Skip to main content
PMC home page
Springer logoLink to Springer
. 2024 Dec 16;108(1):536. doi: 10.1007/s00253-024-13374-1

Improved recombinant expression of soluble cathepsin B and L in Escherichia coli

Christina Möller 1, Niklas Rimkus 1, Ferdinand F O Skala 1, Maëlle Merouze 1, Dominique Böttcher 1, Mark Dörr 1, Uwe T Bornscheuer 1,✉
PMCID: PMC11649755  PMID: 39680170

Abstract

Abstract

Cysteine cathepsins such as cathepsin B and L play an important role in numerous diseases like acute pancreatitis or SARS-CoV-2 and therefore have high potential for the development of new therapeutics. To be able to screen for potent and selective inhibitors sufficient amounts of protein are required. Here, we present an easy and efficient protocol for the recombinant expression of soluble and active murine cathepsin B and L. For this, we used the strain E. coli SHuffle® T7 Express which is capable of forming disulfide bridges in the cytoplasm. The enzymes were purified by immobilized nickel ion-affinity chromatography. Using different constructs and media, expression levels were significantly improved and expression yields of 80 ± 2 mg L−1 for procathepsin B, which is 16-fold better than previously reported expression yields for procathepsin B, and 37 ± 2 mg L−1 for procathepsin L, were achieved. After activation with dithiothreitol at slightly acidic pH, in vitro kinetic parameters of both cathepsins were determined using the commonly used synthetic substrates Arg-Arg-AMC or Phe-Arg-AMC. Moreover, to investigate the impact of the short C-terminal propeptide of procathepsin B, it was deleted by site-directed mutagenesis, the shortened target protein was expressed and purified, activated in vitro, and its activity was similar to the variant bearing this C-terminal propeptide.

Key points

• Recombinant gene expression of cathepsin B and L in E. coli SHuffle® T7 Express

• Soluble cathepsin expression with high expression yields

• Investigation of the short C-terminal propeptide of cathepsin B

Supplementary Information

The online version contains supplementary material available at 10.1007/s00253-024-13374-1.

Keywords: Cathepsin B, Cathepsin L, E. coli SHuffle® T7 Express, Recombinant gene expression

Introduction

Cathepsins are a family of proteases with a broad range of functions. The cathepsins can be divided into cysteine, serine, and aspartic proteases (Yadati et al. 2020). Papain-like cysteine proteases are ubiquitously expressed and play a role in many physiological and pathological processes (Brix et al. 2008).

Under physiological conditions, cysteine proteases are expressed as preproenzymes, which are inactive precursors, also called “zymogens.” This means that they consist of a signal peptide, a propeptide and a catalytic domain. The signal peptide is responsible for the transport of a protein through membranes into distinct compartments where it is cleaved off by signal peptidases (Von Heijne 1985; Verner and Schatz 1988; Calo and Eichler 2011). The propeptide keeps the protease inactive during the expression to prevent unwanted protein degradation and enable temporal regulation of proteolytic activity (Khan and James 1998; Wiederanders et al. 2003).

For a long time, cysteine proteases have been considered as potential drug targets to be able to treat various diseases (Turk and Gunčar 2003; Bromme 2004). The lysosomal cysteine protease cathepsin B (CTSB) plays a role in the intrapancreatic activation of trypsinogen in the onset of acute pancreatitis (Halangk et al. 2000). Moreover, CTSB has been shown to be up-regulated in a variety of cancers as well as in traumatic brain injury (Hook et al. 2015; Shen and Li 2022). The lysosomal cysteine protease cathepsin L (CTSL) is known to be up-regulated during chronic inflammation and plays a role in the degradation of the extracellular matrix which is important for SARS-CoV-2 to enter host cells. It is also believed to play a role in the processing of the SARS-CoV-2 spike protein (Zhao et al. 2021). Therefore, both cysteine proteases can be considered a possible therapeutic target (Hook et al. 2015; Gomes et al. 2020; Zhao et al. 2021; Shen and Li 2022).

For this reason, there is an increasing interest in cysteine proteases in terms of academic research to unravel their specific functions in various diseases as well as the pharmaceutical interest to be able to find drugs. Consequently, sufficient amounts of protein are required to be able to screen for potent and selective inhibitors and analyse function-structure relationships. Usually, E. coli is the first choice for recombinant gene expression since it is a well-established host with short cultivation time, low-cost production, and ease of use (Gopal and Kumar 2013). However, the most commonly used E. coli strains such as BL21 (DE3) are not able to form posttranslational modifications like the formation of disulfide bridges in the cytoplasm. It is noteworthy that mature CTSB contains six and CTSL three disulfide bridges, respectively. The recombinant expression of CTSB and CTSL in E. coli faced difficulties in soluble expression. Often, the cathepsins were expressed as inclusion bodies which usually require subsequent and time-consuming refolding (Kuhelj et al. 1995; Kramer et al. 2007). Moreover, low expression yields were obtained (Bromme 2004).

