Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Nov 22;104(1):104581. doi: 10.1016/j.psj.2024.104581

Reducing the dietary starch:protein ratios in low-protein diets enhanced the growth performance of goslings from 1 to 28 days of age

Xucheng Zheng a, Qian Lu a, Chunhui Huang a, Usman Nazir a, Zhi Yang b, Haiming Yang a, Zhiyue Wang a,
PMCID: PMC11647613  PMID: 39622092

Abstract

The current study aimed to explore the suitable starch: protein ratios under different dietary protein levels for goslings. A total of 360 male 1-day-old Jiangnan White goslings were randomly divided into 6 groups with six replicates containing ten goslings each. The experimental design consisted of a 3 × 2 factorial array of treatments. Three protein levels (18%, 16%, 14%) and two starch: protein ratio (S: P ratio) types (standard, reduced) were formulated. The results showed that: reducing the S: P ratio at the same dietary protein level increased weight gain (WG), average daily gain (ADG), and average daily feed intake (ADFI) of goslings (P < 0.05). Lowering the protein level increased feed-to- gain ratio (F/G) at the same dietary S: P ratio type. Both decreasing dietary protein levels and reducing S: P resulted in an increase (P < 0.05) in the serum albumin (ALB) content of goslings. Protein at 18% level, minimized serum total cholesterol (TC) in goslings. Reducing the dietary S: P ratio elevated serum lipid concentration. In reduced S: P ratio diets, serum Leucine (Leu) decreased and Threonine (Thr) concentration increased. The reduction in dietary protein level and S: P ratio significantly affected the amino acid composition of muscles. The varied levels of protein and S: P ratio types interacted to influence the starch digestibility of distal jejunum. In addition, the reduced S: P ratio attenuates α-amylase activity of jejunal chyme. Moreover, SGLT1 and GLUT2 genes expression were generally down-regulated, and SLC7A5 gene expression was up-regulated in reduced S: P ratio groups. In summary, the diet with 14% protein level, and 2.97 starch: protein ratio is recommended to use in gosling's growth phase of 1 to 28 days.

Keywords: Gosling, Low-protein diet, Starch: protein ratio, Growth performance, Amino acid

Introduction

Currently, the shortage of high-quality raw protein sources poses a challenge to the feed industry, and their increased prices reduced the economic efficiency of farming (Mottet et al., 2017). Although, high-protein diets cause more nitrogen deposition, leading to environmental pollution (Hernandez et al., 2012). Anyhow, soybean meal is the most essential and economic protein source for poultry production, making up at least 25% of the feed. As a result, developing low-protein diets is imperative. Nowadays, The basic idea behind the development of low-protein diets is to reduce the amount of soybean meal and add exogenous nutrients to the diet, such as amino acids, proteases, etc. (Selle et al., 2020; Wang et al., 2020). Liang et al. (2023) found that lowering the dietary protein level from 18.55% to 15.55% and supplementing with 12 essential amino acids, did not negatively affect growth performance of 1-28 d goslings, but their nitrogen excretion reduced by 19.71%. The result indicated that the low protein level in the diet of goslings that can meet the growth and development of goslings may not only be 15.55%, but might be further reduced. In addition, several experiments on broilers (Son et al., 2003; Kobayashi et al., 2012) and ducks (Xie et al., 2016; Jiang et al., 2017) have sufficiently demonstrated the feasibility of low-protein diets.

When dietary soybean meal content is reduced, the grain (corn or wheat) inclusions increase in the diet, which inevitably increases the starch: protein ratio. It definitely affects the digestive dynamics of starch and protein causing more fat deposition (Liu et al., 2017). There were similar findings in the two broiler experiments as Capping the S: P ratio from 1.97 to 1.63 in diets (CP, 19.75%) for Ross 308 chicks from 7-35 d increased weight gain by 10.37% (Greenhalgh et al., 2020). Moreover, Limiting dietary S: P ratios improved weight gain, and the effect was most pronounced at a 17.5% protein level (Greenhalgh et al., 2022). The following two experiments validate that reducing starch content (S: P ratio) in low-protein diets suits growth performance. The success of reducing the dietary S: P ratio might be associated with the decreased starch digestibility and slower disappearance rate of starch in the small intestine.

Excess starch in low-protein diets breaks down more glucose in the intestine, and overloaded glucose disrupts amino acid absorption (Selle et al., 2019). As a result, both glucose and amino acids can break down to provide energy for the intestines. Generally, glucose contains a higher energy supply efficiency than amino acids. The digestive dynamics of starch and protein is, to control the decomposition of glucose and amino acids so that more glucose is available to supply energy in the intestines. So, more amino acids pass through the intestinal mucosa and enter the portal vein to synthesize body proteins. Competitive uptake of glucose and amino acids may occur when both are absorbed along the small intestine (Murer et al., 1975). This may be due to competition between glucose and amino acids uptake via their respective Na+-dependent transporters in intestine (Macelline et al., 2020). Most of the glucose is absorbed from the intestinal lumen with Na+ through the SGLT1 transporter, while the GLUT2 transporter transfers glucose from the basolateral channel of enterocytes into the portal circulation (Daniel et al., 2015).

The primary purpose of the present study was to explore the effects of reducing the dietary starch: protein ratio at different protein levels on the growth performance and intestinal starch digestion of goslings and to preliminarily explore whether this strategy will cause competition for intestinal uptakes between glucose and amino acids or not.

Materials and methods

All animal care and experimental procedures in the study were performed according to the Regulations for the Administration of Affairs Concerning Experimental Animals of the People's Republic of China and approved by the Animal Care and Use Committee of Yangzhou University Yangzhou, China (SYXK (Su) IACUC 2021-0036).

Experimental diets and design

Total 360 male 1-day-old Jiangnan White goslings, supplied by the Jiangsu Lihua Animal Husbandry Co., LTD (Changzhou, China), were randomly divided into six groups with six replicates and each replicate containing ten goslings. The experiment designed as 3 × 2 factorial array of dietary treatments, as outlined in Table 1. Three protein levels (18%, 16%, 14%) and two starch: protein ratio types (standard, reduced) were formulated. There is a standard S: P ratio for every protein level., and every standard ratio was lowered by 9% to obtain the corresponding reduced S: P ratio. All the diets were formulated to the same energy density (AME=11.5 MJ/kg). The dietary composition and nutrient levels were shown in Table 2. The group with a protein level of 18% and an S: P ratio of 2.27 was the control group of this experiment, which can basically meet the growth and physiological needs of goslings.

