouse host embryos, enabling donor chimerism to steadily increase from mid-gestation onward.36 It would be intriguing to explore the use of Igf1r and Hesx1 double knockout mouse embryos for full forebrain complementation with rESCs.

Several previous studies suggest that in interspecies chimeras, foreign donor cells can synchronize with the host species’ developmental timing, even with inherent species differences.4042 In our study, we observed that the developmental rate of rat ESC-derived brain tissues aligned with that of the mouse host. These findings demonstrate the innate adaptability of PSCs concerning differentiation speed and suggest that the host microenvironment plays a role in regulating the developmental timing of donor cells. Remarkably, the single-cell transcriptomes of rat forebrain tissues generated in mice show more similarity to those in control rats than to mice. This observation demonstrates that certain intrinsic features of donor cells are preserved in interspecies chimeras. These findings emphasize that both cell-autonomous and non-cell-autonomous mechanisms contribute to organ development within an interspecies context. This is reminiscent of a recent study that reported the generation of mouse kidneys in Sall1-deficient rats. In that study, the authors observed that the number of glomeruli was similar to control mice, but the size of the glomeruli was more like that of control rats.21 Therefore, interspecies neural blastocyst complementation allows researchers to explore the intricate interplay between external factors, like the host environment, and internal factors, such as species-specific gene expression. This dynamic interaction plays a crucial role in guiding the development of species-specific neuronal circuits and functions. Gaining a deeper understanding of these relationships can offer valuable insights into the fundamental mechanisms driving brain development, organization, and function.

Our study demonstrated that rESC-derived neurons are capable of not only functionally integrating but also enriching within a mouse forebrain. This discovery represents a crucial first step in realizing the full potential of interspecies neural blastocyst complementation as a transformative approach for studying brain development and disorders. With further advancements in interspecies chimerism, we anticipate that interspecies neural blastocyst complementation will pave the way for new opportunities to explore gene regulatory networks, cell-cell communication, and brain functions and behaviors within an evolutionary context.

Limitations of the study

There are several limitations to our current study. (1) This study was not able to achieve complete replacement of mouse forebrain by rat cells. The gradual decline in the overall contribution of rat cells in mouse forebrain is presumably due to mouse cells outgrow and/or outcompete rat cells, and/or other xenogeneic barriers. Future research needs to investigate the mechanisms underlying these interspecies barriers to further improve the contribution ratio of rat cells in mouse forebrain. (2) We did not observe any significant differences between Hesx1−/−+rESCs chimeras and WT mice in several behavioral tests used in this study. We cannot exclude the possibility that more comprehensive behavioral studies based on tests that can distinguish mice and rats may be able to detect differences. (3) The efficiency of generating postnatal forebrain complemented rat-mouse chimeras remains low, which suggests additional unrecognized xenogeneic barriers exist between the two closely related rodent species. 4) While the behavioral tests we have conducted, along with additional analyses such as synaptic staining and electrophysiology, provide compelling evidence of the rat forebrain tissues’ functionality in mice, there is lack of direct evidence for functional connectivity between rat and mouse neurons within the chimeric brains. It is noteworthy that, in the same issue, a related study by Throesch et al. provides support for the functional connectivity between rat and mouse neurons within a chimeric brain. (5) While we have verified that the tdTomato-positive cells are of rat origin using fluorescence reporter, PCR, and scRNA-seq analysis, our study lacks more definitive evidence to confirm the identity of these cells as rat cells within the intact tissue, such as staining with rat-specific antibodies and RNA and DNA in situ hybridization.

STAR★METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests about reagents and other resources used in this work should be directed to and will be fulfilled by the lead contact: Jun Wu (jun2.wu@utsouthwestern.edu).

Materials Availability

Plasmids and cell lines generated in this study are available upon request to the lead contact and with a complete Materials Transfer.

Data and Code Availability

  • The RNA-seq datasets generated in this study have been deposited in the NCBI Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo) under accession number GSE152126.The deep sequencing data have been deposited in the BioProject (BioProject;https://www.ncbi.nlm.nih.gov/bioproject/) under accession number PRJNA649514.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Mice

C57BL/6-Tg(CAG-EGFP)131Osb/LeySopJ male mice aged 8 weeks were purchased from The Jackson Laboratory (006567). ICR (CD1) female mice aged 8 weeks were purchased from The Envigo (030). B6D2F1/J female mice aged 8 weeks were purchased from The Jackson Laboratory (100006). 6-week-old female and 8-week-old male rats Sprague-Dawley (SD) were purchased from SLAC laboratory (Shanghai). Mice and Rats were housed in a 12-h light/12-h dark cycle at 22.1°C–22.3°C and 33–44% humidity. All animal procedures were performed per the ethical guidelines of the University of Texas Southwestern Medical Center. The animal protocol was reviewed and approved by the UT Southwestern Institutional Animal Care and Use Committee (IACUC) [Protocol #2018–102430]. All experiments followed the 2021 Guidelines for Stem Cell Research and Clinical Translation released by the International Society for Stem Cell Research (ISSCR).

Derivation of mESCs and rESCs

Mouse blastocysts from C57BL/6J mice were obtained from in vitro cultured mouse zygotes. The zona pellucida was removed with acid Tyrodes solution (Sigma), each blastocyst was transferred into a 4-well plate and cultured on the derivation medium: KnockOut DMEM (Gibco) supplemented with 20% KnockOut Serum Replacement (KSR, Gibco), 0.1mM non-essential amino acids (NEAA, Millipore), 1% penicillin/streptomycin (Gibco), 1% nucleosides (Millipore), 1% L-Glutamine (Gibco), 0.1mM β-mercaptoethanol (Millipore), 3 μM CHIR99021 (Selleck), 1 μM PD035901 (Selleck) and 1500 U/ml of mouse LIF (Millipore). After 5–7 days, the outgrowths of blastocysts were disaggregated and replated in the 2il medium. rESCs were derived as reported previously.57 Rat blastocysts from Sprague-Dawley rat were gently flushed out from the E4.5 timed-pregnant rats’ uteruses using M2 medium (Millipore). Zona pellucida was removed with acid Tyrodes solution (Sigma), and each blastocyst was transferred into a 4-well plate and cultured on MEFs with 2il medium or N2B27 plus 2il. After 5–7 days, the outgrowths of blastocysts were disaggregated and replated in the same culture medium.

Generation of tdTomato-labelled mouse and rESCs

C57BL/6 ES cells and SD rat ES cells were passaged at a ratio of 1:4–1:6 to a 6-well plate when cells reached 70% confluence. 5 μg plasmids (PBL-CAG-tdTomato-PBR: CMV-PBase = 1:1) were introduced into cells with Lipofectamine 3000 (Thermo Fisher Scientific) using the standard protocol. Cells were sorted out by BD FACS Aria II and cultured for blastocysts injection.

Cell culture

C57BL/6 ES and C57BL/6-tdTomato+ ES cell lines were cultured on feeder cells with 2il medium: DMEM (Millipore) supplemented with 15% FBS (Gibco), 0.1mM non-essential amino acids (NEAA, Millipore), 1% penicillin/streptomycin (Gibco), 1% nucleosides (Millipore), 1% L-Glutamine (Gibco), 0.1mM β-mercaptoethanol (Millipore), 3 μM CHIR99021 (Selleck), 1 μM PD035901 (Selleck) and 1000 U/ml of mouse LIF (Millipore). Rat ES cells derived from SD rats’ blastocyst were cultured on feeder cells with N2B27 plus 2il: Mix DMEM/F12 (Gibco) with Neurobasal medium (Gibco) at a ratio of 1:1, and then supplemented with 0.5% N-2 Supplement (Gibco), 1% B-27 Supplement (Gibco), 1% L-Glutamine (Gibco), 0.1mM β-mercaptoethanol (Millipore), 1 μM CHIR99021 (Selleck), 1 μM PD035901 (Selleck) and 10000 U/ml of recombinant rat LIF (ESGRO). All the cells were cultured in a 37°C incubator under 5% CO2.

METHOD DETAILS

In vitro transcription of Cas9 mRNA and sgRNAs

The T7 promoter sequence was added to the Cas9 coding region by PCR amplification of px260 (Addgene, 42229) using the primer pair listed in Table S5. The T7-Cas9 PCR product was purified using Gel Extraction Kit (Omega) and then used as the template for in vitro transcription (IVT) of Cas9 mRNA using the mMESSAGE mMACHINE T7 kit (Life Technologies). For sgRNA preparation, we added the T7 promoter sequence to the sgRNA template by PCR amplification of px330 (Addgene, 42230) using the primer pair listed in Table S5. The T7-sgRNA PCR product was purified using Gel Extraction Kit (Omega) and used as the template for IVT of sgRNAs using the MEGAshortscript T7 kit (Life Technologies). Both the Cas9 mRNA and sgRNAs were purified using the MEGAclear kit (Life Technologies) and eluted with elution buffer according to the standard protocol.

Embryo and mice genotyping

Each zygote was collected into a PCR tube for genotyping when it reached to 4-cell stage. Zygotes were dissociated with 3 μl lysis buffer consists of 0.1% triton X-100 (Amresco, H2Q0212), 0.1% tween-20 (Amresco, H2T0301) and 30% proteinase K (20 min at 55°C and then 5min at 95°C). For mice, toes were collected and genomic DNA was extracted for genotyping. All the primers used in this study were listed in Table S5.