Here, we present an easy and efficient protocol for the expression of the murine cysteine proteases cathepsin B and L using E. coli SHuffle® T7 Express cells as gene expression system. The cathepsins were expressed as zymogens in a soluble form, purified and activated in vitro. For both cathepsins, we investigated the expression levels using several constructs by varying the location of the His6-tag and further optimized the expression of both cathepsins by utilizing different media. Moreover, the very short C-terminal propeptide of cathepsin B was deleted via site-directed mutagenesis in order to investigate its role in comparison to the full-length proprotein.

Materials and methods

Molecular cloning

The synthetic genes for the three different variants of murine procathepsin B and the variant of procathepsin L with an N-terminal His6-tag were ordered cloned into a pET28a( +) vector (BioCat GmbH, Heidelberg, Germany), where the genes were inserted via seamless cloning using AACTTTAAGAAGGAGATATACC at the 5´site and the XhoI restriction site at the 3´site, respectively. The propeptide sequences were retained, while the signal peptide sequences were excluded in the design of the synthetic genes. The sequences were codon-optimized for expression in E. coli. All genes contained an N- or C-terminal His6-tag or a His6-tag after the sequence for the N-terminal propeptide for purification via affinity chromatography together with an additional cleavage site for the TEV-protease (ENLYFQS) to have the possibility to cleave off the His6-tag. The procathepsin L construct CTSL_C-6xHis was generated due to the deletion of the N-terminal His6-tag and insertion of a C-terminal His6-tag using site-directed mutagenesis. The N-terminal His6-tag was deleted using the forward primer 5′-ACCCCGAAATTCGATCAG-3′ and the reverse primer 5′-CATGGTATATCTCCTTCTTAAAG-3′ and the C-terminal His6-tag of the pET28a( +) vector was inserted using the forward primer 5′-acttccagagcCTCGAGCACCACCACCA-3′ and the reverse primer 5′-acagattttcATTAACAACCGGATAACTTGCTGC-3′. The amino acid and nucleotide sequences of the variants of procathepsin B and L are listed in the Supplementary Information.

To investigate the function of the C-terminal propeptide of CTSB, the construct CTSB_N-6xHis was used for site-directed mutagenesis where the C-terminal propeptide was deleted. For this variant, the forward primer 5′-GCGCACCGATtagTATTGGGGTC-3′ and the reverse primer 5′-GGAATGCCTGCCACAATTTC-3′ were used.

Gene expression

For gene expression, the pET28a( +) vector containing the desired gene sequence was introduced into E. coli SHuffle® T7 Express cells (New England Biolabs, Frankfurt am Main, Germany) by the heat-shock method. For each gene expression, a single colony of freshly transformed E. coli SHuffle® T7 Express cells with the desired gene sequence was picked and used to inoculate 4 mL lysogeny broth (LB) medium supplemented with 50 µg mL−1 kanamycin. Subsequently, the cultures were grown overnight at 30 °C at 180 rpm. These starter cultures were used to inoculate the 50 mL main cultures in which the cells were grown. For the main cultures either LB, terrific broth (TB), LB autoinduction medium (LB-AIM), or TB autoinduction medium (TB-AIM) were used. When an optical density (OD600) of approximately 0.8–1.0 was reached, the gene expressions of the LB or TB cultures were induced with a final concentration of 0.4 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and were shaken for 26 h at 16 °C at 160 rpm. The LB-AIM and TB-AIM cultures were also shifted to 16 °C for 26 h at 160 rpm when an optical density (OD600) of approximately 0.8–1.0 was reached. The main cultures were harvested by centrifugation for 20 min at 4500 × g at 4 °C and washed once with sodium phosphate buffer (50 mM, pH 6.0). The cell pellets were stored at − 20 °C until further use. All constructs were expressed three times.

Cell disruption

The harvested bacteria pellets were resuspended in 4 mL equilibration buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0) for each gram of cell pellet. Afterward, the cells were disrupted using ultrasonication with 50% cycle and 30% power on ice. The sonication procedure consisted of 4 min sonication followed by a 2 min break and another 4 min of sonication. Subsequently, the samples were centrifuged at 10,000 × g for 30 min at 4 °C for separation of the cell debris from the supernatant and the lysates were purified.