Table 1.

Outline of dietary treatments.

Diet Description
CP/starch: protein ratio
CP level (%) Starch: protein ratio
A High protein/standard 18 2.27
B Medium protein/standard 16 2.70
C Low protein/standard 14 3.26
D High protein/reduced 18 2.06
E Medium protein/reduced 16 2.47
F Low protein/reduced 14 2.97

Note: Starch: protein ratio is calculated value.

Table 2.

Composition and nutrient levels of experimental diets for 1-28 d goslings.

Items Treatments1
A B C D E F
Ingredients, %
Corn 62.31 65.35 68.56 53.95 57.30 60.95
Soybean meal 29.27 23.28 17.30 28.62 22.38 16.94
Wheat bran 2.57 4.88 7.02 9.74 12.64 12.87
Rice hull 2.16 2.21 2.24 2.06 1.44 2.45
Limestone 0.90 0.95 1.00 0.94 0.98 1.01
CaHPO4 1.27 1.27 1.27 1.22 1.21 1.22
Salt 0.30 0.30 0.30 0.30 0.30 0.30
Soy oil 0.00 0.00 0.00 1.90 1.95 1.95
L-lysine HCl 0.03 0.17 0.31 0.03 0.17 0.30
DL-methionine 0.19 0.22 0.25 0.20 0.22 0.25
L-leucine 0.00 0.15 0.31 0.04 0.19 0.34
L-threonine 0.00 0.08 0.17 0.00 0.09 0.17
L-tryptophan 0.00 0.03 0.06 0.00 0.03 0.05
L-valine 0.00 0.11 0.21 0.00 0.10 0.20
Permix2 1.00 1.00 1.00 1.00 1.00 1.00
Total 100.00 100.00 100.00 100.00 100.00 100.00
Nutrient levels3, %
Metabolizable energy (MJ/Kg) 11.55 11.49 11.45 11.43 11.41 11.41
Crude protein 18.11 16.08 13.99 18.07 16.06 14.07
Starch 41.10 43.28 45.53 37.19 39.67 41.84
Starch: protein ratio 2.27 2.70 3.26 2.06 2.47 2.97
Crude fiber 4.28 4.17 4.04 4.47 4.10 4.32
Calcium 0.82 0.82 0.82 0.82 0.81 0.82
Available phosphorus 0.38 0.38 0.38 0.38 0.38 0.38
Lysine 0.97 0.99 1.00 0.95 0.96 0.99
Methionine 0.48 0.47 0.49 0.48 0.46 0.47
Leucine 1.59 1.60 1.61 1.58 1.62 1.60
Threonine 0.68 0.69 0.65 0.66 0.67 0.67
Tryptophan 0.20 0.22 0.23 0.19 0.21 0.21
Valine 0.85 0.87 0.86 0.85 0.88 0.86
1

A: High protein, Standard S: P ratio; B: Medium protein, Standard S: P ratio; C: Low protein, Standard S: P ratio; D: High protein, Reduced S: P ratio; E: Medium protein, Reduced S: P ratio; F: Low protein, Reduced S: P ratio.

2

The premix supplied per kilogram of diet: vitamin A, 12000 IU; vitamin D3, 4000 IU; vitamin E, 28 mg; vitamin K3, 1.5 mg; vitamin B1, 0.9 mg; vitamin B2, 8 mg; vitamin B6, 3.2 mg; vitamin B12, 0.01 mg; nicotinic acid, 45 mg; pantothenic acid, 11 mg; folic acid, 0.65 mg; choline chloride, 0.45g; biotin, 0.05 mg; Fe, 60 mg; Cu, 10 mg; Mn, 95 mg; Zn, 90 mg; I, 0.5 mg; Se, 0.3 mg.

3

Analyzed values except for Metabolizable energy, calcium and available phosphorus.

The goslings were raised on plastic nets for the whole experiment period (single pen area: 1.9 m × 1.5 m, 2.85 m2), and the stocking density of goslings from 1 to 14 d was 10/m2, and 4/m2 from 15 to 28 d. The ambient temperature decreased with the age of the goslings (1 to 7d, 28−30°C 7 to 14 d, 26−28°C; 15 to 28 d, 24−26°C). Birds were provided with unlimited water and feed under natural light.

Data and sample collection, chemical analyses, calculations

Growth performance

All goslings were weighed at 1 d and 28 d to calculate WG and ADG. The feed intake of geese was counted weekly to calculate the average daily feed intake and F/G.

Serum biochemical indicators

5 mL of blood was collected from the brachial vein of goslings before slaughter and centrifuged at 3500 rmp for 10 min to produce serum samples. Serum samples were stored at -20°C for determination of serum biochemical indexes. Total protein (TP), albumin (ALB), globulin (GLB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-c (HDL-c), low-density lipoprotein-c (LDL-c), creatinine (CREA), urea nitrogen (UREA) and glucose (GLU) were analyzed with the use of Hitachi 7600 Automatic Biochemistry Analyzer (Hitachi High-Tech Corporation, Tokyo, Japan).

Amino acid content

Serum and muscle amino acid content were measured according to GB 5009.124-2016 and Liang et al. (2023) method. Methionine content was determined by oxidative hydrolysis, and other free amino acids (alanine, glycine, glutamate, arginine, lysine, isoleucine, histidine, phenylalanine, tyrosine, Leucine, proline, serine, threonine, aspartate, valine) content were analyzed by acid hydrolysis.