Microinjection of mRNAs into zygotes and establishment of blastocysts

For zygote preparation, fertilized eggs were obtained from super ovulated 8-week-old B6D2F1 (C57BL/6 cross with DBA/2) female mice by intraperitoneal injection of 7.5 IU pregnant mare serum gonadotropin (PMSG, Ningbo Sansheng Medicine) followed by 7.5 IU human chorionic gonadotropin (hCG, Ningbo Sansheng Medicine) 48 hours later. After injection, the mice were mated with B6D2F1 males. One-cell-stage embryos were collected 22–24 hours after hCG injection. For zygote injection, the mixture of Cas9 mRNA (80 ng/μl) and sgRNA (25 ng/μl) was injected into the cytoplasm of fertilized embryos with well recognized two pronuclei in a droplet of M2 medium containing 5 μg/ml cytochalasin B (CB, Sigma) using a FemtoJet microinjector (Eppendorf) with continuous flow settings. Embryos were then cultured in KSOM+AA with D-Glucose (Millipore) at 37°C under 5% CO2 for blastocyst injection. For blastocyst injection, blastocysts and ESCs were transferred into M2 medium droplets respectively. 8 to 12 mESCs or rESCs were introduced into the blastocoele near the ICM. The embryos were immediately transferred to recipients after injection.

Transfer of mouse embryos

ICR female mice (8 weeks) in the stage of estrus were selected as recipients and mated with vasectomized ICR males overnight to induce pseudopregnancy. Injected E3.5 blastocysts were loaded into the embryo manipulation pipette and transferred into the uterine cavity of 2.5 dpc pseudo pregnant recipient. Each recipient received 15 to 20 blastocysts and this experiment was finished within 20 to 30 minutes.

Whole genome sequencing and analysis for off-target effect

Genomes from Hesx1−/− (n = 6) and WT mice (n = 2) at P0 were sequenced with average 30 folds data using 150bp paired-end Illumina Xten platform. SolexaQA (V3.1.7.1)44 was used to filter the low-quality reads and Bwa-mem (0.7.16a)45,58 was used to align the clean reads to mm10 reference genome. Variant calling and filtration were performed using GATK (4.0.12.0)46 following GATK best practices. The parameters for variant filtration were “QD < 2.0 || MQ < 40.0 || FS > 60.0 || SOR > 3.0 || MQRankSum < −12.5 || ReadPosRankSum < −8.0”. Cas-offinder47 was used to predict the off-target sites with no more than five mismatches. Overlapping of SNVs or Indels was performed using Bedtools(v2.29.2).48 Dbsnp database and UCSC repeat tracks were used to filter the variants. All of the off-target sites were further examined by PCR amplification and sequencing, and none of true off-target sites were found (Table S2).

Immunofluorescence analysis

Mice were anaesthetized and transcardially perfused with normal saline and 4% paraformaldehyde at P0, P7 or adult stage. Brain and other tissues or organs were removed and fixed with 4% paraformaldehyde at 4°C for 24h, dehydrated with 30% sucrose in 0.1 M sodium phosphate buffer overnight at 4 °C, and then embedded in OCT. Brain and pancreas slices were sectioned into slices with thickness of 30 μm, washed with PBS three times, and then incubated with primary antibody at 4°C overnight. The following primary antibodies were used: anti-RFP (rabbit polyclonal, 1:500; 600401379, Rockland), Ctip2 (rat monoclonal, 1:200; ab18465, Abcam), Alpha Amylase (rabbit polyclonal, 1:200; PA5–51078, Thermo Fisher Scientific), Insulin (rabbit polyclonal, 1:1000; 15848–1-AP, Proteintech), Glucagon (rabbit polyclonal, 1:1000; 15954–1-AP, Proteintech). Sections were washed three times with PBS and incubated with secondary antibody Alexa Fluor 488-AffiniPure Donkey Anti-Rabbit IgG (H+L) (1:500, 711545152, Jackson), Alexa Fluor 488-AffiniPure Donkey Anti-Rat IgG (H+L) (1:500, 712545153, Jackson) and Cy™3-AffiniPure Goat Anti-Rabbit IgG (H+L) (1:500, 111165003, Jackson) for two hours at room temperature. Sections were washed three times with PBS, mounted with Vectashield (Vector Laboratories), a mounting medium containing DAPI (Thermo Fisher Scientific) for nuclear counterstaining. Non-brain tissues (liver, heart, stomach,spleen, kidney, tail and eye) were fixed and sectioned similarly to the brains. Slides were imaged with vs120 and FV3000 (Olympus) and processed using Image J.

Measurement of the width of the hippocampus and the cortex

To measure the layer width of the cortex and width of the hippocampus, brain slices from P7, adult chimeras (Dkk1−/−+mESCs, Hesx1−/−+mESCs, and Hesx1−/−+rESCs) and conventional chimera controls (WT+mESCs and WT+rESCs) were analyzed. Width of layer I–VI, I, II–IV and VI were determined by DAPI staining and the boundary of cortex. Layer V was determined by Ctip2 immunostaining. Width of CA1, CA3 and dentate gyrus were determined by DAPI staining. For quantification, target brain regions with high structural similarity were selected (at least three sections per mouse).

Analysis of single-cell RNA-seq data

For the raw sequencing data, the Cell Ranger (v3.1; 10X Genomics)49 was used for reads alignment, deduplication and quantification of gene expression with default parameters. First, both the Mouse (Mus musculus, GRCm38.p6) and Rat (Rattus norvegicus, Rnor_6.0) reference genomes were used for reads alignment, following the instructions from the 10× Genomics. Raw reads were aligned to the two-species reference genome and quality checked. Then, those uniquely mapped reads were used for UMI counting. Finally, for each barcode observed, gene expression was quantified and those cells with much lower RNA content were discarded. The filtered feature-barcode matrices were constructed by the Cell Ranger (v3.1; 10X Genomics)49.

The cell source in the chimera was first identified. Since the two-species reference genome was used, feature-barcode matrices could be separated into the part of Mouse and Rat, respectively. For each cell, the number of counts from the part of Mouse and Rat was calculated, respectively. Cells with counts 10-fold more from the Mouse than the counts from Rat were considered the Mouse cells. And cells with counts 10-fold more from the Rat than the counts from Mouse were considered the Rat cells. The remaining cells were considered as the ambiguous and were excluded. As quality control, cells were included if they passed the following filters: 1) the percentage of counts from the mitochondrial genome was less than 10%, 2) the number of unique detected counts was more than the half and less than the two-fold of the average unique detected counts across the cells within the same sample. For chimera, quality control was performed based on the source of cell, 3) the ratio of log10-transformed number of detected genes and log10-transformed number of detected counts was higher than 0.85, 4) A potential 10% of doublets in sequencing data due to two cells are encapsulated in one reaction volume are detacted and filtered out by DoubletFinder (v2.0.3).50 In total, 30,070 out of 58,688 cells were used for the downstream integrated analysis by Seurat (v4.4.0),51 according to the recommended procedures.

Single-cell datasets over species were integrated by Seurat. Briefly, the features for homologous genes and genes with the same name between mice and rats were remained. In total, 16043 sharing gene features were used to combined single cells from WT mouse, WT rat and the and the three chimeras. The top 2000 high variable features were further identified by using the function FindVariableFeatures in the wild-type and the chimera, respectively. And the function FindIntegrationAnchors was used to identify anchor points with parameter dim=1:50, k.anchor = 20, and k.filter = 20. These anchors are common reference points between different species, and are used to integrate the whole single cell expression matrix by using IntegrateData function. Next, we computed cell similarity distances using the K-nearest neighbors algorithm and identified cell clusters by a shared nearest neighbor algorithm and visualized the data by UMAP.

For identifying cell types, we defined a set of marker genes for each cell type based on previously similar studies.5966 For Cajal-Retzius cells: LHX1, RELN, LHX5, GDF5, EBF3. For endothelial: CLDN5, FLT1, TEK. For Microglia: TMEM119, AIF1,CD53, CX3CR1. For neural stem cells (NSCs): FABP7, ALDOC, DBI, SLC1A3. For proliferating: TOP2A, PCNA. For Oligodendrocyte precursor cells (OPC) / Oligodendrocyte: OLIG1, OLIG2, PDGFRA, NEU4. For pericytes: KCNJ8, VTN, COL1A1. For subgroups of excitatory neuron (EX): EOMES, NEUROD6, MEF2C, SATB2, KCNIP4, UNC5C, LDB2, SCG2, TLE4, TBR1, RND2, SEMA3C. For subgroups of inhibitory neuron (IN): DLX1, HTR3A, LHX6, SIX3, RXRG, GPR88, ISL1.

To projection cells onto different brain regions, markers for brain regions were retrieved.67 For each cell, expression score was calculated for each region and the region with highest score was assigned to the cell.

The cell-cell interaction among all subgroups of EXs and INs was inferred from single-cell RNA-seq data using CellPhoneDB (v5.0.0) with the default parameters.52 The normalized counts were used as input for CellPhoneDB.

Differentially expressed genes analysis (DEGs)

A comparative analysis was conducted on the gene expression patterns in cell populations procured from wild-type mice and mouse cells derived from Hesx1−/−+rESCs chimeras. Initially, marker genes were identified within the wild-type mouse cells by selecting those with a log2(Fold-change) exceeding 0.25 and adjusted P-value less than 0.05. Subsequently, the expression patterns of these identified genes were examined in both the wild-type mouse cells and the cells from Hesx1−/−+rESCs chimeras. Utilizing the same methodology, the gene expression variations between the wild-type rat cells and the rat cells within the Hesx1−/−+rESCs chimera were compared.

Gene function annotation of differentially expressed genes

We calculated differentially expressed genes (DEGs) for each cell type between the chimeric mouse and control group. Genes with adjusted p-values less than 0.05 and absolute log2(Fold-Change) greater than 0.25 were selected as significantly different genes within each cell type. Then, functional annotation of differentially expressed genes in each cell type was performed using the enrichGO function from the clusterProfiler (v4.9.4).53 Clustered GO terms with significantly low p-values (<0.05) and a gene count greater than or equal to 5 were considered as functionally enriched entries. Then we computed the gene proportions for top 10 significant GO terms and visualized in Figures 6I and 6J.

Gene set enrichment analysis

We conducted gene set enrichment analysis (GSEA) on the top 10 ranked annotated GO terms in EXs and INs cell types in Hesx1−/−+rESCs chimera to analyze their regulation states by using DOSE(v3.26.2).54 Terms with p < 0.05 in GSEA were presented (Figures S5F and S5G).

Selection of gene set for comparative species analysis

List of homologous genes between Mouse (Mus musculus) and Rat (Rattus norvegicus) was downloaded from MGI Vertebrate Homology (http://www.informatics.jax.org/downloads/reports/HOM_AllOrganism.rpt). Those homologous genes between mouse and rat were used for the comparative species analysis as previously described.59

Annotation of brain region distribution of single cells

List of marker genes related to mouse brain regions were extracted from reference article Table S6.67 Then, the relative expression of each cell in different brain region marker gene sets is calculated through the AddModuleScore function in Seurat software. According to their expression levels, all cells were classified into different brain regions. Finally, the brain areas are categorized into four parts: Cortex, Cortes/Hippocampus, Hipppocampus, and Others (Figure S5D).

40 × read depth DNA Sequencing

The PCR products amplified from Mouse Hesx1 genomic sites of Hesx1−/−+rESCs chimeras were sequenced with average 40 folds data using 150bp paired-end Illumina Xten platform. Barcodes for demultiplexing:

Hesx1−/−+rESCs1#^GAATTCATCACGGGATCCACATATAAAATACTGCCACT;

Hesx1−/−+rESCs2#^GAATTCCGATGTGGATCCACATATAAAATACTGCCACT;

Hesx1−/−+rESCs3#^GAATTCTTAGGCGGATCCACATATAAAATACTGCCACT.

Sequencing reads were demultiplexed using cutadapt (v2.10).55 Alignment of amplicon sequences to a reference sequence was performed using CRISPResso2.56 For the quantification of editing efficiency, editing efficiency was calculated as: percentage of (number of modified reads) / (number of total reads). CRISPResso2 was run with default parameters except the ‘exclude_bp_from_left’ was set to zero.

Morris water maze (MWM)

In the preparation stage, the three lights on the wall of behavior laboratory were turned on, the escape platform remained in the center of one quadrant of the pool. The pool was filled with water that has a temperature of 20–23°C. To hide the platform, the platform was submerged below the water surface (0.5–1 cm) and soluble non-toxic white powder was added into the water. For learning stage (day 1 to 5), adult mice were placed in the pool facing the tank wall, each mouse was given 60s to swim to find the hidden platform. The mouse was allowed to stay there for 2s if it could find the platform. If the mice could not find the platform within 60s, they were transferred from the water to the platform. Each mouse completed four learning trails on day 1 to day 5, and each trail started from different orientations of the pool. To assess the spatial learning and memory, the platform was removed in the testing stage (day 6) and mice were placed in the quadrant opposite to the quadrant where the platform was located previously and given 60s to swim. Time spent and path length in each quadrant were recorded. The swim trajectory was recorded using water maze 5 software.

Contextual fear conditioning

Contextual fear conditioning was done as previously describe.32 Mice were placed in a system comprising four boxes that have iron cages and different contexts. All animals completed 2 trails (5 minutes per trial) each day and this task was repeated on three consecutive days. On day one, mice were placed in context A that was used for fear conditioning. After 180s, the mice were received the first foot shock (0.75mA, 180s), and the second foot shock was added 30s later. On day two, mice were placed in the context A again for 5 mins. On day three, mice were placed in context B for 5 mins. The boxes were cleaned with 70% ethanol before placing the mice. The movements were detected by the infrared sensors and the freezing behavior was recorded using FreezeFrame (4.07) software (Actimetrics).

Open-field assay

The open-field assay took place in a square, white Plexiglas box. Mice were placed in the arena and allowed to move freelyfor about 30 minutes while being recorded and analyzed by EthoVisonXT 11.5 (Noldus) for the following parameters: distance moved, velocity, and time spent in pre-defined zones.

AAV injection

The AAVs (serotype: AAV8) were injected into the ALM, similar to previously reported.30 In brief, mice were anaesthetized with isoflurane (R510–22, RWD) and the head was fixed on the stereotactic frame. After cutting the skin over the skull, a micropipette was advanced into the ALM (AP +2.3 mm, ML ±1.7 mm and DV −0.6 mm) using a micromanipulator and 0.1–0.2 μl AAV (AAV8-hSyn-EGFP-WPRE-pA, titer: 1 × 1013 vg/ml) in the micropipette were released. Two weeks later, brains were collected and sectioned for immunostaining and analysis.

Whole-Cell Patch-Clamp Recordings

Chimera mice (P13) were anesthetized with 1.5%–2.5% isoflurane, and immediately euthanized. The brain was dissected and coronally sectioned with 300 μm thickness in the ice-cold choline solution (in mM: 92 choline chloride, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 glucose, 5 sodium ascorbate, 2 thiourea, 3 sodium pyruvate, 10 MgSO4, 0.5 CaCl2, pH is 7.2~7.4, Osmolarity is 300~310 mOsm) using a vibratome (VT1000S, Leica). The brain slices were allowed to recover at 34 °C for 30 minutes in oxygenated (95% O2 and 5% CO2) HEPES holding solution (in mM: 86 NaCl, 2.5 KCl, 1.2 NaH2PO4, 35 NaHCO3, 20 HEPES, 25 glucose, 5 sodium ascorbate, 2 thiourea, 3 sodium pyruvate, 1 MgSO4, 2 CaCl2, pH is 7.2~7.4, Osmolarity is 290~300 mOsm). After recovery, brain slices were transferred into the recording chamber and perfused with oxygenated (95% O2 and 5% CO2) artificial cerebrospinal fluid (ACSF) solution (in mM: 119 NaCl, 2.5 KCl, 1 NaH2PO4, 26 NaHCO3, 1.3 sodium ascorbate, 25 glucose, 1.3 MgSO4, 2.5 CaCl2, pH is 7.2~7.3, Osmolarity is 290~300 mOsm) for 15–20 minutes at room temperature before recording. Rat and mouse cortical neurons were identified by the presence and absence of tdTomato fluorescence, respectively, and monitored with a camera (Qimaging). Whole-cell patch-clamp recordings were performed using a 40× objective under the Olympus microscope (BX51WIF). The recording electrodes were pulled from borosilicate glass (TW150F-3, Word Precision Instrument) using a micropipette puller (P-1000, Sutter Instrument), and the electrodes with resistance ranging from 6–8 MΩ were used for recordings. The recording electrodes were filled with intracellular solution (in mM: 135 K-gluconate, 5 KCl, 0.5 CaCl2, 5 EGTA, 5 HEPES, 5 MgATP, pH is 7.2~7.3, Osmolarity is 280~290 mOsm). Signals were acquired using a Multiclamp 700B amplifier (Molecular Devices). The data were low-pass filtered at 2 kHz, digitized at 10 kHz with an A/D converter (Digidata1550A, Molecular Devices), and stored using a data-acquisition program (Clampex version 10, Molecular Devices). After establishing the whole-cell recording mode, the resting membrane potential (RMP) was measured by immediately switching to the current-clamp configuration without current injection (I = 0 mode). The liquid junction potential of 15 mV was corrected for RMP. In the current-clamp mode, the holding current was injected into cells to maintain −70 mV membrane potential. A series of step currents (10 ms duration, 20 pA increase each step) were injected to induce a single action potential firing, and the rheobase was defined as the minimal current that induced the action potential firing. To determine the action potential firing rate, step currents (2 s duration, 10 pA increase each step) were injected. The input resistance was measured by injecting hyperpolarizing current (−20 pA) with 2 s duration.

QUANTIFICATION AND STATISTICAL ANALYSIS

All values are shown as mean ± s.e.m.. Unpaired Student’s t-tests (two tailed) were used to evaluate statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001). Randomization was used in all experiments. Data visualization and analysis were performed using GraphPad Prism versions 9.0 (GraphPad Software, La Jolla,CA) and Microsoft Excel (Microsoft 365). All of the statistical details of experiments can be found in the figure legends.

Supplementary Material

5

Table S5. Primers used for T7 transcription and genotyping, related to Figure 1

6

Table S6. Markers of brain region, related to Figure 1

2

Table S2. Analysis of guide RNA off-target effects, related to Figure 1

3

Table S3. The DEGs between chimera cells and WT cells, related to Figure 6H

1

Table S1. Summary of embryo transfer and newborn, related to Figures 1-3

4

Table S4. GO enrichment analysis of DEGs between chimera cells and WT cells, related to Figures 6I and 6J

f6. Figure S6. Similarity score, Pearson correlations and cell interaction across cell types in Hesx1−/−+rESCs chimeras, related to Figure 6.

(A) Similarity score across cell types in Hesx1−/−+rESCs chimeras, WT mouse and WT rat are as color-coded. The putative source of cells is as shape coded. WT, wildtype. EXP, Hesx1−/−+rESCs.

(B) Heatmaps showing Pearson correlations between cells of the indicated sources. Pearson correlation was calculated based on the normalized gene expression levels. WT, wildtype. EXP, Hesx1−/−+rESCs.

(C) Dot plot showing potential cell-cell interaction among chimera rat cells and chimera mouse cells. Strength of cell-cell interaction were color coded and dot size indicates the p-value of interaction.

f5. Figure S5. Integrated analysis for identifying cell types in Hesx1−/−+rESCs chimeras, related to Figure 6.

(A) Dot plot showing the expression of marker genes for different cell types. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(B) Quantification of the editing efficiency via deep sequencing analysis. The editing efficiency was calculated as: percentage of (number of modified reads) / (number of total reads). Hesx1 modified and unmodified reads were represented as blue and green, respectively.

(C) Stacked barplot showing the proportional representation of putative mouse/rat cells across cell types identified in 3 Hesx1−/−+rESCs chimeras. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(D) The spatial annotation of cells within WT mouse, Hesx1−/−+rESCs chimera and WT rat. Waffle plots showing putative regions for cells in WT mouse/rat and the chimera. The total number of cells within the cell type was encoded by the size of the dot, while the color encodes the putative source of cells. Each dot represents around 1% of the total number of cells within the indicated brain region.

(E) Stacked barplot showing compositions of cell populations among wild-type mouse/rat and the chimera. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(F) and (G) Gene Set Enrichment Analysis (GSEA) of pathways depicted in GO enrichment, revealing activation of some neural development-related pathways in mouse or rat cells within the chimeras. Terms with p < 0.05 in GSEA were presented.

f4. Figure S4. Chimeric contribution of rESCs in mice, related to Figure 3.

(A) Bright-field and fluorescence images of WT mice, WT+mESCs and Hesx1−/−+rESCs chimeras at P0.

(B) Images of brains from a WT mouse, WT+rESCs, and Hesx1−/−+rESCs chimeras at 10 weeks.

(C) Sagittal brain sections from WT+rESCs and Hesx1−/−+rESCs chimeras at 8 weeks. White dashed line, cortex; Scale bar, 1mm. F, Forebrain.

(D) Percentages of tdTomato+ rat cells in the indicated cortical layers between WT+rESCs and Hesx1−/−+rESCs chimeras (n = 12 slices from 3 chimeras per group). Unpaired t-tests.

(E) Representative images showing the contribution of tdTomato+ donor rESCs to the indicated non-brain organs in WT+rESCs and Hesx1−/−+rESCs chimeras (n = 3, 10 weeks of age). Red, rESC-derived cells; blue, DAPI. Scale bar, 100 μm.

(F) Schematic for the generation of dual-color-labelled Hesx1−/−+rESCs chimeras. Red, tdTomato+ donor rESCs; Green, EGFP+ Hesx1−/− host blastocyst.

(G) Representative images of WT mouse and dual-color-labelled Hesx1−/−+rESCs at P0.

(H) Single action potential of tdToamto+ and tdTomato cortical neurons was induced by a series of short step current injections (10 ms duration) to determine the rheobase.

(I)-(K) Representative immunohistochemical images of presynaptic (Syn) and postsynaptic (PSD-95) marker proteins in double-fluorescent Hesx1−/−+rESCs chimeras reveal interspecies or intraspecies synaptic connections. Red, tdTomato+ rESCs derived neurons; Green, Hesx1−/− mouse cells derived neurons; Magenta, Presynaptic protein Synaptophysin (Syn); Blue, Postsynaptic protein PSD-95. The white arrows indicate the close proximity of blue and magenta signals, which are showed in two adjacent cells. Scale bar, 5 μm.

(L) The quantification of the ratio of direct synaptic connections between adjacent cells among interspecies and intraspecies. Specific values are marked on the bar chart.

f3. Figure S3. Generation of a rat pancreas in mouse via CCBC, related to Figure 3.

(A) Macroscopic images showing a rESC-derived pancreas generated in Pdx1−/−+rESCs chimeras (n = 4) at 8 weeks of age.

(B) Quantification of pancreas complementation efficiency in Pdx1−/−+rESCs chimeras.

(C) Immunofluorescence images showing the distribution of rESC-derived cells in a reconstituted pancreas from Pdx1−/−+rESCs chimeras (n = 4 chimeras). Note that α-Amylase is a pancreatic exocrine marker, insulin and glucagon are pancreatic endocrine markers. Scale bar, 100 μm.

(D) Bright-field and fluorescence images showing WT mice and Dkk1−/−+rESCs partial reconstituted chimeras at P0.

(E) Bright-field images showing the head of a WT mice and a forebrain partial reconstituted Dkk1−/−+rESCs chimera.

f2. Figure S2. Dkk1−/−+mESCs chimeras are structurally and functionally normal, related to Figure 2 and Figure 4.

(A) Representative sagittal brain sections from WT+mESCs (upper, n = 4), Hesx1−/−+mESCs (middle, n = 4) and Dkk1−/−+mESCs (lower, n = 4) chimeras at 8 weeks of age. Yellow dashed line, cortex; white dashed line, hippocampus; green dashed line, midbrain. Scale bar, 200 μm.

(B) Quantification of donor ES cell contribution in WT+mESCs, Hesx1−/−+mESCs and Dkk1−/−+mESCs chimeras at 8 weeks of age. n = 4 for each group.

(C) Representative images of Dkk1−/−+mESCs chimeras (8 weeks of age).

(D) Bright-field and fluorescence images showing no obvious difference between the brains of Dkk1−/−+mESCs and WT+mESCs chimeras (10 weeks of age).

(E) Brain weight of Dkk1−/−+mESCs and WT+mESCs chimeras (n = 10, 10 weeks of age).

(F) Mean path length to platform for WT+mESCs (gray) or Dkk1−/−+mESCs (orange) chimeras in learning trials.

(G) Mean time ratio in the target quadrant for WT+mESCs (gray) and Dkk1−/−+mESCs (orange) chimeras in test trials.

(H) Contextual fear conditioning test of WT+rESCs (gray) and Dkk1−/−+mESCs (orange) chimeras.

(I) Open-field assay of WT+mESCs (gray) and Dkk1−/−+mESCs (orange) chimeras. For (F) to (I), n = 16 chimeras for each group. All values are presented as mean ± s.e.m.. *p < 0.05, **p < 0.01, ***p < 0.001, Unpaired t-test. ns, not significant.

f1. Figure S1. CCBC enables one-step generation of donor mESC-derived pancreatic tissue in Pdx1−/− mice, related to Figure 1.

(A) Schematic showing generation of pancreas reconstituted mice using CCBC. Cas9 mRNA and 4 sgRNAs targeting Pdx1 were co-injected into WT mouse (B6D2F1) zygotes. The compensated blastocysts could develop into normal individuals with an organ derived from tdTomato+ mESCs or rESCs.

(B) Design of 4 sgRNAs targeting Pdx1. Note that the PCR products of knockout blastocysts are about 200 bp shorter than that of WT.

(C) PCR-based genotyping of 4-cell embryos. Red asterisks indicate the Pdx1 knockout embryos.

(D) Photograph of newborn Pdx1−/− and WT mice at postnatal day (P) 2.

(E) Macroscopic images of stomach, spleen and pancreas in Pdx1−/− and WT mice at P2.

(F) Quantification of the efficiency of pancreas agenesis, showing that injection of Cas9 mRNA and 4 sgRNAs lead to the pancreas agenesis of all mice. Numbers above the bar indicates the number of mice.

(G) Representative images showing Pdx1−/−+mESCs mice (Pdx1−/−+mESCs, Pdx1−/− mice with mESC-derived pancreas) at P1. Note that the 4 mice on the left were pancreas-complemented, and the 2 mice on the right failed to develop a tdTomato+ mESC-derived pancreas.

(H) Representative images showing the reconstitution of pancreas in Pdx1−/−+mESCs chimeras at P1. Section of pancreas between stomach and spleen marked with green dashed lines. Note that the WT mouse has a normal pancreas, the Pdx1−/− mouse has no pancreas and the Pdx1−/−+mESCs chimera has a tdTomato labeled normal pancreas.

(I) Quantification of pancreas reconstitution efficiency in the Pdx1−/−+mESCs chimeras

(J) Macroscopic images showing the mESC-derived pancreases generated in Pdx1−/−+mESCs (n = 4 chimeras) and WT+mESCs (n = 3 chimeras) at 8 weeks of age.

(K) Immunofluorescence images showing the contribution of mESC-derived cells in a reconstituted pancreas (n = 6 chimeras). Note that α-Amylase is a pancreatic exocrine marker; insulin and glucagon are pancreatic endocrine markers. Scale bar, 100 μm.

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-Ctip2 (rat monoclonal) Abcam Cat# ab18465
Anti-RFP (rabbit polyclonal) Rockland Cat# 600401379
Anti-Alpha Amylase(rabbit polyclonal) Thermo Fisher Cat# PA5–51078
Anti-Insulin(rabbit polyclonal) Proteintech Cat# 15848–1-AP
Anti-Glucagon(rabbit polyclonal) Proteintech Cat# 15954–1-AP
Anti-Synaptotagmin-1 (rabbit mAb) Cell Signaling Technology Cat# 14558
Anti-PSD-95 (mouse monoclonal) Thermo Scientific Cat# MA1–046
Alexa Fluor Plus 405 Donkey anti-Mouse IgG (H+L) Invitrogen Cat# A48257
Alexa Fluo 647 Donkey anti-Rabbit IgG (H+L) Invitrogen Cat# A-31573
Alexa Fluor 488-AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Cat# 711545152
Alexa Fluor 488-AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Cat# 712545153
CyTM3-AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Cat# 111165003
Chemicals, Peptides, and Recombinant Proteins
Lipofectamine 3000 Transfection Reagent Life Technology Cat# L3000015
DPBS, no calcium, no magnesium Gibco Cat# 14190144
TRYPSIN 0.05% EDTA Gibco Cat# 25300054
Opti MEM Gibco Cat# 31985–070
DMEM/F12 Gibco Cat# 11330–032
KnockOut DMEM Gibco Cat# 10829–018
Neurobasal Gibco Cat# 21103–049
KnockOut Serum Replacement Gibco Cat# 10828028
Non-essential amino acids (NEAA) Millipore Cat# TMS-001-C
Penicillin/streptomycin Gibco Cat# 15070063
Nucleosides Millipore Cat# ES-008-D
L-Glutamine Gibco Cat# 25030081
β-mercaptoethanol Millipore Cat# ES-007-E
CHIR99021 Selleck Cat# S1263
PD035901 Selleck Cat# S1036
Mouse LIF Millipore Cat# ESG1107
Acid Tyrodes solution Sigma Cat# T1788–100ML
N-2 Supplement Gibco Cat# 17502048
B-27 Supplement Gbico Cat# 12587010
FBS Gibco Cat# 10099141
Rat LIF ESGRO Cat# ESG2206
Triton X-100 Amresco Cat# H2Q0212
Tween-20 Amresco Cat# H2T0301
KOD-plus-neo kit TOYOBO Cat# KOD-401
Proteinase K Thermo Fisher Cat# EO0491
Gel Extraction Kit Omega Cat# D2500–02
MMESSAGE MMACHINE T7 ULTRA Life Technology Cat# AM1345
MEGACLEAR KIT 20 RXNS Life Technology Cat# AM1908
MEGASHORTSCRIPT T7 KIT 25 RXNS Life Technology Cat# AM1354
Nuclease-Free Water Life Technology Cat# AM9930
PMSG Ningbo Sansheng Medicine Cat# S141004
HCG Ningbo Sansheng Medicine Cat# B141002
Cytochalasin B Sigma Cat# C6762
KSOM+AA with D-Glucose and Phenol Red Millipore Cat# MR-106-D
M2 Medium with Phenol Red Millipore Cat# MR-015-D
Polyvinylpyrrolidone Sigma Cat# 9003–39-8
Hyaluronidase Sigma Cat# H4272
Mineral oil Sigma Cat# M8410
TIANprep Rapid Mini Plasmid Kit TIANGEN Cat# DP105
Pregnant mare serum gonadotropin BioVendor R&D Cat# RP1782725000
Human chorionic gonadotropin BioVendor R&D Cat# RCD006R
Isoflurane RWD Cat# R510–22
Deposited Data
Rat and mouse chimera | RNA-seq datasets This paper GEO: GSE152126 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE152126)
Homologous genes between Mouse (Mus musculus) and Rat (Rattus norvegicus) MGI Vertebrate Homology http://www.informatics.jax.org/downloads/reports/HOM_AllOrganism.rpt
Rat and mouse chimera | Depth DNA sequencing data This paper BioProject: PRJNA649514 (https://www.ncbi.nlm.nih.gov/bioproject/)
Experimental Models: Cell lines
C57BL/6 ESCs This paper N/A
SD rat ESCs This paper N/A
Experimental Models: Organisms/Strains
Mouse: ICR (CD1) Envigo 030
Mouse: B6D2F1/J The Jackson Laboratory 100006
EGFP transgenic male mice The Jackson Laboratory 006567
Sprague-Dawley (SD) rat SLAC laboratory (Shanghai) N/A
Oligonucleotides
All primers used in this study were listed in the Table S5 This manuscript N/A
Recombinant DNA
PBL-CAG-tdTomato-PBR This paper N/A
CMV-Pbase This paper N/A
pX330-U6-Chimeric_BB-CBh-hSpCas9 Cong et al.43 pX330-U6-Chimeric_BB-CBh-hSpCas9; Addgene plasmid, Cat# 42230
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro Cong et al.43 pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro; Addgene plasmid, Cat#42229
Software and Algorithms
FreezeFrame (4.07) Actimetrics https://actimetrics.com/downloads/freezeframe/
EthoVisonXT 11.5 Noldus https://www.noldus.com/ethovision-xt
SolexaQA (V3.1.7.1) Cox et al.44 https://solexaqa.sourceforge.net/
Bwa-mem (0.7.16a) Li et al.45 https://bio-bwa.sourceforge.net/
GATK (4.0.12.0) GA et al.46 https://gatk.broadinstitute.org/hc/en-us
Cas-offinder Bae et al.47 http://www.rgenome.net/cas-offinder/
Bedtools(v2.29.2) A.R. et al.48 https://bedtools.readthedocs.io/en/latest/
Cell Ranger (v3.1; 10X Genomics) Zheng et al.49 https://www.10xgenomics.com/cn/support/software/cell-ranger/latest
DoubletFinder (v2.0.3) McGinnis et al.50 https://github.com/chris-mcginnis-ucsf/DoubletFinder
Seurat (v4.4.0) Hao et al.51 https://satijalab.org/seurat/
CellPhoneDB (v5.0.0) Efremova et al. 52 https://www.cellphonedb.org/
ClusterProfiler (v4.9.4) Wu et al. 53 https://github.com/GuangchuangYu/enrichment4GTEx_clusterProfiler
DOSE (v3.26.2) Yu et al. 54 http://www.bioconductor.org/packages/release/bioc/html/DOSE.html
Cutadapt (v2.10) Martin et al.55 https://cutadapt.readthedocs.io/en/stable/
CRISPResso2 Clement et al. 56 https://github.com/pinellolab/CRISPResso2
FlowJo BD FACS Aria II https://www.flowjo.com/solutions/flowjo/downloads
GraphPad Prism 9 GraphPad https://www.graphpad.com/scientific-software/prism/
Image J NIH Image https://imagej.net/NIH_Image

Highlights:

  • C-CRISPR enables quick candidate gene screening aiding blastocyst complementation

  • Mouse and rat ESCs can both complement Hesx1−/− forebrain agenesis in mice

  • Reconstituted rat forebrains in mice exhibit normal structure and function

  • Rat forebrains in mice develop at mouse rates with rat-specific gene expression

ACKNOWLEDGMENTS

We thank Dr. Mu-ming Poo for discussions and comments on the manuscript, and Optical Imaging facility Y. Wang, Y. Zhang and Q. Hu, and FACS facility S. Qian, H. Wu and L. Quan in ION. We also thank J. Du, M. Zhang, Z. Zhou, L. Zhang, Y.A. and Y. Zhao for technical assistance. This work was supported by NYSCF, NIH (HD103627–01A1), Welch (854671), R&D Program of China (2017YFC1001300 and 2018YFC2000100), CAS Strategic Priority Research Program (XDB32060000), National Natural Science Foundation of China (31871502, 31925016, 91957122, 31901047), Basic Frontier Scientific Research Program of Chinese Academy of Sciences. From 0 to 1 original innovation project (ZDBS-LY-SM001), Shanghai Municipal Science and Technology Major Project (2018SHZDZX05), Shanghai City Committee of Science and Technology Project (18411953700, 18JC1410100, 19XD1424400, 19YF1455100), and International Partnership Program of Chinese Academy of Sciences (153D31KYSB20170059). J.W. is a New York Stem Cell Foundation (NYSCF)–Robertson Investigator and Virginia Murchison Linthicum Scholar in Medical Research.

Footnotes

DECLARATION OF INTERESTS

The authors declare no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Wu J, Greely HT, Jaenisch R, Nakauchi H, Rossant J, and Belmonte JCI (2016). Stem cells and interspecies chimaeras. Nature 540, 51–59. 10.1038/nature20573. [DOI] [PubMed] [Google Scholar]
  • 2.Wu J, Platero-Luengo A, Sakurai M, Sugawara A, Gil MA, Yamauchi T, Suzuki K, Bogliotti YS, Cuello C, Morales Valencia M, et al. (2017). Interspecies Chimerism with Mammalian Pluripotent Stem Cells. Cell 168, 473–486.e415. 10.1016/j.cell.2016.12.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Isotani A, Hatayama H, Kaseda K, Ikawa M, and Okabe M (2011). Formation of a thymus from rat ES cells in xenogeneic nude mouse<-->rat ES chimeras. Genes Cells 16, 397–405. 10.1111/j.1365-2443.2011.01495.x. [DOI] [PubMed] [Google Scholar]
  • 4.Kobayashi T, Yamaguchi T, Hamanaka S, Kato-Itoh M, Yamazaki Y, Ibata M, Sato H, Lee YS, Usui J, Knisely AS, et al. (2010). Generation of rat pancreas in mouse by interspecific blastocyst injection of pluripotent stem cells. Cell 142, 787–799. 10.1016/j.cell.2010.07.039. [DOI] [PubMed] [Google Scholar]
  • 5.Zuo E, Cai YJ, Li K, Wei Y, Wang BA, Sun Y, Liu Z, Liu J, Hu X, Wei W, et al. (2017). One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs. Cell Res 27, 933–945. 10.1038/cr.2017.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zheng C, Ballard EB, and Wu J (2021). The road to generating transplantable organs: from blastocyst complementation to interspecies chimeras. Development 148. 10.1242/dev.195792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Garry DJ, and Garry MG (2019). Interspecies Chimeras and the Generation of Humanized Organs. Circ Res 124, 23–25. 10.1161/CIRCRESAHA.118.314189. [DOI] [PubMed] [Google Scholar]
  • 8.Kitahara A, Ran Q, Oda K, Yasue A, Abe M, Ye X, Sasaoka T, Tsuchida M, Sakimura K, Ajioka Y, et al. (2020). Generation of Lungs by Blastocyst Complementation in Apneumic Fgf10- Deficient Mice. Cell Rep 31, 107626. 10.1016/j.celrep.2020.107626. [DOI] [PubMed] [Google Scholar]
  • 9.Mori M, Furuhashi K, Danielsson JA, Hirata Y, Kakiuchi M, Lin CS, Ohta M, Riccio P, Takahashi Y, Xu X, et al. (2019). Generation of functional lungs via conditional blastocyst complementation using pluripotent stem cells. Nat Med 25, 1691–1698. 10.1038/s41591-019-0635-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chang AN, Liang Z, Dai HQ, Chapdelaine-Williams AM, Andrews N, Bronson RT, Schwer B, and Alt FW (2018). Neural blastocyst complementation enables mouse forebrain organogenesis. Nature 563, 126–130. 10.1038/s41586-018-0586-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sturzu AC, Rajarajan K, Passer D, Plonowska K, Riley A, Tan TC, Sharma A, Xu AF, Engels MC, Feistritzer R, et al. (2015). Fetal Mammalian Heart Generates a Robust Compensatory Response to Cell Loss. Circulation 132, 109–121. 10.1161/circulationaha.114.011490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Usui J, Kobayashi T, Yamaguchi T, Knisely AS, Nishinakamura R, and Nakauchi H (2012). Generation of kidney from pluripotent stem cells via blastocyst complementation. Am J Pathol 180, 2417–2426. 10.1016/j.ajpath.2012.03.007. [DOI] [PubMed] [Google Scholar]
  • 13.Stanger BZ, Tanaka AJ, and Melton DA (2007). Organ size is limited by the number of embryonic progenitor cells in the pancreas but not the liver. Nature 445, 886–891. 10.1038/nature05537. [DOI] [PubMed] [Google Scholar]
  • 14.Müller SM, Terszowski G, Blum C, Haller C, Anquez V, Kuschert S, Carmeliet P, Augustin HG, and Rodewald HR (2005). Gene targeting of VEGF-A in thymus epithelium disrupts thymus blood vessel architecture. Proc Natl Acad Sci U S A 102, 10587–10592. 10.1073/pnas.0502752102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wen B, Li E, Ustiyan V, Wang G, Guo M, Na CL, Kalin GT, Galvan V, Xu Y, Weaver TE, et al. (2021). In Vivo Generation of Lung and Thyroid Tissues from Embryonic Stem Cells Using Blastocyst Complementation. Am J Respir Crit Care Med 203, 471–483. 10.1164/rccm.201909-1836OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Miura K, Matoba S, Hirose M, and Ogura A (2021). Generation of chimeric mice with spermatozoa fully derived from embryonic stem cells using a triple-target CRISPR method for Nanos3dagger. Biol Reprod 104, 223–233. 10.1093/biolre/ioaa176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ran Q, Zhou Q, Oda K, Yasue A, Abe M, Ye X, Li Y, Sasaoka T, Sakimura K, Ajioka Y, and Saijo Y (2020). Generation of Thyroid Tissues From Embryonic Stem Cells via Blastocyst Complementation In Vivo. Front Endocrinol (Lausanne) 11, 609697. 10.3389/fendo.2020.609697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang X, Shi H, Zhou J, Zou Q, Zhang Q, Gou S, Chen P, Mou L, Fan N, Suo Y, et al. (2020). Generation of rat blood vasculature and hematopoietic cells in rat-mouse chimeras by blastocyst complementation. J Genet Genomics 47, 249–261. 10.1016/j.jgg.2020.05.002. [DOI] [PubMed] [Google Scholar]
  • 19.Zvick J, Tarnowska-Sengül M, Ghosh A, Bundschuh N, Gjonlleshaj P, Hinte LC, Trautmann CL, Noé F, Qabrati X, Domenig SA, et al. (2022). Exclusive generation of rat spermatozoa in sterile mice utilizing blastocyst complementation with pluripotent stem cells. Stem Cell Reports 17, 1942–1958. 10.1016/j.stemcr.2022.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hamanaka S, Umino A, Sato H, Hayama T, Yanagida A, Mizuno N, Kobayashi T, Kasai M, Suchy FP, Yamazaki S, et al. (2018). Generation of Vascular Endothelial Cells and Hematopoietic Cells by Blastocyst Complementation. Stem Cell Reports 11, 988–997. 10.1016/j.stemcr.2018.08.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Goto T, Hara H, Sanbo M, Masaki H, Sato H, Yamaguchi T, Hochi S, Kobayashi T, Nakauchi H, and Hirabayashi M (2019). Generation of pluripotent stem cell-derived mouse kidneys in Sall1-targeted anephric rats. Nat Commun 10, 451. 10.1038/s41467-019-08394-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kobayashi T, Goto T, Oikawa M, Sanbo M, Yoshida F, Terada R, Niizeki N, Kajitani N, Kazuki K, Kazuki Y, et al. (2021). Blastocyst complementation using Prdm14-deficient rats enables efficient germline transmission and generation of functional mouse spermatids in rats. Nat Commun 12, 1328. 10.1038/s41467-021-21557-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yamaguchi T, Sato H, Kato-Itoh M, Goto T, Hara H, Sanbo M, Mizuno N, Kobayashi T, Yanagida A, Umino A, et al. (2017). Interspecies organogenesis generates autologous functional islets. Nature 542, 191–196. 10.1038/nature21070. [DOI] [PubMed] [Google Scholar]
  • 24.Jonsson J, Carlsson L, Edlund T, and Edlund H (1994). Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371, 606–609. 10.1038/371606a0. [DOI] [PubMed] [Google Scholar]
  • 25.Fossat N, Ip CK, Jones VJ, Studdert JB, Khoo PL, Lewis SL, Power M, Tourle K, Loebel DA, Kwan KM, et al. (2015). Context-specific function of the LIM homeobox 1 transcription factor in head formation of the mouse embryo. Development 142, 2069–2079. 10.1242/dev.120907. [DOI] [PubMed] [Google Scholar]
  • 26.Lewis SL, Khoo P-L, Andrea De Young R, Bildsoe H, Wakamiya M, Behringer RR, Mukhopadhyay M, Westphal H, and Tam PPL (2007). Genetic interaction of Gsc and Dkk1 in head morphogenesis of the mouse. Mech Dev 124, 157–165. [DOI] [PubMed] [Google Scholar]
  • 27.Andoniadou CL, Signore M, Sajedi E, Gaston-Massuet C, Kelberman D, Burns AJ, Itasaki N, Dattani M, and Martinez-Barbera JP (2007). Lack of the murine homeobox gene Hesx1 leads to a posterior transformation of the anterior forebrain. Development 134, 1499–1508. 10.1242/dev.02829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mukhopadhyay M, Shtrom S, Rodriguez-Esteban C, Chen L, Tsukui T, Gomer L, Dorward DW, Glinka A, Grinberg A, Huang SP, et al. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Developmental cell 1, 423–434. [DOI] [PubMed] [Google Scholar]
  • 29.Oliver G, Mailhos A, Wehr R, Copeland NG, Jenkins NA, and Gruss P (1995). Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development (Cambridge, England) 121, 4045–4055. [DOI] [PubMed] [Google Scholar]
  • 30.Economo MN, Viswanathan S, Tasic B, Bas E, Winnubst J, Menon V, Graybuck LT, Nguyen TN, Smith KA, Yao Z, et al. (2018). Distinct descending motor cortex pathways and their roles in movement. Nature 563, 79–84. 10.1038/s41586-018-0642-9. [DOI] [PubMed] [Google Scholar]
  • 31.Kennedy A, Kunwar PS, Li LY, Stagkourakis S, Wagenaar DA, and Anderson DJ (2020). Stimulus-specific hypothalamic encoding of a persistent defensive state. Nature 586, 730–734. 10.1038/s41586-020-2728-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Boyce R, Glasgow SD, Williams S, and Adamantidis A (2016). Causal evidence for the role of REM sleep theta rhythm in contextual memory consolidation. Science 352, 812–816. 10.1126/science.aad5252. [DOI] [PubMed] [Google Scholar]
  • 33.Vorhees CV, and Williams MT (2006). Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc 1, 848–858. 10.1038/nprot.2006.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yamaguchi T, Sato H, Kobayashi T, Kato-itoh M, Goto T, Hara H, Mizuno N, Yanagida A, Umino A, Hamanaka S, et al. (2018). An interspecies barrier to tetraploid complementation and chimera formation. Scientific Reports 8, 15289. 10.1038/s41598-018-33690-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zheng C, Hu Y, Sakurai M, Pinzon-Arteaga CA, Li J, Wei Y, Okamura D, Ravaux B, Barlow HR, Yu L, et al. (2021). Cell competition constitutes a barrier for interspecies chimerism. Nature 592, 272–276. 10.1038/s41586-021-03273-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Nishimura T, Suchy FP, Bhadury J, Igarashi KJ, Charlesworth CT, and Nakauchi H (2021). Generation of Functional Organs Using a Cell-Competitive Niche in Intra- and Inter-species Rodent Chimeras. Cell Stem Cell 28, 141–149.e143. 10.1016/j.stem.2020.11.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Chen VS, Morrison JP, Southwell MF, Foley JF, Bolon B, and Elmore SA (2017). Histology Atlas of the Developing Prenatal and Postnatal Mouse Central Nervous System, with Emphasis on Prenatal Days E7.5 to E18.5. Toxicol Pathol 45, 705–744. 10.1177/0192623317728134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hu Y, Sun HX, Sakurai M, Jones AE, Liu L, Cheng T, Zheng C, Li J, Ravaux B, Luo Z, et al. (2023). RNA Sensing and Innate Immunity Constitutes a Barrier for Interspecies Chimerism. bioRxiv. 10.1101/2023.03.07.531624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zheng C, Hu Y, Sakurai M, Pinzon-Arteaga CA, Li J, Wei Y, Okamura D, Ravaux B, Barlow HR, Yu L, et al. (2021). Cell competition constitutes a barrier for interspecies chimerism. Nature 592, 272–276. 10.1038/s41586-021-03273-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Brown J, Barry C, Schmitz MT, Argus C, Bolin JM, Schwartz MP, Van Aartsen A, Steill J, Swanson S, Stewart R, et al. (2021). Interspecies chimeric conditions affect the developmental rate of human pluripotent stem cells. PLoS Comput Biol 17, e1008778. 10.1371/journal.pcbi.1008778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bayerl J, Ayyash M, Shani T, Manor YS, Gafni O, Massarwa R, Kalma Y, Aguilera-Castrejon A, Zerbib M, Amir H, et al. (2021). Principles of signaling pathway modulation for enhancing human naive pluripotency induction. Cell Stem Cell 28, 1549–1565.e1512. 10.1016/j.stem.2021.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Yu L, Wei Y, Sun HX, Mahdi AK, Pinzon Arteaga CA, Sakurai M, Schmitz DA, Zheng C, Ballard ED, Li J, et al. (2021). Derivation of Intermediate Pluripotent Stem Cells Amenable to Primordial Germ Cell Specification. Cell Stem Cell 28, 550–567.e512. 10.1016/j.stem.2020.11.003. [DOI] [PubMed] [Google Scholar]
  • 43.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, and Zhang F (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Cox MP, Peterson DA, and Biggs PJ (2010). SolexaQA: At-a-glance quality assessment of Illumina second-generation sequencing data. BMC Bioinformatics 11, 485. 10.1186/1471-2105-11-485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Li H, and Durbin R (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754–1760. 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Van der Auwera GA, Carneiro MO, Hartl C, Poplin R, Del Angel G, Levy-Moonshine A, Jordan T, Shakir K, Roazen D, Thibault J, et al. (2013). From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr Protoc Bioinformatics 43, 11.10.11–11.10.33. 10.1002/0471250953.bi1110s43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bae S, Park J, and Kim JS (2014). Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473–1475. 10.1093/bioinformatics/btu048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Quinlan AR, and Hall IM (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zheng GXY, Terry JM, Belgrader P, Ryvkin P, Bent ZW, Wilson R, Ziraldo SB, Wheeler TD, McDermott GP, Zhu J, et al. (2017). Massively parallel digital transcriptional profiling of single cells. Nature Communications 8, 14049. 10.1038/ncomms14049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.McGinnis CS, Murrow LM, and Gartner ZJ (2019). DoubletFinder: Doublet Detection in Single-Cell RNA Sequencing Data Using Artificial Nearest Neighbors. Cell Systems 8, 329–337.e324. 10.1016/j.cels.2019.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hao Y, Hao S, Andersen-Nissen E, Mauck WM 3rd, Zheng S, Butler A, Lee MJ, Wilk AJ, Darby C, Zager M, et al. (2021). Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587.e3529. 10.1016/j.cell.2021.04.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Efremova M, Vento-Tormo M, Teichmann SA, and Vento-Tormo R (2020). CellPhoneDB: inferring cell–cell communication from combined expression of multi-subunit ligand–receptor complexes. Nature Protocols 15, 1484–1506. 10.1038/s41596-020-0292-x. [DOI] [PubMed] [Google Scholar]
  • 53.Wu T, Hu E, Xu S, Chen M, Guo P, Dai Z, Feng T, Zhou L, Tang W, Zhan L, et al. (2021). clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. The Innovation 2, 100141. 10.1016/j.xinn.2021.100141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yu G, Wang L-G, Yan G-R, and He Q-Y (2015). DOSE: an R/Bioconductor package for disease ontology semantic and enrichment analysis. Bioinformatics 31, 608–609. 10.1093/bioinformatics/btu684. [DOI] [PubMed] [Google Scholar]
  • 55.Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17, 10–12. [Google Scholar]
  • 56.Clement K, Rees H, Canver MC, Gehrke JM, Farouni R, Hsu JY, Cole MA, Liu DR, Joung JK, Bauer DE, and Pinello L (2019). CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat Biotechnol 37, 224–226. 10.1038/s41587-019-0032-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Buehr M, Meek S, Blair K, Yang J, Ure J, Silva J, McLay R, Hall J, Ying QL, and Smith A (2008). Capture of authentic embryonic stem cells from rat blastocysts. Cell 135, 1287–1298. 10.1016/j.cell.2008.12.007. [DOI] [PubMed] [Google Scholar]
  • 58.Li H (2013). Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. Quantitative Biology. [Google Scholar]
  • 59.Butler A, Hoffman P, Smibert P, Papalexi E, and Satija R (2018). Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol 36, 411–420. 10.1038/nbt.4096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Mizrak D, Levitin HM, Delgado AC, Crotet V, Yuan J, Chaker Z, Silva-Vargas V, Sims PA, and Doetsch F (2019). Single-Cell Analysis of Regional Differences in Adult V-SVZ Neural Stem Cell Lineages. Cell Rep 26, 394–406.e395. 10.1016/j.celrep.2018.12.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Loo L, Simon JM, Xing L, McCoy ES, Niehaus JK, Guo J, Anton ES, and Zylka MJ (2019). Single-cell transcriptomic analysis of mouse neocortical development. Nat Commun 10, 134. 10.1038/s41467-018-08079-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Lim L, Mi D, Llorca A, and Marín O (2018). Development and Functional Diversification of Cortical Interneurons. Neuron 100, 294–313. 10.1016/j.neuron.2018.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Haure-Mirande JV, Audrain M, Fanutza T, Kim SH, Klein WL, Glabe C, Readhead B, Dudley JT, Blitzer RD, Wang M, et al. (2017). Deficiency of TYROBP, an adapter protein for TREM2 and CR3 receptors, is neuroprotective in a mouse model of early Alzheimer’s pathology. Acta Neuropathol 134, 769–788. 10.1007/s00401-017-1737-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Dai J, Bercury KK, Ahrendsen JT, and Macklin WB (2015). Olig1 function is required for oligodendrocyte differentiation in the mouse brain. J Neurosci 35, 4386–4402. 10.1523/jneurosci.4962-14.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Imura T, Kornblum HI, and Sofroniew MV (2003). The predominant neural stem cell isolated from postnatal and adult forebrain but not early embryonic forebrain expresses GFAP. J Neurosci 23, 2824–2832. 10.1523/jneurosci.23-07-02824.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM 3rd, Hao Y, Stoeckius M, Smibert P, and Satija R (2019). Comprehensive Integration of Single-Cell Data. Cell 177, 1888–1902.e1821. 10.1016/j.cell.2019.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Zeisel A, Hochgerner H, Lönnerberg P, Johnsson A, Memic F, van der Zwan J, Häring M, Braun E, Borm LE, La Manno G, et al. (2018). Molecular Architecture of the Mouse Nervous System. Cell 174, 999–1014.e1022. 10.1016/j.cell.2018.06.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

5

Table S5. Primers used for T7 transcription and genotyping, related to Figure 1

6

Table S6. Markers of brain region, related to Figure 1

2

Table S2. Analysis of guide RNA off-target effects, related to Figure 1

3

Table S3. The DEGs between chimera cells and WT cells, related to Figure 6H

1

Table S1. Summary of embryo transfer and newborn, related to Figures 1-3

4

Table S4. GO enrichment analysis of DEGs between chimera cells and WT cells, related to Figures 6I and 6J

f6. Figure S6. Similarity score, Pearson correlations and cell interaction across cell types in Hesx1−/−+rESCs chimeras, related to Figure 6.

(A) Similarity score across cell types in Hesx1−/−+rESCs chimeras, WT mouse and WT rat are as color-coded. The putative source of cells is as shape coded. WT, wildtype. EXP, Hesx1−/−+rESCs.

(B) Heatmaps showing Pearson correlations between cells of the indicated sources. Pearson correlation was calculated based on the normalized gene expression levels. WT, wildtype. EXP, Hesx1−/−+rESCs.

(C) Dot plot showing potential cell-cell interaction among chimera rat cells and chimera mouse cells. Strength of cell-cell interaction were color coded and dot size indicates the p-value of interaction.

f5. Figure S5. Integrated analysis for identifying cell types in Hesx1−/−+rESCs chimeras, related to Figure 6.

(A) Dot plot showing the expression of marker genes for different cell types. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(B) Quantification of the editing efficiency via deep sequencing analysis. The editing efficiency was calculated as: percentage of (number of modified reads) / (number of total reads). Hesx1 modified and unmodified reads were represented as blue and green, respectively.

(C) Stacked barplot showing the proportional representation of putative mouse/rat cells across cell types identified in 3 Hesx1−/−+rESCs chimeras. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(D) The spatial annotation of cells within WT mouse, Hesx1−/−+rESCs chimera and WT rat. Waffle plots showing putative regions for cells in WT mouse/rat and the chimera. The total number of cells within the cell type was encoded by the size of the dot, while the color encodes the putative source of cells. Each dot represents around 1% of the total number of cells within the indicated brain region.

(E) Stacked barplot showing compositions of cell populations among wild-type mouse/rat and the chimera. INs, inhibitory neuron; EXs, excitatory neuron; OPCs, oligodendrocyte progenitor cells; NSC, neural stem cell.

(F) and (G) Gene Set Enrichment Analysis (GSEA) of pathways depicted in GO enrichment, revealing activation of some neural development-related pathways in mouse or rat cells within the chimeras. Terms with p < 0.05 in GSEA were presented.

f4. Figure S4. Chimeric contribution of rESCs in mice, related to Figure 3.

(A) Bright-field and fluorescence images of WT mice, WT+mESCs and Hesx1−/−+rESCs chimeras at P0.

(B) Images of brains from a WT mouse, WT+rESCs, and Hesx1−/−+rESCs chimeras at 10 weeks.

(C) Sagittal brain sections from WT+rESCs and Hesx1−/−+rESCs chimeras at 8 weeks. White dashed line, cortex; Scale bar, 1mm. F, Forebrain.

(D) Percentages of tdTomato+ rat cells in the indicated cortical layers between WT+rESCs and Hesx1−/−+rESCs chimeras (n = 12 slices from 3 chimeras per group). Unpaired t-tests.

(E) Representative images showing the contribution of tdTomato+ donor rESCs to the indicated non-brain organs in WT+rESCs and Hesx1−/−+rESCs chimeras (n = 3, 10 weeks of age). Red, rESC-derived cells; blue, DAPI. Scale bar, 100 μm.

(F) Schematic for the generation of dual-color-labelled Hesx1−/−+rESCs chimeras. Red, tdTomato+ donor rESCs; Green, EGFP+ Hesx1−/− host blastocyst.

(G) Representative images of WT mouse and dual-color-labelled Hesx1−/−+rESCs at P0.

(H) Single action potential of tdToamto+ and tdTomato cortical neurons was induced by a series of short step current injections (10 ms duration) to determine the rheobase.

(I)-(K) Representative immunohistochemical images of presynaptic (Syn) and postsynaptic (PSD-95) marker proteins in double-fluorescent Hesx1−/−+rESCs chimeras reveal interspecies or intraspecies synaptic connections. Red, tdTomato+ rESCs derived neurons; Green, Hesx1−/− mouse cells derived neurons; Magenta, Presynaptic protein Synaptophysin (Syn); Blue, Postsynaptic protein PSD-95. The white arrows indicate the close proximity of blue and magenta signals, which are showed in two adjacent cells. Scale bar, 5 μm.

(L) The quantification of the ratio of direct synaptic connections between adjacent cells among interspecies and intraspecies. Specific values are marked on the bar chart.

f3. Figure S3. Generation of a rat pancreas in mouse via CCBC, related to Figure 3.

(A) Macroscopic images showing a rESC-derived pancreas generated in Pdx1−/−+rESCs chimeras (n = 4) at 8 weeks of age.

(B) Quantification of pancreas complementation efficiency in Pdx1−/−+rESCs chimeras.

(C) Immunofluorescence images showing the distribution of rESC-derived cells in a reconstituted pancreas from Pdx1−/−+rESCs chimeras (n = 4 chimeras). Note that α-Amylase is a pancreatic exocrine marker, insulin and glucagon are pancreatic endocrine markers. Scale bar, 100 μm.

(D) Bright-field and fluorescence images showing WT mice and Dkk1−/−+rESCs partial reconstituted chimeras at P0.

(E) Bright-field images showing the head of a WT mice and a forebrain partial reconstituted Dkk1−/−+rESCs chimera.

f2. Figure S2. Dkk1−/−+mESCs chimeras are structurally and functionally normal, related to Figure 2 and Figure 4.

(A) Representative sagittal brain sections from WT+mESCs (upper, n = 4), Hesx1−/−+mESCs (middle, n = 4) and Dkk1−/−+mESCs (lower, n = 4) chimeras at 8 weeks of age. Yellow dashed line, cortex; white dashed line, hippocampus; green dashed line, midbrain. Scale bar, 200 μm.

(B) Quantification of donor ES cell contribution in WT+mESCs, Hesx1−/−+mESCs and Dkk1−/−+mESCs chimeras at 8 weeks of age. n = 4 for each group.

(C) Representative images of Dkk1−/−+mESCs chimeras (8 weeks of age).

(D) Bright-field and fluorescence images showing no obvious difference between the brains of Dkk1−/−+mESCs and WT+mESCs chimeras (10 weeks of age).

(E) Brain weight of Dkk1−/−+mESCs and WT+mESCs chimeras (n = 10, 10 weeks of age).

(F) Mean path length to platform for WT+mESCs (gray) or Dkk1−/−+mESCs (orange) chimeras in learning trials.

(G) Mean time ratio in the target quadrant for WT+mESCs (gray) and Dkk1−/−+mESCs (orange) chimeras in test trials.

(H) Contextual fear conditioning test of WT+rESCs (gray) and Dkk1−/−+mESCs (orange) chimeras.

(I) Open-field assay of WT+mESCs (gray) and Dkk1−/−+mESCs (orange) chimeras. For (F) to (I), n = 16 chimeras for each group. All values are presented as mean ± s.e.m.. *p < 0.05, **p < 0.01, ***p < 0.001, Unpaired t-test. ns, not significant.

f1. Figure S1. CCBC enables one-step generation of donor mESC-derived pancreatic tissue in Pdx1−/− mice, related to Figure 1.

(A) Schematic showing generation of pancreas reconstituted mice using CCBC. Cas9 mRNA and 4 sgRNAs targeting Pdx1 were co-injected into WT mouse (B6D2F1) zygotes. The compensated blastocysts could develop into normal individuals with an organ derived from tdTomato+ mESCs or rESCs.

(B) Design of 4 sgRNAs targeting Pdx1. Note that the PCR products of knockout blastocysts are about 200 bp shorter than that of WT.

(C) PCR-based genotyping of 4-cell embryos. Red asterisks indicate the Pdx1 knockout embryos.

(D) Photograph of newborn Pdx1−/− and WT mice at postnatal day (P) 2.

(E) Macroscopic images of stomach, spleen and pancreas in Pdx1−/− and WT mice at P2.

(F) Quantification of the efficiency of pancreas agenesis, showing that injection of Cas9 mRNA and 4 sgRNAs lead to the pancreas agenesis of all mice. Numbers above the bar indicates the number of mice.

(G) Representative images showing Pdx1−/−+mESCs mice (Pdx1−/−+mESCs, Pdx1−/− mice with mESC-derived pancreas) at P1. Note that the 4 mice on the left were pancreas-complemented, and the 2 mice on the right failed to develop a tdTomato+ mESC-derived pancreas.

(H) Representative images showing the reconstitution of pancreas in Pdx1−/−+mESCs chimeras at P1. Section of pancreas between stomach and spleen marked with green dashed lines. Note that the WT mouse has a normal pancreas, the Pdx1−/− mouse has no pancreas and the Pdx1−/−+mESCs chimera has a tdTomato labeled normal pancreas.

(I) Quantification of pancreas reconstitution efficiency in the Pdx1−/−+mESCs chimeras

(J) Macroscopic images showing the mESC-derived pancreases generated in Pdx1−/−+mESCs (n = 4 chimeras) and WT+mESCs (n = 3 chimeras) at 8 weeks of age.

(K) Immunofluorescence images showing the contribution of mESC-derived cells in a reconstituted pancreas (n = 6 chimeras). Note that α-Amylase is a pancreatic exocrine marker; insulin and glucagon are pancreatic endocrine markers. Scale bar, 100 μm.

Data Availability Statement

  • The RNA-seq datasets generated in this study have been deposited in the NCBI Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo) under accession number GSE152126.The deep sequencing data have been deposited in the BioProject (BioProject;https://www.ncbi.nlm.nih.gov/bioproject/) under accession number PRJNA649514.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.

RESOURCES