Protein purification

Columns of 3 mL Ni-imino diacetate (IDA, Carl Roth, Karlsruhe, Germany) for gravity flow chromatography for the purification of His-tagged proteins were prepared. The columns were washed three times with one column volume of cold MilliQ water followed by five column volume washing steps with equilibration buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). Afterwards, the clarified lysates containing the desired proteins were transferred onto the Ni-IDA columns, incubated for 30 min on ice, washed 10 times with washing buffer (50 mM sodium phosphate, 300 mM NaCl, 20 mM imidazole, pH 8.0), and eluted in 2 mL fractions with elution buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0). All five elution fractions were pooled.

Rebuffering of proteins

Prior to protein concentration measurements, the protein samples were rebuffered to remove imidazole in the elution buffer during protein purification. For this, the samples were transferred into centricons with a membrane cutoff of 10 kDa and centrifuged for 20 min at 4500 × g at 4 °C and the protein solutions were filled up to 5 mL with CTSB/CTSL measuring buffer (100 mM sodium acetate, 5 mM calcium chloride, pH 5.5). The two steps of centrifugation and filling up with CTSB/CTSL measuring buffer were repeated two more times.

Protein yields

The protein concentrations were measured at 280 nm via NanoDrop 1000 (Thermo Scientific, Wilmington, DE, USA), and the protein yields were calculated based on the extinction coefficients which were determined using the Expasy tool ProtParam (https://web.expasy.org/protparam/, Table S1).

Activation of recombinant proteins

The recombinant procathepsins were autocatalytically activated. For this, subsequently after rebuffering, the recombinant procathepsins B and procathepsin L were incubated with 10 mM dithiothreitol (DTT) at 37 °C until fully activated protein could be verified by SDS-PAGE analysis. Precipitated protein was removed by filtration after the activation process.

Determination of kinetic parameters

The activities of both cathepsins were determined in measuring buffer (100 mM sodium acetate, 5 mM calcium chloride, pH 5.5) using chromogenic substrates. The activity of cathepsin B was measured using the substrate Z-Arg-Arg-AMC (Bachem, Bubendorf, Switzerland), and the activity of cathepsin L was measured using the substrate Z-Phe-Arg-AMC (Bachem). In both cases, the fluorescence was measured at an extinction wavelength of 360 nm and an emission wavelength of 470 nm. KM values were determined by measuring initial rates with varying substrate concentrations. For CTSB, the final substrate concentrations of 0, 0.05, 0.1, 0.2, 0.5, 1, 2, and 4 mM of Z-Arg-Arg-AMC were used. For CTSL, the final substrate concentrations of 0, 5, 10, 25, 50, 75, 100, and 150 µM were used. Ninety microliters of the substrate in measuring buffer with the addition of 10 mM DTT were prepared in a reaction plate, and the reaction was started by the addition of 10 µL of a 1 µg mL−1 CTSB or CTSL solution. The KM values for CTSB were calculated with a nonlinear regression for the fit function for the Michaelis–Menten kinetics and for CTSL with a nonlinear regression using the substrate-inhibition fit in GraphPad Prism 8.4.3 (GraphPad Software, USA) software.

Results

Heterologous protein production and purification

For recombinant gene expression of procathepsin B and L in a soluble form and a high expression yield, the E. coli SHuffle® T7 Express strain was used. This bacterial strain possesses many advantages for the recombinant expression of eukaryotic proteins as cathepsin B and cathepsin L. It is an engineered E. coli strain that is suitable for T7-promoter-based expression and is dedicated to produce correctly folded active proteins containing disulfide bridges within its cytoplasm (Lobstein et al. 2012).

For gene expression of procathepsin B and L in a soluble form and a high expression yield, several constructs for synthetic genes were designed (Fig. 1a and b). The N-terminal propeptide was maintained since these amino acids shield the active site and therefore inhibit protease activity. Otherwise, the active form of cathepsin B (CTSB) and cathepsin L (CTSL) could result in unwanted protein degradation during recombinant gene expression. Additionally, it was decided to keep the C-terminal propeptide for CTSB since it could be required as well, e.g., for proper protein folding.

Fig. 1.