Apparent starch digestibility

Starch digestibility in the intestine was analyzed by following Khoddami et al. (2017). In brief, at 28 day, after slaughtering, the abdominal cavities opened, and the small intestine was removed. The jejunum and ileum was separated and collected the chyme part from the distal jejunum and distal ileum with a 1.5 mL enzyme-free tube. The chyme was mixed, freeze-dried, grounded, and then weighed to measure the apparent starch digestibility coefficient-determination of starch concentration in feed and chyme by polarimetry. Titanium dioxide (TiO2) was used as an inert marker, and the additional amount in the feed was 0.5%. The content of TiO2 was determined by spectrophotometry, as described in Short et al. (1996). The apparent digestibility coefficient and disappearance rate of starch were calculated using the following formulas.

Apparent starch digestibility = 100- [(C1 × C2)/ (C3 × C4)] × 100
  • C1: starch content in chyme;

  • C2: dietary TiO2 content;

  • C3: dietary starch content;

  • C4:TiO2 content in chyme.

Enzyme activity

α-amylase and maltase activities of intestinal chyme were measured using kits (Nanjing Jincheng Bioengineering Institute, Nanjing, China). The two kits were mentioned as C016-1-1 and A082-3-1, respectively.

Relative gene mRNA expression

The kits for total RNA extraction, reverse transcription, and real-time PCR analysis were purchased from Yeasen Biotechnology (Shanghai) Co., Ltd. Briefly, total RNA was extracted from jejunal mucosal tissue according to the method provided by the manufacturer. RNA integrity was verified by determining RNA concentration and by 1% agar gel electrophoresis. Extracted RNA was diluted with sterile, enzyme-free water to maintain a consistent RNA concentration for each sample. Afterward, the total RNA from each sample was reverse-transcribed into cDNA using a reverse transcription system. The melt curve stage was programmed using the default settings of Applied Biosystems: 7500. The primer sequences used in this study are listed in Table 3. The β-action gene was used as the internal reference gene. All samples contained 3 biological replicates, and the results were analyzed using ΔCt values and the results were calculated by the 2-ΔΔCt method and expressed as the mean value.

Table 3.

Primers used in real-time quantitative PCR.

Gene name Primer sequence (5´-3´) Product size (bp) Gene Bank NO./Reference
SGLT-1 F: CTTATGCCAAATGGTCTGCGAG 174 MG925328.1
R: CATAAATGCCCTTCCAGCCAAC
GLUT-2 F: GATGGTCCAGATATCCCAGCAG 106 MG925329.1
R: AATGGTTGCATAAACGGGTTGG
SLC7A5 F: GCTTCTCACTCCTGTGCCAT 188 XM_013197556.2
R: TCACCTTGATGGGCCTTTCC
SLC6A14 F: TCACCTACCAGAACGGTGGA 163 XM_013183397.2
R: ACGCCCACTCCTTGAAACAA
SLC38A1 F: AGCTTGGTGAGCAGGTCTTT 123 XM_013198961.2
R: TGGCAGAAGGCAGCTCATTT
β-action F: GAAATCGTGCGTGACATCAA 198 XM_013174886.1
R: GCAGGACTCCATACCCAAGA

Statistical analysis

The results were statistically analyzed by one-way ANOVA (analysis of variance) and General Linear Model (GLM) using SPSS 26.0 (SPSS, Inc., Chicago, IL) software, and LSD was applied for multiple comparisons. The data was presented as the mean values and the standard error of the means (SEM). Differences were considered statistically significant at P < 0.05. The figures were created using Graph-Pad Prism 8 (Graph Pad Software Inc., San Diego, CA) software.

Results

Growth performance

The effect of reducing the S: P ratios at different protein levels on the growth performance of 28-day-old goosling is shown in Table 4. Lowering the protein level increased FCR at the same dietary S: P ratio type (P < 0.05), and also there was a trend toward increased ADFI (P>0.05). Conversely, reducing the S: P ratio at the same dietary protein level led to a significant increase in body weight, WG, ADG, and ADFI of 28-day-old goslings (P < 0.05).

Table 4.

Effect of different dietary treatments on growth performance of goslings from 1 d to 28d.

Items CP (%) S: P ratio 28 d weight (g) ADG (g) ADFI (g) FCR
A 18 2.27 (Standard) 1763.52 59.97 116.96 1.95
B 16 2.70 (Standard) 1713.53 58.19 115.00 1.98
C 14 3.26 (Standard) 1739.86 59.12 120.72 2.04
D 18 2.06 (Reduced) 1795.85 61.13 118.50 1.94
E 16 2.47 (Reduced) 1797.30 61.18 123.70 2.02
F 14 2.97 (Reduced) 1762.35 59.93 120.51 2.01
SEM 8.074 0.167 9.497 0.010
CP 18 1779.68 60.55 117.73 1.95a
16 1755.42 59.68 119.35 2.00b
14 1751.11 59.53 120.61 2.03b
S: P ratio Standard 1738.97a 59.09a 117.56a 1.99
Reduced 1785.17b 60.74b 120.90b 1.99
P-value CP 0.203 0.203 0.119 0.001
S: P ratio 0.002 0.002 0.005 0.974
Interaction 0.164 0.164 0.006 0.133

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Serum biochemical indicators content

Serum biochemical indicators are shown in Table 5. Decreasing dietary protein levels and reducing the S: P ratio resulted in an increase (P < 0.05) in serum's ALB content. The ALB/GLB ratio was significantly higher (P < 0.05) at 14% than 18% of the protein level. However, a protein level of 18% resulted in a reduced serum TC content in 28-day-old goslings (P < 0.05). Reducing the dietary S: P ratio was associated with elevated serum TC, HDL-C, and LDL-C levels (P < 0.05), and decreased CREA-S levels (P < 0.05).

Table 5.

Effect of different dietary treatments on serum biochemical indicators of goslings at 28 d.