Fig. 1

Open in a new tab

Schematic representations of synthetic genes of a procathepsin B (CTSB) and b procathepsin L (CTSL). For protein purification, a His6-tag with a TEV-protease cleavage site was either added C-terminally (CTSB_C-6xHis, CTSL_C-6xHis), N-terminally (CTSB_N-6xHis, CTSL_N-6xHis), or after the N-terminal propeptide 1 (CTSB_M-6xHis). c Overlay of the AlphaFold3 models of CTSB (ptm 0.95) and CTSB_M-6xHis (ptm 0.90) using UCSF chimera. The N-terminal propeptide of CTSB (dark red) and CTSB_M-6xHis (goldenrod) shield the active site cleft with the catalytically active cysteine and histidine residues (pink). The loop where the His6-tag (purple) and the TEV-protease cleavage site (green) of CTSB_M-6xHis are located does not seem to interfere with the overall structure of mature CTSB (cyan) compared to CTSB_M-6xHis (dark blue). d Overlay of mature human CTSB (PDB-ID: 1CSB) with the murine AlphaFold3 model of CTSB using UCSF chimera. The overall structure of mature human CTSB (dark blue) and murine CTSB (cyan) have a sequence identity of 83% showing overall the same fold. Only minor differences in the loop region of the occluding loop are visible

In all constructs, a His6-tag was added to the protein sequence with an additional cleavage site for the TEV-protease to have the possibility to cleave off the His6-tag. The His6-tag and TEV-protease cleavage site were either added to the C-terminus (CTSB_C-6xHis, CTSL_C-6xHis), N-terminus (CTSB_N-6xHis, CTSL_C-6xHis) or between the N-terminal propeptide and the mature form of CTSB (CTSB_M-6xHis). The insertion after the N-terminal propeptide would enable the possibility to activate the protein due to the addition of the TEV protease and also to leave the mature protein fused with a His6-tag since in both other constructs the His6-tag would be cleaved off during autocatalytic activation. Using AlphaFold3 (Abramson et al. 2024) models, it was predicted that the N-terminal propeptide would still correctly occlude the catalytic center and the His6-tag would also be accessible for purification (Fig. 1c). The loop where the His6-tag and the TEV protease cleavage site were inserted was only enlarged and did not seem to alter the overall protein structure. Moreover, it is shown that mature murine CTSB that has a sequence identity with mature human CTSB of 83% shows an overall similar fold, solely the position of the so called “occluding loop” of CTSB is slightly altered, which is not surprising since it is a flexible loop (Fig. 1d).

For recombinant protein production, E. coli SHuffle® T7 Express cells were used. The highest yields of approx. 50 mg L−1 were obtained for the two constructs CTSB_N-6xHis and CTSB_C-6xHis (Fig. 2a). The recombinant expression of CTSB_M-6xHis was also successful with a yield of 9 ± 2 mg L−1. All variants were shown to be active (Figure S1). For procathepsin L, the expression of both constructs was also successful (Fig. 2b). Although the expression yield for CTSL_C-6xHis was higher (approx. 70 mg L−1) further expression optimization was continued with the CTSL_N-6xHis construct since here the His6-tag and cleavage site for the TEV-protease would be completely removed upon activation of the proenzyme. Therefore, mature CTSL_N-6xHis would result in the physiologically relevant enzyme which would not be the case for the construct with the C-terminal His6-tag and TEV-protease cleavage site.

Fig. 2.

Fig. 2

Open in a new tab

Expression yields of a procathepsin B constructs with an N-terminal His6-tag (CTSB_N-6xHis), a C-terminal His6-tag (CTSB_C-6xHis) and a His6-tag after the N-terminal propeptide (CTSB_M-6xHis) expressed in LB-media; b procathepsin L (CTSL) constructs with an N-terminal His6-tag (CTSL_N-6xHis) and a C-terminal His6-tag (CTSL_C-6xHis) expressed in LB medium; c procathepsin B containing an N-terminal His6-tag (CTSB_N-6xHis) expressed in different media; and d procathepsin L containing an N-terminal His6-tag (CTSL_N-6xHis) expressed in different media. Media investigated have been lysogeny broth (LB), terrific broth (TB), LB autoinduction medium (LB-AIM), and TB autoinduction medium (TB-AIM). The data represent three independent experiments and the significance was calculated by two-tailed Student t test for independent samples

To even further increase recombinant protein production, different media were studied (Fig. 2c and d). In both cases, the highest yield was obtained using terrific broth (TB) medium, where yields of 80 ± 2 mg L−1 for CTSB_N-6xHis and 37 ± 2 mg L−1 for CTSL_N-6xHis were obtained. For expression in lysogeny broth (LB) medium protein amounts of 61 ± 5 mg L−1 for CTSB_N-6xHis and 21 ± 1 mg L−1 for CTSL_N-6xHis were determined. Low recombinant CTSB and CTSL expression yields were determined using the autoinduction media (AIM) LB-AIM and TB-AIM.

Biochemical characterization of the proteins

Recombinant procathepsin B and L can be autocatalytically activated by rebuffering in a suitable buffer with a slightly acidic pH value. Both procathepsins were rebuffered in 100 mM sodium acetate buffer supplemented with 5 mM calcium chloride at pH 5.5 and 10 mM dithiothreitol (DTT). The successful activation was verified by SDS-PAGE analysis (Fig. 3). CTSB_N-6xHis has a molecular weight of 37.5 kDa while the mature protein after activation has a molecular weight of 27.6 kDa and the propeptide of 9.1 kDa (Table S1, Fig. 3a). CTSL_N-6xHis has a molecular weight of 38.0 kDa as proenzyme and a molecular weight of 24.0 kDa, when the propeptide with a size of 13.9 kDa is cleaved (Fig. 3b).

Fig. 3.

Fig. 3

Open in a new tab

SDS-PAGE analysis of the activation of CTSB and CTSL. a Procathepsin B (proCTSB, lane 1), activated CTSB and propeptide (lane 2), and the ladder (lane 3). b Activated CTSL and the propeptide (lane 1), procathepsin L (proCTSL, lane 2), and the ladder (lane 3). Pierce™ Unstained Protein MW Marker (ThermoFisher, Germany) was used as a reference

To investigate if the C-terminal propeptide is also cleaved in vitro, we separated partially activated CTSB_C-6xHis and mature CTSB_C-6xHis via affinity chromatography (Fig. S2). While the proenzyme was found in the elution fractions, the mature protein did not bind to the column and instead was found in the flowthrough, giving evidence that the C-terminal propeptide is also cleaved off in vitro.

The activity of mature CTSB and CTSL were investigated utilizing the commonly used fluorogenic substrates Z-Arg-Arg-AMC or Z-Phe-Arg-AMC, respectively (Table 1). For CTSB, a KM value of 0.37 ± 0.05 mM and a kcat value of 77.00 ± 28.90 s−1 were obtained. For CTSL, a KM value of 0.02 ± 0.00 mM and a kcat of 230.00 ± 43.50 s−1 were calculated.

Table 1.

Kinetic parameters for the cathepsin B (CTSB)-catalyzed hydrolysis of Z-Arg-Arg-AMC and the cathepsin L (CTSL)-catalyzed hydrolysis of Z-Phe-Arg-AMC. All experiments were performed with 10 ng CTSB or CTSL in 100 mM sodium acetate buffer with 5 mM calcium chloride at pH 5.5 supplemented with 10 mM DTT

KM (mM) kcat (s−1) kcat/KM (mM−1 s−1)
CTSB 0.37 ± 0.05 77.00 ± 28.90 208.11 ± 33.12
CTSL 0.02 ± 0.00 230.00 ± 43.50 9430.09 ± 337.42
Open in a new tab

Determination of the C-terminal propeptide’s function

To investigate the function of the C-terminal propeptide (P2) of CTSB, the C-terminal propeptide of CTSB_N-6xHis was deleted by site-directed mutagenesis and the variants with and without the C-terminal propeptide were expressed and purified. During the activation of both variants, it was observed that parts of the deletion variant precipitated (Fig. 4a). To investigate if CTSB lacking the C-terminal propeptide also influences the activity, activity tests were performed (Fig. 4b). However, no significant difference in the activity of both variants could be observed.

Fig. 4.

Fig. 4

Open in a new tab

a Procathepsin B (CTSB) expressed with the C-terminal propeptide (CTSB with P2) and without (CTSB without P2) after activation at 37 °C. b Relative activity of mature CTSB with P2 and CTSB without P2 using Arg-Arg-AMC as a substrate. CTSB with P2 was normalized to 100%, and the relative activity of CTSB without P2 was calculated by dividing the activity measurement by CTSB with P2 and multiply this value with 100 to gain percentage activity. The data represent three independent experiments, and the significance was calculated by two-tailed Student t test for independent samples

Discussion

The goal of this study was to achieve an easy and soluble expression of functional cathepsin B and L in the microbial expression host E. coli at high expression yields. For the synthesis of recombinant cysteine cathepsins, several protocols were already established, including various expression systems using bacterial, baculovirus, yeast, and mammalian cell culture systems (Hasnain et al. 1992; Kuhelj et al. 1995; Steed et al. 1998; Bromme 2004; Kramer et al. 2007; Zhou et al. 2024). However, these systems are usually quite expensive and time-consuming. Moreover, often challenges as formation of inclusion bodies were faced that are followed by tedious refolding procedures and resulted in low protein yields (Kuhelj et al. 1995; Bromme 2004; Kramer et al. 2007).