Items CP (%) S: P ratio TP
(g/L)
ALB
(g/L)
GLB
(g/L)
GLU (mmol/L) TC (mmol/L) TG (mmol/L) HDL-c (mmol/L) LDL-c (mmol/L) CREA-S (μmol/L) UREA (mmol/L)
A 18 2.27 (Standard) 40.85 7.59 32.77 12.66 3.25 2.68 1.45 1.64 12.83 1.83
B 16 2.70 (Standard) 42.60 8.82 33.78 12.24 3.41 2.75 1.69 1.75 16.17 1.50
C 14 3.26 (Standard) 40.78 9.00 31.78 11.94 3.45 2.84 1.65 1.73 14.60 1.52
D 18 2.06 (Reduced) 40.00 8.75 31.58 11.39 3.39 2.56 1.82 1.85 14.50 1.65
E 16 2.47 (Reduced) 43.28 9.78 34.10 12.71 3.87 3.48 1.77 2.14 12.80 1.60
F 14 2.97 (Reduced) 42.90 9.75 33.15 10.52 3.74 3.08 1.70 1.90 11.67 1.80
SEM 0.265 0.063 0.670 0.218 0.492 0.167 0.039 0.047 0.418 0.060
CP 18 40.43 8.16b 32.18 12.02 3.32b 2.62 1.63 1.74 13.67 1.74
16 42.94 9.30a 33.94 12.48 3.64a 3.12 1.73 1.94 14.48 1.55
14 41.84 9.38a 32.47 11.23 3.59a 3.18 1.68 1.81 13.13 1.66
S: P ratio Standard 41.41 8.47b 32.78 12.28 3.37b 2.76 1.60b 1.70b 14.53a 1.62
Reduced 42.06 9.43a 32.94 11.54 3.67a 3.19 1.76a 1.96a 12.99b 1.68
P-value CP 0.337 0.024 0.328 0.142 0.047 0.327 0.573 0.153 0.318 0.435
S: P ratio 0.642 0.018 0.870 0.147 0.012 0.207 0.028 0.004 0.038 0.591
Interaction 0.680 0.905 0.585 0.245 0.496 0.506 0.150 0.521 0.011 0.294

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Serum amino acid concentration

Table 6 shows the effect of reducing the S: P ratios at different protein levels on serum amino acid concentration. Changes in dietary protein levels did not have a significant effect on the concentration of 16 amino acids in serum (P > 0.05). However, differences were observed for Leucine and Threonine, whereas the concentrations of both amino acids increased in diets with reduced S: P ratios (P < 0.05).

Table 6.

Effect of different dietary treatments on serum animo acid content of goslings at 28 d. (nmol/L)

Items CP (%) S: P ratio Ala Gly Glu Arg Lys Ile His Phe Met Tyr Leu Pro Ser Thr Asp Val
A 18 2.27 (Standard) 20.02 16.72 38.51 12.06 22.00 9.66 6.02 10.90 14.74 9.57 22.75 15.78 19.81 15.81 26.92 15.79
B 16 2.70 (Standard) 21.14 16.65 40.10 12.63 23.37 10.17 6.24 11.50 14.97 9.94 23.25 16.50 20.91 15.53 28.05 16.65
C 14 3.26 (Standard) 19.08 14.92 37.79 11.71 22.02 9.61 5.85 10.54 15.14 9.27 21.50 15.46 19.01 16.11 26.00 15.36
D 18 2.06 (Reduced) 20.02 15.54 38.40 11.96 22.58 10.04 5.83 10.80 15.08 9.38 21.47 15.49 19.01 17.77 26.42 15.65
E 16 2.47 (Reduced) 19.75 15.62 37.65 11.94 21.62 9.76 5.75 10.41 15.28 9.16 21.35 15.28 18.63 17.29 25.85 15.36
F 14 2.97 (Reduced) 19.83 15.54 38.74 12.15 22.57 10.16 6.07 10.70 15.08 9.47 20.58 15.48 19.49 16.65 26.92 15.79
SEM 0.366 0.364 0.607 0.208 0.362 0.179 0.112 0.192 0.234 0.159 0.331 0.272 0.362 0.230 0.460 0.309
CP 18 20.02 16.13 38.46 12.01 22.29 9.85 5.93 10.85 14.91 9.47 22.11 15.64 19.41 16.79 26.67 15.72
16 20.45 16.13 38.89 12.89 22.50 9.96 6.00 10.96 15.12 9.55 22.30 15.89 19.77 16.41 26.95 16.01
14 19.46 15.23 38.26 11.93 22.30 9.89 5.96 10.62 15.11 9.37 21.04 15.47 19.25 16.38 26.46 15.58
S: P ratio Standard 20.08 16.10 38.80 12.13 22.47 9.81 6.04 10.98 14.95 9.59 22.50a 15.91 19.91 15.82b 26.99 15.93
Reduced 19.87 15.57 38.27 12.02 22.26 9.99 5.89 10.64 15.14 9.34 21.13b 15.42 19.04 17.24a 26.40 15.60
P-value CP 0.583 0.542 0.926 0.795 0.970 0.970 0.969 0.781 0.926 0.913 0.240 0.838 0.842 0.639 0.920 0.865
S: P ratio 0.784 0.489 0.680 0.796 0.782 0.646 0.527 0.396 0.705 0.455 0.039 0.395 0.248 0.001 0.543 0.615
Interaction 0.528 0.565 0.561 0.596 0.374 0.559 0.493 0.422 0.937 0.503 0.818 0.663 0.335 0.295 0.437 0.568

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Muscle amino Acid Content

Tables 7 and 8 shows the effect of reducing the S: P ratios at different protein levels on the amino acid content in breast and leg muscle. A reduction in dietary protein levels led to a decrease in Thr content in the breast muscle, as well as Ala, Glu, Tyr, Pro, and Thr content in the leg muscle (P < 0.05). Conversely, Thr content in breast muscle, and the Glu, Tyr, and Thr content in leg muscle increased in those group that fed reduced S: P ratio diets (P < 0.05).

Table 7.