Since recombinant protein production in E. coli is very easy to do and cost-efficient, we were searching for a suitable E. coli expression host that is able to form disulfide bridges, since cathepsin B possesses six and cathepsin L possesses three disulfide bridges (Table S2). Since the most commonly used E. coli strains are not capable of the formation of disulfide bridges, we used the strain E. coli SHuffle® T7 express. This represents a suitable host for the expression of especially eukaryotic proteins, such as cathepsins since it is able to synthesize correctly folded active enzymes that contain disulfide bridges. It is an engineered E. coli strain that can be used for recombinant protein production using a T7-promoter system. This E. coli strain is based on a trxB gor suppressor strain where its cytoplasmic reductive pathways have been diminished, which enables the formation of disulfide bridges in the cytoplasm. Moreover, a disulfide bond isomerase DsbC was integrated into the chromosome, which corrects the mis-oxidized disulfide bonds (Lobstein et al. 2012).

The recombinant expression of all three cathepsin B variants using E. coli SHuffle® T7 Express cells was successful (Fig. 2a). Even though the highest expression yields for procathepsin B were obtained where the His6-tag was added either N- or C-terminally, it is worth noting that the His6-tag can also be inserted after the N-terminal propeptide. Expression of this construct led to reduced expression yields, however, it was functionally active and could be of interest if a His6-tagged version is needed, e.g., if the enzyme has to be removed from a solution after a reaction. Since procathepsin B has a propeptide at both termini, the tag will always be cleaved off if it is added N-terminally or C-terminally. The higher expression yield by using TB medium (Fig. 2c) can easily be explained by the fact that TB medium is an enriched medium that was designed to be able to achieve higher bacterial densities. In 2011, an expression protocol for CTSB expression in soluble form using E. coli Rosetta-gami B (DE3) pLysS was already published. However, only low expression yields of 5 mg L−1 bacterial culture of the proenzyme were obtained (Novinec et al. 2012).

For the recombinant expression of CTSL, a C-terminally His6-tag seems to be the better choice for high expression yields (Fig. 2b). However, since CTSL has no C-terminal propeptide in contrast to CTSB, the His6-tag and TEV-protease cleavage site would not be cleaved off upon activation. The His6-tag could be cleaved off by using the TEV protease. However, there would still be a six amino acids extension to mature CTSL due to the fact that the TEV-protease cleavage site (ENLYFQS) is cleaved between the amino acids Q and S and therefore six amino acids of the cleavage site would not be cleaved off. To achieve higher yields of physiological CTSL, expression optimization was further carried out with the CTSL_N-6xHis construct where yields of 37 ± 2 mg L−1 were obtained (Fig. 2c).

Both procathepsins can be autocatalytically activated by adjusting the pH value to a slightly acidic pH (Fig. 3). The addition of DTT leads to faster full activation for both cathepsins, most likely due to its ability to prevent oxidation of the catalytically active cysteine residue, therefore keeping the proteases in their active state. Moreover, CTSB has a free cysteine residue on the protein surface which could also form an intermolecular disulfide bridge with the free cysteine residue of another CTSB molecule if not prevented.

The activated cathepsin B and L variants showed activity against the common fluorogenic substrates Z-Arg-Arg-AMC and Z-Phe-Arg-AMC, respectively (Table 1). The obtained KM values for CTSB of 0.37 ± 0.05 mM and 77.00 ± 28.90 s−1, respectively, are comparable with the obtained values of the same substrate with recombinantly expressed murine CTSB where values of 0.23 mM and 34 s−1 were reported (Caglič et al. 2009). Similar values were also obtained for rat CTSB expressed in yeast where values of 1.27 ± 0.23 mM and 57.9 ± 3.83 s−1 were determined (Hasnain et al. 1992). Even though the rat CTSB was expressed in yeast and is therefore glycosylated, this does not seem to alter the activity as it already has been described in the literature (Mach et al. 1992). For CTSL slightly different kinetic parameters compared to the literature were obtained. For CTSL previously expressed in E. coli followed by refolding, a KM value of 1.4 ± 0.1 µM and a kcat of 86 s−1 were reported. However, these values were determined for human CTSL, which has a sequence similarity of only 77.7% with murine CTSL (Kramer et al. 2007).

Moreover, to investigate the function of the very short C-terminal propeptide of CTSB, this propeptide was deleted using site-directed mutagenesis. During the autocatalytic activation, where the N-terminal and C-terminal propeptides are cleaved off, parts of the variant lacking the C-terminal propeptide precipitated (Fig. 4a). However, the activity of both variants was similar and therefore CTSB lacking the C-terminal propeptide during the activation does not seem to influence the activity and therefore does not lead to alternative protein folding. Since it is known that the C-terminal propeptide does not play a noteworthy role in protein trafficking where it can be considered as a bystander with no recognizable function (Müntener et al. 2003; Bestvater et al. 2005), it can be suggested that this very short propeptide might play a role in protein stability and/or proper protein folding during the expression or activation.

Easy recombinant expression of the cysteine proteases cathepsin B and L is of great interest due to their high potential as drug targets of numerous diseases. The expression protocol reported in this work might also be widely applicable for the recombinant production of other cysteine cathepsins.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (PDF 745 KB) (744.5KB, pdf)

Acknowledgements

We would like to thank Norman Geist and Mihaela Delcea for a previously generated AlphaFold2 model of one of the CTSB variants and valuable discussions. Additionally, we would like to thank Matthias Sendler and Ali Aghdassi for fruitful discussions about the functions of cathepsins.

Author contribution

UTB, DB, and MD initiated and directed the project. CM, NR, FFOS, and MM conducted the experiments. CM wrote the manuscript. All authors corrected and approved the manuscript.

Funding

Open Access funding enabled and organized by Projekt DEAL. This work was supported by the Deutsche Forschungsgemeinschaft (GRK 2719, RTG-PRO).

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethical approval

Not applicable.

Competing interest

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, Ronneberger O, Willmore L, Ballard AJ, Bambrick J, Bodenstein SW, Evans DA, Hung C-C, O’Neill M, Reiman D, Tunyasuvunakool K, Wu Z, Žemgulytė A, Arvaniti E, Beattie C, Bertolli O, Bridgland A, Cherepanov A, Congreve M, Cowen-Rivers AI, Cowie A, Figurnov M, Fuchs FB, Gladman H, Jain R, Khan YA, Low CMR, Perlin K, Potapenko A, Savy P, Singh S, Stecula A, Thillaisundaram A, Tong C, Yakneen S, Zhong ED, Zielinski M, Žídek A, Bapst V, Kohli P, Jaderberg M, Hassabis D, Jumper JM (2024) Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630:493–500. 10.1038/s41586-024-07487-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bestvater F, Dallner C, Spiess E (2005) The C-terminal subunit of artificially truncated human cathepsin B mediates its nuclear targeting and contributes to cell viability. BMC Cell Biol 6:16. 10.1186/1471-2121-6-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brix K, Dunkhorst A, Mayer K, Jordans S (2008) Cysteine cathepsins: cellular roadmap to different functions. Biochimie 90:194–207. 10.1016/j.biochi.2007.07.024 [DOI] [PubMed] [Google Scholar]
  4. Bromme D (2004) Production and activation of recombinant papain-like cysteine proteases. Methods 32:199–206. 10.1016/S1046-2023(03)00212-3 [DOI] [PubMed] [Google Scholar]
  5. Caglič D, Kosec G, Bojič L, Reinheckel T, Turk V, Turk B (2009) Murine and human cathepsin B exhibit similar properties: possible implications for drug discovery. Biol Chem 390:175–179. 10.1515/BC.2009.021 [DOI] [PubMed] [Google Scholar]
  6. Calo D, Eichler J (2011) Crossing the membrane in Archaea, the third domain of life. Biochim Biophys Acta BBA - Biomembr 1808:885–891. 10.1016/j.bbamem.2010.03.020 [DOI] [PubMed] [Google Scholar]
  7. Gomes CP, Fernandes DE, Casimiro F, da Mata GF, Passos MT, Varela P, Mastroianni-Kirsztajn G, Pesquero JB (2020) Cathepsin L in COVID-19: from pharmacological evidences to genetics. Front Cell Infect Microbiol 10:589505. 10.3389/fcimb.2020.589505 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gopal GJ, Kumar A (2013) Strategies for the production of recombinant protein in Escherichia coli. Protein J 32:419–425. 10.1007/s10930-013-9502-5 [DOI] [PubMed] [Google Scholar]
  9. Halangk W, Lerch MM, Brandt-Nedelev B, Roth W, Ruthenbuerger M, Reinheckel T, Domschke W, Lippert H, Peters C, Deussing J (2000) Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest 106:773–781. 10.1172/JCI9411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hasnain S, Hirama T, Tam A, Mort JS (1992) Characterization of recombinant rat cathepsin B and nonglycosylated mutants expressed in yeast. New insights into the pH dependence of cathepsin B-catalyzed hydrolyses. J Biol Chem 267:4713–4721 [PubMed] [Google Scholar]
  11. Hook G, Jacobsen JS, Grabstein K, Kindy M, Hook V (2015) Cathepsin B is a new drug target for traumatic brain injury therapeutics: Evidence for E64d as a promising lead drug candidate. Front Neurol 6. 10.3389/fneur.2015.00178 [DOI] [PMC free article] [PubMed]
  12. Khan AR, James MNG (1998) Molecular mechanisms for the conversion of zymogens to active proteolytic enzymes. Protein Sci 7:815–836. 10.1002/pro.5560070401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kramer G, Paul A, Kreusch A, Schüler S, Wiederanders B, Schilling K (2007) Optimized folding and activation of recombinant procathepsin L and S produced in Escherichia coli. Protein Expr Purif 54:147–156. 10.1016/j.pep.2007.02.007 [DOI] [PubMed] [Google Scholar]
  14. Kuhelj R, Dolinar M, Pungercar J, Turk V (1995) The preparation of catalytically active human cathepsin B from its precursor expressed in Escherichia coli in the form of inclusion bodies. Eur J Biochem 229:533–539. 10.1111/j.1432-1033.1995.0533k.x [DOI] [PubMed] [Google Scholar]
  15. Lobstein J, Emrich CA, Jeans C, Faulkner M, Riggs P, Berkmen M (2012) SHuffle, a novel Escherichia coli protein expression strain capable of correctly folding disulfide bonded proteins in its cytoplasm. Microb Cell Factories 11:753. 10.1186/1475-2859-11-56 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mach L, Stüwe K, Hagen A, Ballaun C, Glössl J (1992) Proteolytic processing and glycosylation of cathepsin B. The role of the primary structure of the latent precursor and of the carbohydrate moiety for cell-type-specific molecular forms of the enzyme. Biochem J 282:577–582. 10.1042/bj2820577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Müntener K, Zwicky R, Csucs G, Baici A (2003) The alternative use of exons 2 and 3 in cathepsin B mRNA controls enzyme trafficking and triggers nuclear fragmentation in human cells. Histochem Cell Biol 119:93–101. 10.1007/s00418-002-0487-y [DOI] [PubMed] [Google Scholar]
  18. Novinec M, Pavšič M, Lenarčič B (2012) A simple and efficient protocol for the production of recombinant cathepsin V and other cysteine cathepsins in soluble form in Escherichia coli. Protein Expr Purif 82:1–5. 10.1016/j.pep.2011.11.002 [DOI] [PubMed] [Google Scholar]
  19. Shen Y, Li X (2022) Cathepsin B as a target in cancer therapy and imaging. New J Chem 46:19593–19611. 10.1039/D2NJ03037C [Google Scholar]
  20. Steed PM, Lasala D, Liebman J, Wigg A, Clark K, Knap AK (1998) Characterization of recombinant human cathepsin B expressed at high levels in baculovirus. Protein Sci 7:2033–2037. 10.1002/pro.5560070920 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Turk D, Gunčar G (2003) Lysosomal cysteine proteases (cathepsins): promising drug targets. Acta Crystallogr D Biol Crystallogr 59:203–213. 10.1107/S0907444902021479 [DOI] [PubMed] [Google Scholar]
  22. Verner K, Schatz G (1988) Protein translocation across membranes. Science 241:1307–1313. 10.1126/science.2842866 [DOI] [PubMed] [Google Scholar]
  23. Von Heijne G (1985) Signal sequences. J Mol Biol 184:99–105. 10.1016/0022-2836(85)90046-4 [DOI] [PubMed] [Google Scholar]
  24. Wiederanders B, Kaulmann G, Schilling K (2003) Functions of propeptide parts in cysteine proteases. Curr Protein Pept Sci 4:309–326. 10.2174/1389203033487081 [DOI] [PubMed] [Google Scholar]
  25. Yadati T, Houben T, Bitorina A, Shiri-Sverdlov R (2020) The ins and outs of cathepsins: physiological function and role in disease management. Cells 9:1679. 10.3390/cells9071679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Zhao M-M, Yang W-L, Yang F-Y, Zhang L, Huang W-J, Hou W, Fan C-F, Jin R-H, Feng Y-M, Wang Y-C, Yang J-K (2021) Cathepsin L plays a key role in SARS-CoV-2 infection in humans and humanized mice and is a promising target for new drug development. Signal Transduct Target Ther 6:134. 10.1038/s41392-021-00558-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zhou W, You B, Zheng Y, Si S, Li Y, Zhang J (2024) Expression, purification, and biological activity evaluation of cathepsin L in mammalian cells. Biosci Biotechnol Biochem 88:405–411. 10.1093/bbb/zbae005 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (PDF 745 KB) (744.5KB, pdf)

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Applied Microbiology and Biotechnology are provided here courtesy of Springer

RESOURCES