Effect of different dietary treatments on breast muscle animo acid content of goslings at 28 d. (%)

Items CP (%) S: P ratio Ala Gly Glu Arg Lys Ile His Phe Met Tyr Leu Pro Ser Thr Asp Val
A 18 2.27 (Standard) 0.80 0.96 2.02 0.94 1.10 0.62 0.31 0.67 0.21 0.40 1.03 0.54 0.54 0.59 1.20 0.62
B 16 2.70 (Standard) 0.77 0.85 2.02 0.91 1.10 0.61 0.32 0.66 0.22 0.39 1.01 0.51 0.55 0.58 1.15 0.61
C 14 3.26 (Standard) 0.66 0.90 2.09 0.90 1.06 0.58 0.32 0.66 0.22 0.40 0.98 0.56 0.51 0.54 1.14 0.62
D 18 2.06 (Reduced) 0.66 0.97 2.11 0.91 1.03 0.58 0.31 0.64 0.21 0.38 0.98 0.56 0.51 0.63 1.15 0.59
E 16 2.47 (Reduced) 0.70 0.94 2.06 0.90 1.02 0.58 0.31 0.62 0.22 0.37 0.97 0.55 0.51 0.61 1.19 0.58
F 14 2.97 (Reduced) 0.82 1.04 1.98 0.93 1.07 0.58 0.31 0.64 0.22 0.37 0.99 0.57 0.53 0.60 1.19 0.62
SEM 0.021 0.029 0.026 0.014 0.017 0.008 0.004 0.011 0.003 0.005 0.012 0.008 0.008 0.007 0.011 0.009
CP 18 0.73 0.96 2.06 0.92 1.06 0.60 0.31 0.66 0.21 0.39 1.00 0.55 0.52 0.61a 1.17 0.60
16 0.73 0.90 2.04 0.90 1.06 0.59 0.31 0.64 0.22 0.38 0.99 0.53 0.53 0.59ab 1.16 0.59
14 0.74 0.97 2.03 0.91 1.06 0.58 0.31 0.65 0.22 0.39 0.99 0.57 0.52 0.57b 1.17 0.62
S: P ratio Standard 0.74 0.90 2.04 0.91 1.08 0.60 0.32 0.67 0.21 0.39 1.00 0.54 0.53 0.57b 1.16 0.62
Reduced 0.73 0.98 2.05 0.91 1.04 0.58 0.30 0.63 0.22 0.38 0.98 0.56 0.52 0.61a 1.18 0.60
P-value CP 0.974 0.562 0.905 0.806 0.996 0.655 0.876 0.858 0.750 0.824 0.877 0.146 0.981 0.021 0.933 0.464
S: P ratio 0.719 0.198 0.901 0.985 0.202 0.231 0.126 0.135 0.824 0.094 0.379 0.117 0.271 0.001 0.583 0.321
Interaction 0.011 0.649 0.293 0.730 0.592 0.575 0.987 0.926 0.935 0.952 0.577 0.610 0.254 0.648 0.137 0.872

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Table 8.

Effect of different dietary treatments on leg muscle animo acid content of goslings at 28 d. (%)

Items CP (%) S: P ratio Ala Gly Glu Arg Lys Ile His Phe Met Tyr Leu Pro Ser Thr Asp Val
A 18 2.27 (Standard) 1.16 0.90 2.81 1.28 1.73 1.02 0.63 1.00 0.30 0.62 1.65 0.69 0.75 0.89 1.80 1.06
B 16 2.70 (Standard) 1.05 0.85 2.44 1.25 1.68 0.94 0.60 0.89 0.30 0.56 1.57 0.59 0.73 0.81 1.72 0.96
C 14 3.26 (Standard) 1.13 0.86 2.70 1.24 1.68 0.98 0.60 0.97 0.28 0.57 1.60 0.63 0.75 0.89 1.75 1.00
D 18 2.06 (Reduced) 1.14 0.84 3.04 1.25 1.68 0.98 0.55 0.98 0.31 0.70 1.63 0.65 0.81 1.06 1.68 1.00
E 16 2.47 (Reduced) 1.09 0.85 2.83 1.22 1.63 0.95 0.62 0.96 0.29 0.64 1.57 0.62 0.75 0.91 1.74 0.99
F 14 2.97 (Reduced) 1.13 0.86 2.81 1.25 1.69 0.97 0.65 0.96 0.30 0.59 1.60 0.65 0.75 0.90 1.76 1.02
SEM 0.013 0.014 0.042 0.008 0.012 0.009 0.011 0.013 0.004 0.011 0.012 0.009 0.010 0.016 0.022 0.012
CP 18 1.15a 0.87 2.93a 1.26 1.71 1.00 0.59 0.99 0.31 0.66a 1.64 0.67a 0.78 0.97a 1.74 1.03
16 1.09b 0.85 2.64b 1.23 1.65 0.95 0.61 0.93 0.29 0.60b 1.57 0.61b 0.74 0.86b 1.73 0.97
14 1.13ab 0.86 2.76b 1.25 1.68 0.97 0.62 0.96 0.29 0.58b 1.60 0.64ab 0.75 0.89b 1.76 1.01
S: P ratio Standard 1.11 0.87 2.65b 1.25 1.70 0.98 0.61 0.95 0.29 0.58b 1.61 0.64 0.74 0.86b 1.76 1.00
Reduced 1.12 0.85 2.89a 1.24 1.67 0.97 0.61 0.97 0.30 0.64a 1.60 0.64 0.77 0.95a 1.73 1.00
P-value CP 0.028 0.865 0.003 0.261 0.192 0.069 0.438 0.107 0.164 <0.001 0.076 0.012 0.251 <0.001 0.887 0.182
S: P ratio 0.715 0.596 0.001 0.322 0.185 0.509 0.825 0.496 0.237 <0.001 0.831 0.705 0.128 <0.001 0.498 0.820
Interaction 0.638 0.652 0.216 0.510 0.481 0.411 0.032 0.281 0.205 0.218 0.968 0.119 0.402 0.010 0.409 0.308

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Starch digestibility and starch-digesting enzyme activity

Outcomes related to starch digestibility and activity of starch-digesting enzyme in the distal jejunum and distal ileum are presented in Table 9. The interaction between protein levels and and S: P ration significantly increased starch digestibility (P < 0.001). A reduction in the S: P ratio resulted in a 7.31% decrease in starch digestibility in the jejunum (P < 0.001). Furthermore, lowering the S: P ratio diminished α-amylase activity in jejunal chyme (P < 0.05). Conversely, maltase activity showed a slight increase in both intestinal tracts when fed diets with reduced S: P ratios; however, these differences were not statistically significant (P > 0.05).

Table 9.

Effect of dietary treatments on the starch digestibility of distal jejunum & ileum and the activity of starch digestive enzymes in chyme of goslings at 28 d.

Items CP (%) S: P ratio Distal jejunum
Distal ileum
Digestibility
(%)
α-amylase (U/mg) Maltase (U/mg) Digestibility
(%)
α-amylase (U/mg) Maltase (U/mg)
A 18 2.27 (Standard) 84.85 198.38 462.11 93.02 370.29 696.19
B 16 2.70 (Standard) 86.86 189.16 468.03 92.45 382.57 588.12
C 14 3.26 (Standard) 86.11 201.66 473.18 92.84 314.96 618.24
D 18 2.06 (Reduced) 82.19 176.81 526.10 92.43 370.73 691.43
E 16 2.47 (Reduced) 78.55 153.86 472.43 93.61 406.01 663.68
F 14 2.97 (Reduced) 75.25 155.05 499.59 92.64 381.41 693.75
SEM 0.648 6.205 0.648 0.238 12.977 0.238
CP 18 83.52 187.60 494.25 92.73 370.51 695.31
16 82.80 171.51 470.23 93.03 394.29 625.90
14 82.18 178.36 486.38 92.74 348.19 656.00
S: P ratio Standard 85.94a 196.40a 467.87 92.77 355.94 634.18
Reduced 79.66b 161.91b 499.37 92.90 386.05 683.95
P-value CP 0.141 0.522 0.655 0.838 0.367 0.468
S: P ratio <0.001 0.005 0.155 0.790 0.259 0.283
Interaction <0.001 0.673 0.533 0.298 0.584 0.729

Note: a,bMeans with different superscripts within the same row differ significantly (P< 0.05).

Relative gene mRNA expression

The relative mRNA expression of glucose and amino acid transporter genes is shown in Fig. 1. In groups with a reduced S: P ratio, the expression of the SGLT1 and GLUT2 genes was generally down-regulated, while the expression of the SLC7A5 gene was up-regulated (P < 0.05).

Fig. 1.

Fig. 1

Relative gene expression of glucose and amino acid transport carriers

Note: A: High protein, Standard S:P ratio; B: Medium protein, Standard S:P ratio; C: Low protein, Standard S:P ratio;D: High protein, ReducedS:P ratio; E: Medium protein, Reduced S:P ratio; F: Low protein, Reduced S:P ratio. a, bMeans with different superscripts within the same row differ significantly (P< 0.05).

Discussion

Generally, varied levels of dietary protein affects feed intake and FCR. High-protein diets reduce FCR by decreasing feed intake. In this experiment, when the dietary protein level was reduced from 18% to 14%, the FCR was elevated by 4.1%. Similar results were observed in geese diets with low-protein levels (Liang et al., 2023; Ho et al., 2015). However, it is not consistent. Abou-Kassem et al. (2019) research was inconsistent with the above; when the protein level was reduced from 22% to 18.05%, FCR was decreased from 2.91 to 2.58. Moreover, a previous study found no effect of different dietary protein levels on average daily feed intake and feed conversion ratio of fattening Turkey geese (Sahin et al., 2008). The all above researches revealed that feed protein levels have a variable effect on FCR in geese, and it is hypothesized that this might be related to breed, age, and feed formulation. In the following study the remarkable result is that, lowering the 10% S: P ratio of the diets at the same protein level improved body weight gain. The reason may be the lower digestibility and slower disappearance rate of starch in the jejunum, resulting in more starch entering the ileum to be hydrolyzed into glucose, followed by glucose breakdown for intestinal energy supply (Selle et al., 2019). The conclusions of the two experiments by Greenhalgh et al. (2020, 2022) are restrictive; that is, the dietary protein level should be reasonable. When protein levels were too low, broilers showed poor growth performance, whether fed on a standard or a reduced S: P ratio diet. However, in the present experiment, even if the protein was reduced to 14%, the growth performance of goslings was not affected, this might be attributed to the supplementation of amino acids. Moreover, one difference between geese and broilers is that goose is herbivorous, and its response to protein concentration is less sensitive than that of broiler. This aspect may explain why lowering dietary protein levels did not affect body weight gain in this experiment.

When the diet's corn (starch) content was reduced, soybean oil was preferred to provide energy to keep every group's energy levels consistent. It should be known that the energy density of oil is much higher than corn, and its energy supply efficiency is higher than that of starch, which might be helpful for geese to achieve better growth performance (Palmquist et al., 1980). However, starch, as the primary energy source, cannot be replaced by fat. Excessive oil in the ration may decrease the feed intake of geese (Martinez et al., 1995) and slowdowns the emptying procedure of the chyme in intestine. To minimize the effect of soybean oil in the experiment, it is necessary to control the starch-to-lipid ratio (Khoddami., 2018). Therefore, the amount of soybean oil added to all reduced diets did not exceed 2%, and the changes in blood lipid indexes might be associated to additional soybean oil.

As feed moves through the digestive system, it subjected to various physical and chemical processes. After feeding on starch, it initially digested by oral salivary amylase, softened by crop mucus, mixed by the glandular stomach in the crop, and grounded by muscles. Then, it enters the small intestine in close contact with digestive fluid. Through the action of α-amylase, straight-chain starches hydrolyzed into maltose and maltotriose, and some branched-chain starches decomposed into maltose, maltotriose, and α-dextrin (Wiseman, 2006). Other branched-chain starches require further degradation of the α-1,6 glycosidic bond of α-dextrin by isomaltase released from the brush border membrane on the surface of the small intestine (Tester et al., 2003). These disaccharides hydrolyzed ultimately into monosaccharides by oligosaccharides and eventually converted into glucose, which is absorbed by the intestinal wall into the bloodstream and participates in body metabolism (Svihus, 2014; Nichols et al., 2003). The primary site of starch digestion in geese is the small intestine. It was reported that about 65% of the starch is digested till it reaches the end of the duodenum, 85% at the end of the jejunum, and 97% at the end of the ileum (Riesenfeld et al., 1980). Outcomes presented that reducing the S: P ratios in diets resulted in a 17.56% attenuation of α-amylase activity in the jejunum, a trend consistent with changes in starch digestibility. Amylase activity positively correlates with the amount of starch consumed (Huntingtin, 1997). The diminished starch content of the diet made it less necessary for the digestive tract to secrete as much amylase to digest the starch.

In the early growth of Jiangnan White Goose, the development of leg muscles is faster than that of breast muscles. Therefore, more amino acids will be transported from the liver to the leg muscles through the blood to synthesize protein. If the blood amino acids change, the amino acid composition of the leg muscles will be affected more than that of the breast muscles. Gene expression of the glucose transporter vectors SGLT1 and GLUT2 was down-regulated, whereas gene expression of the amino acid transporter vector SCL7A5 was up-regulated in the reduced S: P diets. In short, we speculate that there was a competitive relationship between glucose and amino acids, and more amino acids enter the portal vein, which may elucidate why the content of some amino acids in muscles, especially in leg muscles, was increased.

In addition, some branched-chain amino acids such as leucine and threonine will affect the growth rate of intestinal cells and the activity of digestive enzymes. When the absorption of intestinal amino acids is affected, the activity of starch-digest enzymes will also change (Cao et al., 2018; Yu et al., 2013). On the one hand, leucine and threonine, as substrates of protein synthesis, regulate the expression of relevant functional proteins and the synthesis of functional enzymes in the digestive system, and therefore, affect the growth rate of intestinal cells and digestive enzyme activity (Yang et al., 2019; Zhang et al., 2017). On the other hand, as energy donors for intestinal epithelial cells, leucine, and threonine can affect the proliferation of intestinal epithelial cells (Guo et al., 2018).

Conclusion

Reducing the starch: protein ratio of the diet has been shown to improve growth performance of goslings. This improvement might be attributed to slower starch digestibility, which allows more amino acids pass through the intestinal mucosa due to competition with glucose. This factor is significant and should not be overlooked. Based on this study, it is recommended to use a diet with an energy density of 11.5 MJ/kg, a protein level of 14%, and a starch: protein ratio of 2.97 for goslings from 1 to 28 days of age.

Declaration of AI and AI-assisted technologies in the writing process

During the preparation of this work the author used Grammarly in order to improve readability and language. After using Grammarly, the author reviewed and edited the content as needed and takes full responsibility for the content of the publication.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Zhiyue Wang reports financial support was provided by CARS-42-11. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgement

This work was financially supported by the earmarked fund for CARS-42-11 and the dedicated fund for Jiangsu Postgraduates' Practical Innovation Plan (SJCX22_1797).

Footnotes

Scientific Section: Poultry Nutrition and Metabolism

References

  1. Abou-Kassem D.E., Ashour E.A., Alagawany M., Alagawany M., Mahrose K.M., Rehman Z.U., Ding C. Effect of feed form and dietary protein level on growth performance and carcass characteristics of growing geese. Poult. Sci. 2019;98:761–771. doi: 10.3382/ps/pey445. [DOI] [PubMed] [Google Scholar]
  2. Cao Y., Liu S., Yang X., Guo L., Cai C., Yao J. Effects of dietary leucine and phenylalanine on pancreas development, enzyme activity, and relative gene expression in milk-fed Holstein dairy calve. J. Dairy Sci. 2018;101:4235–4424. doi: 10.3168/jds.2017-13987. [DOI] [PubMed] [Google Scholar]
  3. Daniel H., Zietek T. Taste and move: glucose and peptide transporters in the gastrointestinal tract. Exp. Physiol. 2015;100:1441–1450. doi: 10.1113/EP085029. [DOI] [PubMed] [Google Scholar]
  4. Greenhalgh S., Chrystal P.V., Lemme A., Dorigam J.C.D., Macelline S.P., Liu S.Y., Selle P.H. Capping dietary starch: protein ratios enhances performance of broiler chickens offered reduced-crude protein, maize-based diets. Anim. Feed. Sci. Tech. 2022;290 [Google Scholar]
  5. Greenhalgh S., Mcinerney B.V., Mcquade L.R., Chrystal P.V., Khoddami A., Zhuang M.A.M. Capping dietary starch: protein ratios in moderately reduced crude protein, wheat-based diets showed promise but further reductions generated inferior growth performance in broiler chickens. Anim. Nutr. 2020;6:168–178. doi: 10.1016/j.aninu.2020.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Guo L., Liang Z., Zheng C., Liu B., Yin Q., Cao Y., Yao J.H. Leucine affects α-amylase synthesis through pi3k/akt-mtor signaling pathways in pancreatic acinar cells of dairy calves. J. Agric. Food Chem. 2018;66:5149–5156. doi: 10.1021/acs.jafc.8b01111. [DOI] [PubMed] [Google Scholar]
  7. Hernandez F., Lopez M., Martinez S., Megias M.D., Catala P., Madrid J. Effect of low-protein diets and single sex on production performance, plasma metabolites, digestibility, and nitrogen excretion in 1- to 48-day-old broilers. Poult. Sci. 2012;91:683–692. doi: 10.3382/ps.2011-01735. [DOI] [PubMed] [Google Scholar]
  8. Huntingtin G.B. Starch utilization by ruminants: from basics to the bulk. J. Anim. Sci. 1997;75:852–867. doi: 10.2527/1997.753852x. [DOI] [PubMed] [Google Scholar]
  9. Ho S.Y., Chen Y.H., Yang S.K. Effects of sequential feeding with low- and high-protein diets on growth performances and plasma metabolite levels in geese. Animal. 2015;9:952–957. doi: 10.1017/S1751731114003267. [DOI] [PubMed] [Google Scholar]
  10. Jiang J., Tang J., Xie M., Wen Z.G., Qiao S.Y., Hou S.S. Threonine supplementation reduces dietary protein and improves lipid metabolism in Pekin Ducks. Br. Poult. Sci. 2017;58:687–693. doi: 10.1080/00071668.2017.1363871. [DOI] [PubMed] [Google Scholar]
  11. Khoddami A., Chrystal P.V., Selle P.H., Liu L.Y., Cristina Óvilo. Dietary starch to lipid ratios influence growth performance, nutrient utilisation and carcass traits in broiler chickens offered diets with different energy densities. PLoS. One. 2018;13 doi: 10.1371/journal.pone.0205272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kobayashi H., Nakashima K., Ishida A., Ashihara A., Katsumata M. Effects of low protein diet and low protein diet supplemented with synthetic essential amino acids on meat quality of broiler chickens. Anim. Sci. J. 2012;84:489–495. doi: 10.1111/asj.12021. [DOI] [PubMed] [Google Scholar]
  13. Liang Y.Q., Zheng X.C., Wang J., Yang H.M., Wang Z.Y. Different amino acid supplementation patterns in low-protein diets on growth performance and nitrogen metabolism of goslings from 1 to 28 days of age. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Liu S.Y., Selle P.H. Starch and protein digestive dynamics in low-protein diets supplemented with crystalline amino acids. Anim. Prod. Sci. 2017;57 2250—6. [Google Scholar]
  15. Macelline S.P., McQuade L.R., Mclnerney B.V., Moss A.F., Selle P.H., Liu S.Y. Protein digestive dynamics of meat and bone meals in broiler chickens. Anim. Nutr. 2020;6:521–528. doi: 10.1016/j.aninu.2020.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Martinez V., Jimenez M., Gonalons E., Vergara P. Intraluminal lipids modulate avian gastrointestinal motility. Am. J. Physiol. 1995;269:R445–R452. doi: 10.1152/ajpregu.1995.269.2.R445. [DOI] [PubMed] [Google Scholar]
  17. Mottet A., Haan C.D., Falcucci A., Tempio G., Opio C., Gerber P. Livestock: on our plates or eating at our table? A new analysis of the feed/food debate. Glob. Food Secur.-Agr. 2017;14:1–8. [Google Scholar]
  18. Murer H., Sigrist-Nelson K., Hopfer U. On the mechanism of sugar and amino acid interaction in intestinal transport. J. Biol. Chem. 1975;250:7392–7396. [PubMed] [Google Scholar]
  19. Nichols B.L., Avery S., Sen P., Swallow D.M., Hahn D., Sterchi E. The maltase glucoamylase gene: common ancestry to sucrase-isomaltase with complementary starch digestion activities. Proc. Natl. Acad. Sci. 2003;100:1432–1437. doi: 10.1073/pnas.0237170100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Palmquist D.L., Jenkin T.C. Fat in lactation rations. J. Dairy Sci. 1980;63:11–14. doi: 10.3168/jds.S0022-0302(80)82881-5. [DOI] [PubMed] [Google Scholar]
  21. Riesenfeld G., Sklan D., Bar A., Eisner U., Hurwitz S. Glucose absorption and starch digestion in the intestine of the chicken. J. Nutr. 1980;110:117–121. doi: 10.1093/jn/110.1.117. [DOI] [PubMed] [Google Scholar]
  22. Sahin T., Tilki M., Kaya İ., Unal Y., Elmali D.Aksu. Effect of different protein levels for finishing period on fattening performance and carcass traits in native Turkish geese. J. Anim. Vet. Adv. 2008;7:1364–1369. [Google Scholar]
  23. Selle P.H., Dorigam J.C.D.P., Lemme A., Chrystal P.V., Liu S.Y. Synthetic and crystalline amino acids: alternatives to soybean meal in chicken-meat production. Animals. 2020;10:729. doi: 10.3390/ani10040729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Selle P.H., Liu S.Y. The relevance of starch and protein digestive dynamics in poultry. J. Appl. Poult. Res. 2019;28:531–545. [Google Scholar]
  25. Short F.J., Gorton P., Wiseman J., Boorman K.N. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed. Sci. Tech. 1996;59:215–221. [Google Scholar]
  26. Son J.H., Karasawa Y. Comparative effect of cecal ligation and colostomy on nitrogen utilization in chickens fed low protein or urea-supplemented low protein diets. Poult. Sci. J. 2003;40:92–100. [Google Scholar]
  27. Svihus B. Starch digestion capacity of poultry1. Poult. Sci. 2014;93:2394–2399. doi: 10.3382/ps.2014-03905. [DOI] [PubMed] [Google Scholar]
  28. Tester R., Sommerville M. The effects of non-starch polysaccharides on the extent of gelatinisation, swelling and α-amylase hydrolysis of maize and wheat starches. Food Hydrocoll. 2003;17:41–54. [Google Scholar]
  29. Wang Q.D., Zhang K.Y., Zhang Y., Bai S.P., Ding X.M., Wang J.P., Peng H.W., Tian G., Xuan Y., Su Z.W., Zeng Q.F. Effects of dietary protein levels and protease supplementation on growth performance, carcass traits, meat quality, and standardized ileal digestibility of amino acid in pekin ducks fed a complex diet. Poult. Sci. 2020;99:3557–3566. doi: 10.1016/j.psj.2020.03.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wiseman J. Variations in starch digestibility in non-ruminants. Anim. Feed. Sci. Tech. 2006;130:66–77. [Google Scholar]
  31. Xie M., Jiang Y., Tang J., Wen Z.G., Zhang Q., Huang W., Hou S.S. Effects of low-protein diets on growth performance and carcass yield of growing White Pekin ducks. Poult. Sci. 2016;96:1370–1375. doi: 10.3382/ps/pew349. [DOI] [PubMed] [Google Scholar]
  32. Yang Z., Liao S.F. Physiological effects of dietary amino acids on gut health and functions of swine. Front. Vet. Sci. 2019;6:169. doi: 10.3389/fvets.2019.00169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yu Z.P., Xu M., Liu K., Yao J.H., Yu H.X., Wang F. Leucine markedly regulates pancreatic exocrine secretion in goats. J. Anim. Physiol. An. N. 2013;98:169–177. doi: 10.1111/jpn.12069. [DOI] [PubMed] [Google Scholar]
  34. Zhang S., Zeng X., Ren M., Mao X., Qiao S. Novel metabolic and physiological functions of branched chain amino acids: a review. J. Anim. Sci. Biotechnol. 2017;8:10. doi: 10.1186/s40104-016-0139-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article.


Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES