Salmonella multimutants enable efficient identification of SPI-2 effector protein function in gut inflammation and systemic colonization

Abstract

Salmonella enterica spp. rely on translocation of effector proteins through the SPI-2 encoded type III secretion system (T3SS) to achieve pathogenesis. More than 30 effectors contribute to manipulation of host cells through diverse mechanisms, but interdependency or redundancy between effectors complicates the discovery of effector phenotypes using single mutant strains. Here, we engineer six mutant strains to be deficient in cohorts of SPI-2 effector proteins, as defined by their reported function. Using various animal models of infection, we show that three principle phenotypes define the functional contribution of the SPI-2 T3SS to infection. Multimutant strains deficient for intracellular replication, for manipulation of host cell defences, or for expression of virulence plasmid effectors all showed strong attenuation in vivo, while mutants representing approximately half of the known effector complement showed phenotypes similar to the wild-type parent strain. By additionally removing the SPI-1 T3SS, we find cohorts of effector proteins that contribute to SPI-2 T3SS-driven enhancement of gut inflammation. Further, we provide an example of how iterative mutation can be used to find a minimal number of effector deletions required for attenuation, and thus establish that the SPI-2 effectors SopD2 and GtgE are critical for the promotion of gut inflammation and mucosal pathology. This strategy provides a powerful toolset for simultaneous parallel screening of all known SPI-2 effectors in a single experimental context, and further facilitates the identification of the responsible effectors, and thereby provides an efficient approach to study how individual effectors contribute to disease.

Introduction

A common virulence strategy of Gram-negative pathogens is the use of type-three secretion systems (T3SS) to translocate bacterial effector proteins into host cells (1, 2). Effectors provide a mechanism for the bacterial manipulation of host cells to produce outcomes that favour pathogenesis. Salmonella enterica serovars express two distinct T3SS encoded on the genomic regions termed Salmonella-pathogenicity island-1 and −2 (SPI-1 and SPI-2) (3). Collectively, effectors translocated by the SPI-1 T3SS mediate invasion into host cells and the induction of a strong inflammatory response in the gut lumen, which diminishes colonisation resistance and promotes expansion of luminal Salmonella populations, permitting robust transmission to new hosts (4–6). In contrast, the SPI-2 T3SS is deployed exclusively by intracellular Salmonella, which reside within the Salmonella-containing vacuole (SCV) in both epithelial cells and phagocytic immune cells (7, 8). SPI-2 effectors contribute to a range of phenotypes that promote intracellular replication and survival, which enables within-host migration to systemic niches and later reseeding of the gut (9, 10). Arguably, the SPI-1 and SPI-2 T3SS together represent the principal virulence factors that mediate the pathogenic lifestyle of Salmonella, and indeed a mutant deficient for both T3SS is greatly impaired at inducing gut inflammation, and is not able to efficiently invade into nor survive within host tissue (9, 10). These strong phenotypes should be attributable to the collective functions of translocated effector proteins, in addition to any effect exerted by the injection apparatuses themselves, and so it remains a central challenge to characterise the contribution of individual effectors. While most SPI-1 effectors have clear functions assigned, many SPI-2 effectors remain poorly characterised and it is not clear how individual effectors collectively contribute to the virulence phenotypes mediated by the SPI-2 T3SS.

More than 30 SPI-2 T3SS effectors have been identified for the prototypical laboratory strain S. Typhimurium SL1344. Since the discovery and characterisation of the SPI-2 T3SS (7, 8), decades of research has revealed how many of these effectors function to enable SPI-2 virulence, and these efforts are well reviewed elsewhere (11–13). Briefly, SPI-2 effectors collectively contribute to a range of important intracellular activities, including the development and maintenance of the SCV, control of host cell trafficking, manipulation of cell signalling pathways that can lead to pro- or anti-inflammatory outcomes, and interference with the development of adaptive immunity (11, 14). Many SPI-2 effectors are enzymes that catalyse a diverse range of biochemical post-translational modifications to host proteins, while others act in a structural manner by binding to host enzymes to cause changes in substrate specificity (12). The acquisition of a broad complement of effectors over evolutionary time likely contributes to the success of Salmonella enterica spp. as a broad host-range pathogen, and similarly represents a highly tuneable bacterial strategy for keeping evolutionary pace with host cell defences that restrict bacterial proliferation. Thus, the study of SPI-2 effectors is critical to understand the mechanisms underpinning bacterial subversion of host cell processes, and should inform better strategies for control of this pathogen.

However, there are significant experimental challenges to the study of individual SPI-2 effectors. Logistically, the creation and characterisation of more than 30 single mutant strains is laborious, and while this strategy has been successful in screening for SPI-2 virulence phenotypes in vitro (15–17), there are significant experimental hurdles in more complicated experimental designs, especially those using animal models of infection. Additionally, many effectors have been reported to have or are speculated to have redundant or interdependent functions. Previous studies exploring single mutant phenotypes have shown that single deletions for most effectors have no impact on intracellular replication or survival during in vitro experiments (15, 18). The creation of multimutant strains, in which more than one effector is deleted in a particular genetic background, has proven useful in identifying effectors that are necessary or sufficient for certain virulence phenotypes (15, 19, 20). However, in many cases, the design of these multimutants precludes their use in systematically interrogating the function of all effectors in one experimental setup. Thus, there is a need for new tools that enable rapid and logistically simpler interrogation of SPI-2 effector functions, both to understand the activity of individual effectors and to explore how effectors cooperatively or redundantly contribute to broader virulence phenotypes.

Here, we describe the design and construction of six multimutant strains of S.Tm SL1344, each deficient for three to six different SPI-2 effectors, collectively covering the known repertoire of SPI-2 effectors in this genetic background. We deployed these mutant strains in several murine models of Salmonella infection and found that effector cohorts required for intracellular replication and host-cell survival were critical for expansion in systemic niches, while approximately half of the SPI-2 effector repertoire remained dispensable for virulence. Further, these same effector cohorts were also required for migration from the gut to systemic niches during oral infection. We found that deletion of two effector cohorts could ablate the onset of SPI-2 T3SS-dependent gut inflammation, in the absence of SPI-1 T3SS effector translocation. Finally, we demonstrate a strategy for identifying the individual effectors that contribute to a cohort phenotype by use of simpler mutant strains, and thus describe an unreported role for the effectors SopD2 and GtgE in driving gut inflammation. Together, we show how complex multimutants can be deployed to interrogate virulence phenotypes, a strategy which should be broadly applicable in different experimental contexts.

Results

Construction and validation of SPI-2 effector multimutant strains

To surmount the experimental difficulties in studying how individual SPI-2 effectors contribute to various SPI-2 T3SS-mediated phenotypes, we designed and constructed a set of six multimutant strains in the Salmonella Typhimurium (S. Tm) SL1344 background. The design of these strains was guided by several criteria: effectors that contribute to similar phenotypes based on their reported functions should be deleted together; each effector should only be deleted once across all six strains; intergenic regions between closely located effectors should be preserved; and effectors should be removed as single deletions where possible, rather than deleting multiple closely-located effectors. The characterisation of SPI-2 effectors has been a priority since the identification and characterisation of the SPI-2 T3SS several decades ago, and thus the depth of literature available permits the loose grouping of effectors into functional groups (Fig. 1A). This informed the design of multimutant strains lacking effectors that could reasonably be deleted to produce a strain deficient for a particular function (e.g. a strain lacking several key effectors contributing to development and maintenance of the Salmonella containing vacuole). Some effectors remain poorly characterized with no reported function or host targets, and these were similarly grouped as a multimutant strain. Finally, we used a single mutant deletion for spvR to represent a functional deletion of the virulence plasmid-encoded effectors spvB, spvC, and spvD, in line with previous work (15).

Figure 1. Functional grouping of SPI-2 effector genes permits rationally designed multimutants.

A) Graphic representation of reported functions for SPI-2 T3SS effector proteins. Effectors are loosely grouped into five different functional groups based on literature. Some effectors reportedly contribute to different functional groups and are represented twice here. B) Schematic representation of workflow to generate complex multimutants. Single mutants were created by lambda red recombination to replace genes of interest with cassettes encoding either kanamycin (::aphT) or chloramphenicol (::cat) resistance, followed by generation of P22 lysates containing phage that have packaged these deletions. Successive rounds of sequential P22 transduction and Flp-FRT removal of resistance cassettes resulted in mutants deficient for three to six effector genes, as required. Mutant strains were validated by whole genome sequencing to confirm deletion of target genes and to assess the degree of other changes to the genome. C) Rational design of SPI-2 effector multimutant strains based on reported functions described in Fig 1A. Six multimutant strains were constructed in duplicate and assigned designations based on the Greek alphabet (left) by deletion of effector genes in the sequence shown (right) to produce distinct multimutant genotypes (middle). D) Bioinformatic analysis confirming the deletion of target genes from corresponding multimutant strains. Blue rectangles correspond to absence of reads mapping to chromosomal regions encoding these genes. Two independently-constructed multimutant strains were analysed. Gene position (top) corresponds to position on the chromosome of S.Typhimurium SL1344, while other regions of the chromosome are not shown.

The workflow for generating multimutant strains (Fig. 1B) involved the initial construction of single-mutant strains representing all known SL1344 SPI-2 effectors, either by lambda red recombinase-mediated replacement of target genes with antibiotic resistance cassettes, or by leveraging an existing library of single mutant strains constructed in an S.Tm 14028S background. These single mutant strains were then used to generate P22 lysates which contained randomly-packaged segments of the bacterial chromosome. Using this library of P22 lysates, we sequentially performed P22 transduction to introduce these gene deletions into a clean SL1344 background, followed by Flp-FRT-mediated removal of resistance cassettes. This process was repeated to sequentially delete up to six genes from an individual strain, and we performed this process in duplicate to generate two independent clone of each multimutant strain. Ultimately, we constructed six multimutant strains covering broad functional groups of Salmonella virulence, and assigned these strains designations based on the first six letters of the Greek alphabet (Fig. 1C). We performed whole-genome sequencing to validate the construction of these multimutant strains, and to determine the degree of unwanted changes to the chromosome of these strains (Fig. 1D). This analysis confirmed that all strains bear the correct deletion based on the intended design, and are thus suitable for experimental use. We detected a number of polymorphisms that likely arose due to successive genetic manipulation and passaging in laboratory conditions, which seemed to loosely correlate to the number of genes deleted in each strain (i.e. strains with six deletions tended to bear more polymorphisms than those with four) (Table S1). Other polymorphisms are a consequence of transducing genes that were originally deleted in the S. Tm 14028 background and transferred to the SL1344 genome (i.e. naturally occurring differences in the SL1344 and 14028 genomes) and these are annotated in Table S1. We observed distinct polymorphisms arising between two independently constructed clones of each multimutant, suggesting these genetic changes arise randomly during the construction process. This also provides the opportunity to compare the fitness of each clone, to establish whether particular virulence phenotypes may be attributable to these unwanted polymorphisms. Finally, we observed no significant genomic rearrangement or other changes to the genome, including the presence or absence of phages or other mobile elements. Thus, we report the correct construction of six SPI-2 effector multimutant strains that are suitable for use in various experimental contexts and should be useful in advancing the study of individual and collective SPI-2 effector-mediated phenotypes.

SPI-2 effector cohorts contribute to systemic infection in vivo

Next, we aimed to characterise the phenotypes of these multimutant strains in an infection context, and thus describe how different effector cohorts contribute to virulence. We infected C57BL/6 mice with 10³ S. Tm by intraperitoneal injection (Fig 2A), which is a well-established murine model of systemic infection that is characterised by high levels of bacterial replication in systemic niches such as the spleen and liver (21, 22). At day 4 post infection (Fig 2B), we observed very high bacterial loads in the liver (left) and spleen (right) of mice infected with S.Tm WT, while mice infected with S.Tm ΔssaV (deficient for assembly of the SPI-2 T3SS) or S.Tm Efl (deficient for all known SPI-2 effectors (15)) had greatly reduced bacterial loads, consistent with the critical role played by the SPI-2 T3SS in mediating intracellular replication and survival. Of the six multimutant strains, we observed a significant reduction in bacterial loads in mice infected with S.Tm Alpha, Delta, and Zeta, suggesting the effector groups deleted here play important roles in systemic infection. Surprisingly, three multimutant strains – S.Tm Beta, Gamma, and Epsilon – showed bacterial loads to the WT in both liver and spleen, suggesting these effectors are not required for virulence under these conditions. Further, we observed a similar trend in bacterial numbers in the mesenteric lymph node (Fig S1A, left), suggesting these effectors play similar roles in colonisation of this site, while colonisation of the gut showed a less clear trend but nonetheless suggests the SPI-2 T3SS is important for delayed gut colonisation, consistent with previous findings (Fig S1A, right). To determine if these strong phenotypes arise as a result of bacterial replication and survival, or if these differences are attributable to an initial failure to successfully colonise these sites, we repeated these experiments but euthanised mice at day 2 post infection. We observed a broadly similar trend at this earlier stage of infection (Fig S1B) compared to later stages (Fig 2B, Fig S1A), which suggests that while these functional cohorts do play distinct roles at early stages, the contribution of these effectors to virulence becomes significantly more pronounced as the systemic infection progresses. Collectively, the systemic infection phenotypes of our SPI-2 effector multimutants are broadly concordant with the reported function of S. Tm mutants lacking individual effectors, and so the multimutant phenotypes can be interpreted as compound phenotypes that emerge from the successive deletion of effectors in a given multimutant. Thus, our set of multimutants can provide an efficient means to survey which SPI-2 effectors contribute to a particular virulence phenotype.

Figure 2. Systemic infection is compromised by deletion of SPI-2 effector cohorts.

A) Experimental scheme to study virulence of S.Tm mutants during systemic infection in vivo. Mice were infected with 10³ S.Tm by intraperitoneal injection. Mice were euthanised at day 4 post infection, and bacterial loads in the spleen and liver were quantified by CFU plating to selective media. B) S.Tm recovered from the liver (left) and spleen (right), (n = 5–7 mice per group). Horizontal bars denote median. Statistical differences between WT and indicated groups determined by two-tailed Mann Whitney-U test, (p>0.05 not significant (ns), p<0.05 (*), p<0.01 (**), p<0.001 (***). C) Experimental scheme to study relative fitness of S.Tm mutants in vivo by competitive infection. Mice were infected with a mixed inoculum comprising equal volumes of 9 different S.Tm strains each bearing unique chromosomal tags. Mice were euthanised at day 4 post infection. D) Relative proportion of each genetic tag determined by RT-qPCR. Data is presented as the proportion of a given tag relative to the other tags within one animal. Coloured circles represent tagged strain recovered from the liver (left) and spleen (right) of infected mice. Horizontal bars denote median.

A common strategy for studying virulence phenotypes is to perform competitive index experiments, in which a mixed inoculum comprising both the mutant strain and the wild-type strain is used for infection. In animal models of infection, the testing of multiple strains in the same mouse reduces the number of animals required for the analysis, and provides internal controls for animal-specific differences in disease progression. To enable this approach using our multimutant strains, we introduced a unique fitness-neutral genetic tag into each strain (23), alongside the control strains S.Tm WT, S.Tm ΔssaV, and S.Tm Efl. These tags can be quantified with a very high signal-to-noise ratio (greater than 1:100 000), either by quantitative RT-PCR or by a sequence counting utilising PCR amplification and next generation sequencing (24). The resulting collection of 9 tagged strains was then used to infect C57BL/6 mice by i.p. infection (Fig 2C) to assay the relative fitness of each strain within a single animal. We observed a similar trend as for single infection (Fig 2B) in these mixed infection experiments (Fig 2D, Fig S1C–D), in which S.Tm WT, S.Tm Beta, S.Tm Gamma, and S.Tm Epsilon greatly outcompeted S.Tm ΔssaV, S.Tm Efl, and the mutant strains S.Tm Alpha, S.Tm Delta, and S.Tm Zeta. These data suggest the deficiencies of effector deletion strains cannot be compensated for by the presence of S.Tm WT or other mutants bearing WT-copies of effector genes within the same host animal. As we observed similar phenotypes during single and mixed infection, a mixed inoculum could therefore be used to screen for virulence phenotypes in other experimental contexts in a relatively higher-throughput and logistically simpler manner.

Virulence-dependent migration from the gut to systemic niches

Oral infection represents the natural route of Salmonella infection in mice and other animals, and is characterised by invasion into epithelial tissue and induction of a strong inflammatory response in the gut lumen, followed by migration to systemic sites like the spleen and liver which serve as a niche for bacterial replication (3, 25). While the SPI-1 T3SS is the principal virulence factor that mediates gut infection, the SPI-2 T3SS also plays important roles in the colonisation of the lamina propria and a delayed but potent induction of gut inflammation (10, 26). Similarly, there is a strong requirement for SPI-2 T3SS activity in order for S.Tm to reach systemic niches beyond the gut. To explore how particular SPI-2 effectors might contribute to these phenotypes, we infected mice (Fig 3A) using the well-established streptomycin pre-treatment model of oral infection (10, 27). By day 4 post infection, S.Tm WT had colonised (Fig 3B) both the liver (left) and spleen (right) and replicated to high numbers, while both S.Tm ΔssaV and S.Tm Efl were recovered either at very low numbers or not at all, indicating a strong reliance on SPI-2 T3SS virulence for invasive infection of systemic niches. We observed lower population sizes in mice infected with either S.Tm Alpha or S.Tm Zeta, while S.Tm Delta showed an especially pronounced reduction in bacterial load, similar to that observed for S.Tm ΔssaV and S.Tm Efl. In the mesenteric lymph node (Fig 3C), we observed similar colonisation for all strains with modestly reduced CFU for S.Tm ΔssaV and S.Tm WT Delta. Similarly, we recovered similar numbers in the faeces (Fig 3D) of mice infected with each strain, indicating no significant contribution to gut luminal populations as expected for this model (10). Finally, we measured enteropathy in the cecum tissue and observed a broadly similar degree of pathology in all mice (Fig 3E–F). While this may suggest a limited contribution of SPI-2 effectors to gut pathology, it seems more likely that the strong pathology induced by the SPI-1 T3SS (10, 27) masks more subtle contributions by SPI-2 effectors. Overall, these data suggest that while there are minimal differences in gut colonisation and tissue pathology between multimutant strains, the subsequent migration to systemic niches followed by intracellular replication and survival is strongly dependent on particular cohorts of SPI-2 effectors, while others remain surprisingly dispensable.

Figure 3. SPI-2 effectors support bacterial migration to systemic niches.

A)) Experimental scheme to study virulence of S.Tm mutants during oral infection in vivo. Mice were pre-treated with streptomycin by oral gavage, then received an infectious dose of 5×10^7 S.Tm by oral gavage. Faeces were collected at indicated time points and mice were euthanised at day 4 post infection. B-C) Bacterial loads recovered from B) the liver (left), spleen (right) and C) mesenteric lymph node at day 4 post infection (n = 5 mice per group). Dotted lines denote limit of detection. Horizontal bars denote median. D) Bacterial populations in the gut determined by CFU plating of homogenised faecal samples to selective media. Dotted line at 10² CFU / g faeces denotes conservative limit of detection (n = 5 mice per group). Horizontal bars denote median. E-F) Caecal histology at day 4 post infection. E) combined pathology score based on scoring criteria quantifying submucosal edema, epithelial barrier integrity, goblet cell number, and infiltration of polymorphonuclear granulocytes. F) representative micrographs of cecum samples stained with hematoxylin and eosin. Lu. lumen, S.E. submucosal edema. B-C, E) Statistical differences between WT and indicated groups determined by two-tailed Mann Whitney-U test, (p>0.05 not significant (ns), p<0.05 (*), p<0.01 (**), p<0.001 (***).

Induction of SPI-2 T3SS-driven gut inflammation requires cohorts of effectors

Using our SPI-2 multimutant strains, we observed relatively little difference in the induction of enteropathy in the cecal tissue (Fig 3E–F), which is a hallmark of oral infection in mice and driven largely by the SPI-1 T3SS. We speculated that more subtle contributions of SPI-2 effectors to gut infection, particularly the delayed onset of inflammation, might be masked by the activity of SPI-1 effectors. To explore this, we created a set of SPI-2 multimutant strains that is additionally deficient for SPI-1 T3SS effector translocation by deleting invG, encoding a key structural component of the SPI-1 T3SS (28). Thus, these strains are deficient for SPI-1 effector translocation and additionally lack genes for distinct cohorts of SPI-2 effectors, as in Fig 1C.

These tools allow for the elucidation of subtle phenotypes that are otherwise undetectable against the severe gut pathology induced by SPI-1 effectors. We performed oral infection in streptomycin pre-treated mice as previously (Fig 3A) and observed that both WT and S.Tm ΔinvG are recovered at similar numbers in the liver, spleen, and mesenteric lymph node by day 4 post infection, consistent with previous work (10, 27). Concordantly, there was little difference in CFU recovered for invG-deficient multimutants at these sites (Fig 4A) compared to the respective invG-competent strains (Fig 3B–C). This suggests that SPI-2 remains the primary virulence factor mediating colonisation of systemic sites. By day 4 post infection, we observed a trend towards reduced faecal loads for S.Tm ΔinvGΔssaV (deficient for both SPI-1 and SPI-2 T3SS assembly), consistent with previous reports (29). Interestingly, a similar trend was observed for all invG-deficient multimutants (Fig 4B), perhaps suggesting previously unidentified roles for diverse SPI-2 T3SS effectors in the prolongation of S. Tm gut colonisation.

Figure 4. Effector cohorts contribute to SPI-2 T3SS-dependent inflammation.

A) Bacterial loads recovered from the liver (left), spleen (middle), and mesenteric lymph node (right) at day 4 post infection (n = 5 mice per group). Mice were infected as in Fig. 3A. Dotted lines denote limit of detection. Horizontal bars denote median. B) Bacterial populations in the gut determined by CFU plating of homogenised faecal samples to selective media. Dotted line at 10² CFU / g faeces denotes conservative limit of detection (n = 5 mice per group). Horizontal bars denote median. C) Levels of gut inflammation at indicated days post infection determined by LISA quantification of lipocalin-2 (LCN2). Horizonal dotted line (upper) represents typical threshold of moderately inflamed gut, while dotted line (lower) represents limit of detection. Horizontal bars denote median. D-E) Caecal histology at day 4 post infection. D) combined pathology score based on scoring criteria quantifying submucosal edema, epithelial barrier integrity, goblet cell number, and infiltration of polymorphonuclear granulocytes. E) representative micrographs of cecum samples stained with hematoxylin and eosin. Lu. lumen, S.E. submucosal edema. A, C-E) Statistical differences between WT and indicated groups determined by two-tailed Mann Whitney-U test, (p>0.05 not significant (ns), p<0.05 (*), p<0.01 (**), p<0.001 (***).

Induction of gut inflammation mediated by the SPI-1 T3SS is a well-established hallmark of infection in the streptomycin pre-treatment model, while SPI-1 mutants cause delayed but significant inflammation in a SPI-2 T3SS-dependent manner (26). While the mechanisms of SPI-2 driven inflammation remain enigmatic, this delayed inflammation has been linked to prolonged S.Tm gut colonisation (10, 29–31). Here, we also observed a gradual but strong increase in gut inflammation in the S.Tm ΔinvG strain (thus caused by SPI-2 effectors), while S.Tm ΔinvGΔssaV strain fails to induce gut inflammation, as expected (Fig 4C). For most invG-deficient multimutants we observed a similar trend in which initially uninflamed conditions in the gut gave rise to potent inflammation by day 4 post infection, based on lipocalin-2 ELISA. However, we noted a previously unappreciated trend in which no multimutant produced inflammation to the degree of the SPI-1 or SPI-2 competent strains, which may suggest that diverse perturbations of the SPI-2 effector complement can disrupt the induction of gut inflammation. Regardless, we observed particularly strong phenotypes for S.Tm Alpha and S.Tm Delta, which showed inflammation profiles similar to that of S.Tm ΔinvGΔssaV and greatly diminished relative to S.Tm WT (Fig 4C). To further explore the contributions to gut pathology, we repeated our examination of cecal pathology in these mice (Fig 4D–E). Here, we observed that both S.Tm ΔinvG and S.Tm ΔssaV could produce enteropathy that contributes to the strong level of disease seen in S.Tm WT-infected mice, while mice infected with S.Tm ΔinvGΔssaV retained relatively healthy gut tissue. This healthy state was phenocopied by both S.Tm invG Alpha and S.Tm invG Delta, suggesting that in the absence of the SPI-1 T3SS these effector cohorts contribute to potent SPI-2-dependent gut inflammation and pathology. All other invG-deficient multimutants produced enteropathy approaching that of the control strains, indicating a dispensability of the induction of gut pathology. Together, these data provide initial mechanistic insights into how SPI-2 effectors can contribute to delayed but significant inflammatory phenotypes in the intestinal mucosa.

Iterative deletion of effector genes reveals individual SPI-2 effectors required for gut inflammation

As described in Fig 1C, the multimutant strains were constructed via sequential deletion of individual effector genes. Thus, the creation of a six-fold mutant required the preceding construction of the parent five-fold mutant, and before that a four-fold mutant, et cetera. Each stepwise mutant was preserved in cryostorage, and thus it is possible to use these simpler mutants to determine which particular genes may contribute to the phenotype observed for the complete multimutant. To provide an example of this strategy, we chose to focus on the S.Tm Delta strain, which we showed was deficient for colonisation of systemic niches during intraperitoneal infection (Fig 2), and showed pronounced attenuation for migration from the gut to these systemic niches in oral infection (Fig 3), and was ultimately shown to contribute to SPI-2-dependent gut inflammation and enteropathy (Fig 4). The S.Tm Delta mutant comprises deletions in four effector genes: steC, sseL, sopD2, and gtgE. To determine which effectors contribute to the strong phenotype observed for this multimutant, we used the ΔsteCΔsseL double mutant created during the stepwise construction of S.Tm Delta, and separately constructed a ΔsopD2ΔgtgE double mutant. We infected mice by oral gavage as previously (Fig 3A), and observed that S.Tm ΔsteCΔsseL phenocopied S.Tm WT, while the ΔsopD2ΔgtgE double mutant was recovered in similar numbers to S.Tm ΔssaV (Fig 5A, Fig S2A), and thus these two effectors alone mediate the S.Tm Delta phenotypes. We next used single mutants to determine the relative contribution of each individual effector, and found only partial reductions relative to the WT, demonstrating that both effectors must be deleted together to produce this phenotype, likely due to the functional overlap between these effectors. Finally, we complemented the ΔsopD2ΔgtgE double mutant by sequential chromosomal restoration of WT copies of these genes, and found that the double-complemented ΔsopD2ΔgtgE mutant was restored to approximately WT levels in this infection model (Fig 5A, Fig S2A). Thus, we demonstrate how complex multimutant phenotypes can be interrogated by characterising simpler mutants in a deductive manner,

Figure 5. SPI-2 effectors SopD2 and GtgE contribute to SPI-2 T3SS-dependent inflammation.

A-B) Bacterial loads in the liver (left), spleen (middle), and mesenteric lymph node (right) at day 4 post infection (n = 3–6 mice per group). Mice were infected as in Fig 3A. Dotted lines denote limit of detection. Horizontal bars denote median. C) Levels of gut inflammation at indicated days post infection determined by ELISA quantification of lipocalin-2 (LCN2). Horizonal dotted line (upper) represents typical threshold of moderately inflamed gut, while dotted line (lower) represents limit of detection. Horizontal bars denote median. D) Intracellular populations of bacteria recovered from cecal tissue by gentamicin protection assay. Dotted lines denote limit of detection. Horizontal bars denote median. E-F) Caecal histology at day 4 post infection. E) combined pathology score based on scoring criteria quantifying submucosal edema, epithelial barrier integrity, goblet cell number, and infiltration of polymorphonuclear granulocytes. F) representative micrographs of cecum samples stained with hematoxylin and eosin. Lu. lumen, S.E. submucosal edema. A-C, E) Statistical differences between WT and indicated groups determined by two-tailed Mann Whitney-U test, (p>0.05 not significant (ns), p<0.05 (*), p<0.01 (**), p<0.001 (***).

Previous work has described how SopD2 and GtgE are critical for systemic proliferation following intraperitoneal injection of mice (32), but the contributions of these effectors to gut pathology remains unexplored. Here, we established that gut inflammation during oral infection could be ablated by deletion of both the SPI-1 T3SS and certain cohorts of SPI-2 effectors, including those deficient in S.Tm Delta (Fig 4D–E). Given that deletion of sopD2 and gtgE was sufficient to phenocopy S.Tm Delta in terms of systemic colonisation (Fig 5A), we hypothesised that deletion of these two effectors and the SPI-1 T3SS would similarly be sufficient to reduce gut inflammation to levels seen for the avirulent S.Tm ΔinvGΔssaV. To explore this, we deleted invG from the double mutant S.Tm ΔsopD2ΔgtgE and orally infected mice as previously (Fig 3A). Indeed, while a triple mutant S.Tm ΔinvGΔsopD2ΔgtgE failed to successfully colonise the liver, spleen, and mesenteric lymph nodes in a manner similar to the double mutant S.Tm ΔsopD2ΔgtgE (Fig 5B), there was a marked decrease in gut inflammation whereby the triple mutant failed to induce both early and late stage inflammation, similar to levels seen for the avirulent ΔinvGΔssaV strain (Fig 5C, Fig S2B).

Intracellular reservoirs of S.Tm residing in the cecal tissue can contribute to sustained gut pathology (10, 33). We performed a gentamycin protection assay on infected mucosal tissue (34) to determine the contribution of SopD2 and GtgE to survival of intracellular S.Tm within cecal tissue. Here, we recovered fewer S.Tm ΔinvGΔsopD2ΔgtgE and S.Tm ΔinvGΔssaV relative to S.Tm WT (Fig 5D), perhaps suggesting local replication and survival in cecal tissue is important for sustained gut inflammation. Finally, we discovered a corresponding ablation of enteropathy in the cecum of mice infected with either S.Tm ΔinvGΔsopD2ΔgtgE or ΔinvGΔssaV, confirming that deletion of these two SPI-2 effectors is sufficient for ablation of SPI-2 T3SSdependent gut inflammation (Fig 5E–F). Collectively, these data provide new mechanistic insights into how specific SPI-2 effectors contribute to inflammatory outcomes in the infected gut, and provide a proof of concept for how strong phenotypes observed using S.Tm effector multimutant strains can be rapidly narrowed to candidate effectors responsible for this activity (Fig 6).

Figure 6. Graphical summary effector cohort contributions to inflammation and systemic colonisation.

A) Genotypes of six SPI-2 T3SS effector multimutants generated by successive rounds of P22 transduction. Collectively, these strains cover all described SPI-2 effectors in the SL1344 background. B) Summary of phenotypic data described in Fig 2–5. S.Tm WT causes high levels of gut inflammation and migrates from the gut to colonise systemic tissue, in a manner dependent on the SPI-2 T3SS. Several multimutants show similar levels of virulence to WT. S.Tm Alpha, Delta, and Zeta showed reduced colonisation of systemic niches, while SPI-2 T3SS-dependent inflammation was impaired during infection with S.Tm Alpha and Delta. C) S.Tm WT relies on intracellular niches to induce inflammation and achieve colonisation of systemic tissue. A mutant deficient for SopD2 and GtgE fails to maintain the intracellular niche, leading to reduced levels of gut inflammation and impaired colonisation of systemic sites.

Discussion

The intracellular lifestyle of pathogenic Salmonella enterica spp. is driven by the activity of SPI-2 T3SS effectors, but efforts to characterise the function of individual effectors have proven complicated, either by instances of interdependency or redundancy between effectors, or by the logistical difficulties in characterising more than 30 proteins across different experimental contexts. Here, we designed SPI-2 effector multimutants to explore which effector cohorts are critical for pathogenesis in a logistically easier manner, and showed how such tools can be used to find a minimal set of effectors responsible for key phenotypes, using SPI-2-dependent promotion of gut inflammation as an example.

In designing and constructing SPI-2 effector multimutants, we loosely grouped effectors that reportedly contribute to similar functions. For example, the six effectors deleted in S.Tm Alpha (sseF, sseG, sifA, sseJ, pipB2, steA) collectively contribute to development and maintenance of the SCV, while S.Tm Beta is deficient for six effectors (sseK1, sseK2, sseK3, gtgA, gogA, pipA) that antagonise different aspects of host cell signalling pathways. The rational grouping of deletions is dependent on the reported function of each effector (Fig 1A), and many effectors have functions that are unknown or disputed. Thus, it is possible that unreported functions or inter-effector relationships may contribute to phenotypes that are masked by the current design. Similarly, undiscovered effectors likely exist and the activity of those effectors may contribute to shared phenotypes. While we observed strong phenotypes for several multimutants (S.Tm Alpha, Delta, and Zeta), other mutants (S.Tm Beta, Gamma, and Epsilon) representing approximately half of the known SL1344 effector repertoire phenocopied S.Tm WT in different infection models. It is possible that these effectors do have phenotypes in other infection models (e.g. in a different host species, or during chronic infection), or that the impact is too subtle to measure via the methods used here. Ultimately, further careful characterisation of these mutants in different infectious contexts and using different methodology will be useful to fully characterise the role of these effectors. An alternative explanation for the lack of strong phenotypes for several mutants tested here is the context-dependency of deletion mutants, described elsewhere as the effector network hypothesis (35–37). Effectors of the gut pathogen Citrobacter rodentium reportedly form robust networks that can tolerate the loss of a number of effectors, but deletion of an increasingly large number of effectors ultimately causes a collapse of virulence phenotypes back to an avirulent level. Importantly, this same study describes context-dependent essentiality of effectors, in which deletion of a single effector may or may not produce a strong phenotype depending on the availability of other effectors (35). Certainly this possibility may also exist for the effector cohort of S.Typhimurium, and this may complicate the comparison of studies such as ours with previous and future work.

Other studies have employed the strategy of sequentially deleting multiple genes encoding effector proteins, though the design and rationale for these efforts varies. Chen et al (15) iteratively deleted the majority of known SPI-2 effectors in a single genetic background, producing an ‘effectorless’ S. Tm SL1344 derivative that is otherwise competent for SPI-2 T3SS assembly and function. Restoring selected effectors to this effectorless strain by complementation allowed for the identification of a ‘minimal network’ of effectors that was sufficient for virulence during oral infection (sifA, sseFG, steA, sopD2, and spvBCD) (15). Elsewhere, separate studies have focused on deleting core sets of effectors to produce a strain that is reduced to ΔssaV-levels of virulence. Strong phenotypes have thus been reported for a seven-fold deletion strain (S.Tm ΔsseF ΔsseG ΔsifA ΔsopD2 ΔsseJ ΔsteA ΔpipB2) (19), and separately for a five-fold deletion (S.Tm ΔsifA ΔspvB ΔsseF ΔsseJ ΔsteA, created in a SPI-1 T3SS-deficient background) (20). These efforts represent important steps in understanding how individual effectors contribute to strong collective phenotypes, but they are less useful in contexts where screening for individual effectors is important. The advantage of our strategy described here is that the activity of all effectors can be explored in a single experimental context, and responsible effectors can subsequently be identified by use of simpler mutants. We anticipate that these multimutant strains could be used to screen for SPI-2 T3SS effector functions in other experimental contexts and infection models, for example to study chronic carriage in genetically resistant mice, intracellular replication in vitro in various host cell types, virulence phenotypes in various genetically-modified mouse backgrounds, or performance in reporter assays that measure cell signalling outcomes.

Our work highlights the strong contribution of SopD2 and GtgE to virulence in both oral and systemic infection. The molecular target of both of these effectors is the host GTPase Rab32 (32, 38), which restricts intracellular bacteria via its nucleotide exchange factor BLOC-3 (39). The acquisition of SopD2 and GtgE by S.Typhimurium permits the complementary antagonism of Rab32, in which SopD2 functions as a GAP mimic to limit Rab32 GTPase activity, while GtgE directly proteolytically cleaves Rab32 (32, 38). In the absence of these effectors, Rab32 and the co-factor BLOC-3 facilitate the delivery of itaconate to the SCV (40, 41), which restricts intravacuolar S.Tm by metabolic disruption of the glyoxylate shunt and thereby reduces bacterial replication (42). Thus, effector-mediated disruption of the Rab32-BLOC-3-itaconate axis represents an important strategy for the success of intracellular S.Tm populations. While it had been established that SopD2 and GtgE were important for promoting intracellular survival in systemic niches (32), the contributions of these effectors to gut pathology and inflammation remained unknown.

Here, we show that S.Tm Delta and S.Tm ΔsopD2ΔgtgE cannot reach systemic niches following oral infection (Fig 3), and this mutant also show severe attenuation in systemic sites during intraperitoneal infection (Fig 2), similar to S.Tm ΔssaV (10, 26). Given that itaconate-mediated disruption of intracellular S.Tm restricts actively replicating bacteria (42), this may suggest that bacterial replication is an important activity for successful migration from the gut to systemic niches, or that cell-intrinsic host defenses impose particularly stringent control of intracellular bacteria during these migration events or during subsequent bacterial growth in systemic niches. Importantly, our current work extends previous knowledge by discovering a previously unknown function of SopD2 and GtgE in eliciting mucosal inflammation in a SPI-1 T3SS-deficient background (Fig 4C–E, Fig 5B–F). This finding will enable future work at molecular and cellular scales to explore why the S.Tm ΔinvGΔsopD2ΔgtgE mutant is drastically impaired at inducing gut inflammation (Fig 5C, Fig 5E–F). It may be that a reduction of bacterial numbers in the gut tissue causes a corresponding impairment of gut inflammation, but we observed only a modest reduction in CFU in the mesenteric lymph node (Fig 5B) and faeces (Fig S2B), and similarly a slight reduction in the intracellular population within caecal tissue (Fig 5D). Future work should focus on the molecular mechanisms that underpin how SopD2 and GtgE promote S. Tm growth and survival in the gut, on how this affects inflammation and mucosal pathology, and on how host cell defences (e.g. itaconate) prevent pathogen migration to systemic sites.

While we observed the strongest deficiency for S.Tm Delta, we also found that both S.Tm Alpha and S.Tm Zeta were significantly reduced in the liver and spleen during both oral (Fig 3) and systemic infection models (Fig 2). We observed that S.Tm Alpha colonised these sites at approximately S.Tm ΔssaV levels by day 2 post infection, then increased modestly in the following days, suggesting this mutant can still replicate intracellularly to some extent, despite lacking the principal effectors mediating SCV maturation and expansion. Alternatively, it may be possible that this increase is attributable to extra-vacuolar or extracellular replication, or to cell-to-cell spread via efferocytosis or simply bacterial egress and reinvasion (43–45). Future work, especially using in vitro models of infection, will be useful to determine the replicative defect of this strain. We observed that S.Tm Alpha ΔinvG was greatly attenuated at inducing mucosal inflammation by day 4 post infection, similar to S.Tm Delta ΔinvG, and this is consistent with previous work linking some of these effectors to gut inflammation (20). Future work is needed to understand which minimal subset of effectors contribute to this activity, and to understand how effectors responsible for intracellular replication contribute to the induction of gut inflammation. Separately, we observed a similarly strong phenotype for S.Tm Zeta, which is deficient for the regulator SpvR and thus impaired for expression of genes on the virulence plasmid regulon spvABCD (46, 47). Effectors on this operon reportedly have a range of functions: SpvB is an ADP-ribosyltransferase which causes disruption to the host cytoskeleton and also promotes cell death via apoptosis (48–50); SpvC has anti-inflammatory functions via its phosphothreonine lyase activity against several MAPK signalling proteins (51–53); while SpvD acts as a cysteine protease to inhibit NF-kB signalling, possibly by targeting host exportin Xpo2 (54, 55). In this study, we show that S.Tm Zeta is strongly attenuated at colonising systemic niches but remains competent for inducing SPI-2 T3SS-dependent gut inflammation, which suggests these activities are not necessarily linked, but further work is needed to understand how the reported molecular activities of these proteins contributes to these disease phenotypes.

In conclusion, we describe how multimutants created by sequential deletion of functionally linked genes can be easily used in a variety of experimental contexts to gain new insights into bacterial virulence. We show that effector cohorts linked to intracellular replication and protection from host cell defenses are important for migration from the gut to systemic niches, and these same cohorts also contribute to SPI-2 T3SS-dependent gut inflammation. Finally, we show that the effectors SopD2 and GtgE together are necessary for these phenotypes, providing new insights into how the SPI-2 T3SS contributes to gut infection and migration within the host. We anticipate that these multimutants will prove useful in other experimental contexts to provide new insights into bacterial virulence strategies.

Methods

Strains used in this study

All bacterial strains used in this study were S. Tm SL1344 SB300 (56) or derivatives and are listed in Table 1. Strains in cryostorage at −80 °C were streaked to selective media and subsequently used to inoculate overnight cultures comprising lysogeny broth (LB) medium containing appropriate antibiotics (50 μg/ml streptomycin, 50 μg/ml ampicillin, 50 μg/ml kanamycin, or 15 μg/ml chloramphenicol, as required).

Table 1.

Strains used in this study

Strain name	Strain number	Relevant genotype	Resistance*	Reference
S.Tm SL1344	SB300	Wild-type	Sm	(56)
S.Tm ΔinvG	SB161	ΔinvG	Sm	(28)
S.Tm ΔssaV	M2730	ΔssaV	Sm	(60)
S.Tm ΔinvGΔssaV	M2702	ΔinvG ΔssaV	Sm	(60)
S.Tm Efl	NA170	ΔspvR ΔpipAB ΔpipB2 ΔgtgA ΔsifB ΔgtgEsseI ΔsteBsseJ ΔpipD ΔsseL ΔgogBsteE ΔsopD2 Δslrp ΔsteA ΔsteDsseK2 ΔsspH2 ΔsseK3 ΔsteC ΔcigR ΔsseK1 ΔsrfJ ΔsseFG ΔsifA	Sm	(15)
S. Tm Alpha clone 1	T2978	ΔsifA ΔsseJ ΔsseFG ΔpipB2 ΔsteA	Sm	This study
S. Tm Alpha clone 2	T2979	ΔsifA ΔsseJ ΔsseFG ΔpipB2 ΔsteA	Sm	This study
S. Tm Beta clone 1	T2918	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA ΔpipA	Sm	This study
S. Tm Beta clone 2	T2919	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA ΔpipA	Sm	This study
S. Tm Gamma clone 1	T2974	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE ΔgogB	Sm	This study
S. Tm Gamma clone 2	T2988	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE ΔgogB	Sm	This study
S. Tm Delta clone 1	T2982	ΔsopD2 ΔgtgE ΔsteC ΔsseL	Sm	This study
S. Tm Delta clone 2	T2984	ΔsopD2 ΔgtgE ΔsteC ΔsseL	Sm	This study
S. Tm Epsilon clone 1	T2968	ΔsteB ΔcigR ΔsspH2 ΔpipB ΔsifB ΔslrP	Sm	This study
S. Tm Epsilon clone 2	T2966	ΔsteB ΔcigR ΔsspH2 ΔpipB ΔsifB ΔslrP	Sm	This study
S. Tm Zeta clone 1	T2860	ΔspvR	Sm	This study
S. Tm Zeta clone 2	T2861	ΔspvR	Sm	This study
S.Tm WT Tag 1	T3415	WISH 2	Sm, Amp	(61)
S.Tm ΔssaV Tag 2	T2949	ΔssaV WISH 7	Sm, Amp	This study
S.Tm Efl Tag 3	Z8294	ΔspvR ΔpipAB ΔpipB2 ΔgtgA ΔsifB ΔgtgEsseI ΔsteBsseJ ΔpipD ΔsseL ΔgogBsteE ΔsopD2 Δslrp ΔsteA ΔsteDsseK2 ΔsspH2 ΔsseK3 ΔsteC ΔcigR ΔsseK1 ΔsrfJ ΔsseFG ΔsifA WISH 3	Sm, Amp	This study
S.Tm Alpha Tag 4	T7400	ΔsifA ΔsseJ ΔsseFG ΔpipB2 ΔsteA WISH 5	Sm, Amp	This study
S.Tm Beta Tag 5	T2964	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA ΔpipA WISH 49	Sm, Amp	This study
S.Tm Gamma Tag 6	T7403	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE ΔgogB WISH 19	Sm, Amp	This study
S.Tm Delta Tag 7	T7401	ΔsopD2 ΔgtgE ΔsteC ΔsseL WISH 10	Sm, Amp	This study
S.Tm Epsilon Tag 8	T7402	ΔsteB ΔcigR ΔsspH2 ΔpipB ΔsifB ΔslrP WISH 15	Sm, Amp	This study
S.Tm Zeta Tag 9	T2950	ΔspvR WISH 16	Sm, Amp	This study
S.Tm Alpha ΔinvG	T2990	ΔsifA ΔsseJ ΔsseFG ΔpipB2 ΔsteA ΔinvG	Sm	This study
S.Tm Beta ΔinvG	T2954	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA ΔpipA ΔinvG	Sm	This study
S. Tm Gamma ΔinvG	T2992	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE ΔgogB ΔinvG	Sm	This study
S. Tm Delta ΔinvG	T2994	ΔsopD2 ΔgtgE ΔsteC ΔsseL ΔinvG	Sm	This study
S. Tm Epsilon ΔinvG	T2996	ΔsteB ΔcigR ΔsspH2 ΔpipB ΔsifB ΔslrP ΔinvG	Sm	This study
S.Tm Zeta ΔinvG	T2998	ΔspvR ΔinvG	Sm	This study
S.Tm ΔsteC ΔsseL	Z8278	ΔsteC ΔsseL	Sm	This study
S.Tm ΔsopD2 ΔgtgE	T2816	ΔsopD2::aphT ΔgtgE::cat	Sm, Kan, Cm	This study
S.Tm ΔsopD2::sopD2 ΔgtgE::gtgE	T2856	ΔsopD2::sopD2 ΔgtgE::gtgE	Sm	This study
S.Tm ΔsopD2 ΔgtgE ΔinvG	T2824	ΔsopD2::aphT ΔgtgE::cat ΔinvG	Sm, Kan, Cm	This study
S.Tm Alpha parent 1 clone 1	Z6643	ΔsseFΔsseG::aphT	Sm, Kan	This study
S.Tm Alpha parent 1 clone 2	Z6644	ΔsseFΔsseG::aphT	Sm, Kan	This study
S.Tm Alpha parent 2 clone 1	Z6655	ΔsseFΔsseG::aphT ΔsifA::cat	Sm, Kan, Cm	This study
S.Tm Alpha parent 2 clone 2	Z6656	ΔsseFΔsseG::aphT ΔsifA::cat	Sm, Kan, Cm	This study
S.Tm Alpha parent 3 clone 1	Z6681	ΔsseFΔsseG ΔsifA	Sm	This study
S.Tm Alpha parent 3 clone 2	Z6682	ΔsseFΔsseG ΔsifA	Sm	This study
S.Tm Alpha parent 4 clone 1	Z6693	ΔsseFΔsseG ΔsifA ΔsseJ::aphT	Sm, Kan	This study
S.Tm Alpha parent 4 clone 2	Z6694	ΔsseFΔsseG ΔsifA ΔsseJ::aphT	Sm, Kan	This study
S.Tm Alpha parent 5 clone 1	Z8161	ΔsseFΔsseG ΔsifA ΔsseJ::aphT ΔpipB2::cat	Sm, Kan, Cm	This study
S.Tm Alpha parent 5 clone 2	Z8162	ΔsseFΔsseG ΔsifA ΔsseJ::aphT ΔpipB2::cat	Sm, Kan, Cm	This study
S.Tm Alpha parent 6 clone 1	Z8199	ΔsseFΔsseG ΔsifA ΔsseJ ΔpipB2	Sm	This study
S.Tm Alpha parent 6 clone 2	Z8200	ΔsseFΔsseG ΔsifA ΔsseJ ΔpipB2	Sm	This study
S.Tm Alpha parent 7 clone 1	T2976	ΔsseFΔsseG ΔsifA ΔsseJ ΔpipB2 steA::aphT	Sm, Kan	This study
S.Tm Alpha parent 7 clone 2	T2977	ΔsseFΔsseG ΔsifA ΔsseJ ΔpipB2 steA::aphT	Sm, Kan	This study
S.Tm Beta parent 1 clone 1	Z5608	ΔsseK2::cat	Sm, Cm	This study
S.Tm Beta parent 1 clone 2	Z5600	ΔsseK1::cat	Sm, Cm	This study
S.Tm Beta parent 2 clone 1	Z5628	ΔsseK2::cat ΔsseK3::aphT	Sm, Kan, Cm	This study
S.Tm Beta parent 2 clone 2	Z5624	ΔsseK1::cat ΔsseK2::aphT	Sm, Kan, Cm	This study
S.Tm Beta parent 3 clone 1	Z5640	ΔsseK2 ΔsseK3	Sm	This study
S.Tm Beta parent 3 clone 2	Z5636	ΔsseK1 ΔsseK2	Sm	This study
S.Tm Beta parent 4 clone 1	Z5648	ΔsseK2 ΔsseK3 ΔsseK1::aphT	Sm, Kan	This study
S.Tm Beta parent 4 clone 2	Z5650	ΔsseK1 ΔsseK2 ΔsseK3::aphT	Sm, Kan	This study
S.Tm Beta parent 5 clone 1	Z5654	ΔsseK2 ΔsseK3 ΔsseK1	Sm	This study
S.Tm Beta parent 5 clone 2	Z5656	ΔsseK1 ΔsseK2 ΔsseK3	Sm	This study
S.Tm Beta parent 6 clone 1	T2900	ΔsseK2 ΔsseK3 ΔsseK1 gtgA::aphT	Sm, Kan	This study
S.Tm Beta parent 6 clone 2	T2901	ΔsseK1 ΔsseK2 ΔsseK3 gtgA::aphT	Sm, Kan	This study
S.Tm Beta parent 7 clone 1	T2904	ΔsseK2 ΔsseK3 ΔsseK1 gtgA::aphT gogA::cat	Sm, Kan, Cm	This study
S.Tm Beta parent 7 clone 2	T2905	ΔsseK1 ΔsseK2 ΔsseK3 gtgA::aphT gogA::cat	Sm, Kan, Cm	This study
S.Tm Beta parent 8 clone 1	T2914	ΔsseK2 ΔsseK3 ΔsseK1 ΔgtgA ΔgogA	Sm	This study
S.Tm Beta parent 8 clone 2	T2915	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA	Sm	This study
S.Tm Beta parent 9 clone 1	T2916	ΔsseK2 ΔsseK3 ΔsseK1 ΔgtgA ΔgogA pipA::aphT	Sm, Kan	This study
S.Tm Beta parent 9 clone 2	T2917	ΔsseK1 ΔsseK2 ΔsseK3 ΔgtgA ΔgogA pipA::aphT	Sm, Kan	This study
S.Tm Gamma parent 1 clone 1	Z6539	ΔsteD::aphT	Sm, Kan	This study
S.Tm Gamma parent 1 clone 2	Z6540	ΔsteD::aphT	Sm, Kan	This study
S.Tm Gamma parent 2 clone 1	Z8117	ΔsteD::aphT ΔsrgE::cat	Sm, Kan, Cm	This study
S.Tm Gamma parent 2 clone 2	Z8118	ΔsteD::aphT ΔsrgE::cat	Sm, Kan, Cm	This study
S.Tm Gamma parent 3 clone 1	Z8193	ΔsteD ΔsrgE	Sm	This study
S.Tm Gamma parent 3 clone 2	Z8194	ΔsteD ΔsrgE	Sm	This study
S.Tm Gamma parent 4 clone 1	Z8211	ΔsteD ΔsrgE ΔsseI::aphT	Sm, Kan	This study
S.Tm Gamma parent 4 clone 2	Z8212	ΔsteD ΔsrgE ΔsseI::aphT	Sm, Kan	This study
S.Tm Gamma parent 5 clone 1	Z8215	ΔsteD ΔsrgE ΔsseI::aphT ΔsrfJ::cat	Sm, Kan, Cm	This study
S.Tm Gamma parent 5 clone 2	Z8216	ΔsteD ΔsrgE ΔsseI::aphT ΔsrfJ::cat	Sm, Kan, Cm	This study
S.Tm Gamma parent 6 clone 1	Z8221	ΔsteD ΔsrgE ΔsseI ΔsrfJ	Sm	This study
S.Tm Gamma parent 6 clone 2	Z8222	ΔsteD ΔsrgE ΔsseI ΔsrfJ	Sm	This study
S.Tm Gamma parent 7 clone 1	Z8227	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE::aphT	Sm, Kan	This study
S.Tm Gamma parent 7 clone 2	Z8228	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE::aphT	Sm, Kan	This study
S.Tm Gamma parent 8 clone 1	T2902	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE	Sm	This study
S.Tm Gamma parent 8 clone 2	T2903	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE	Sm	This study
S.Tm Gamma parent 9 clone 1	T2972	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE gogB::aphT	Sm, Kan	This study
S.Tm Gamma parent 9 clone 2	T2986	ΔsteD ΔsrgE ΔsseI ΔsrfJ ΔsteE gogB::aphT	Sm, Kan	This study
S.Tm Delta parent 1 clone 1	Z6535	ΔsteC::aphT	Sm, Kan	This study
S.Tm Delta parent 1 clone 2	Z6536	ΔsteC::aphT	Sm, Kan	This study
S.Tm Delta parent 2 clone 1	Z8270	ΔsteC::aphT ΔsseL::cat	Sm, Kan, Cm	This study
S.Tm Delta parent 2 clone 2	Z8271	ΔsteC::aphT ΔsseL::cat	Sm, Kan, Cm	This study
S.Tm Delta parent 3 clone 1	Z8278	ΔsteC ΔsseL	Sm	This study
S.Tm Delta parent 3 clone 2	Z8279	ΔsteC ΔsseL	Sm	This study
S.Tm Delta parent 4 clone 1	Z8286	ΔsteC ΔsseL sopD2::aphT	Sm, Kan	This study
S.Tm Delta parent 4 clone 2	Z8289	ΔsteC ΔsseL sopD2::aphT	Sm, Kan	This study
S.Tm Delta parent 5 clone 1	T2804	ΔsteC ΔsseL sopD2::aphT gtgE::cat	Sm, Kan, Cm	This study
S.Tm Delta parent 5 clone 2	T2805	ΔsteC ΔsseL sopD2::aphT gtgE::cat	Sm, Kan, Cm	This study
S.Tm Epsilon parent 1 clone 1	Z6525	ΔsteB::cat	Sm, Kan	This study
S.Tm Epsilon parent 1 clone 2	Z6526	ΔsteB::cat	Sm, Kan	This study
S.Tm Epsilon parent 2 clone 1	Z8115	ΔsteB::cat ΔcigR::aphT	Sm, Kan, Cm	This study
S.Tm Epsilon parent 2 clone 2	Z8116	ΔsteB::cat ΔcigR::aphT	Sm, Kan, Cm	This study
S.Tm Epsilon parent 3 clone 1	Z8191	ΔsteB ΔcigR	Sm	This study
S.Tm Epsilon parent 3 clone 2	Z8192	ΔsteB ΔcigR	Sm	This study
S.Tm Epsilon parent 4 clone 1	Z8209	ΔsteB ΔcigR ΔsspH2::aphT	Sm, Kan	This study
S.Tm Epsilon parent 4 clone 2	Z8210	ΔsteB ΔcigR ΔsspH2::aphT	Sm, Kan	This study
S.Tm Epsilon parent 5 clone 1	Z8219	ΔsteB ΔcigR ΔsspH2::aphT pipB::cat	Sm, Kan, Cm	This study
S.Tm Epsilon parent 5 clone 2	Z8220	ΔsteB ΔcigR ΔsspH2::aphT pipB::cat	Sm, Kan, Cm	This study
S.Tm Epsilon parent 6 clone 1	Z8223	ΔsteB ΔcigR ΔsspH2 ΔpipB	Sm	This study
S.Tm Epsilon parent 6 clone 2	Z8224	ΔsteB ΔcigR ΔsspH2 ΔpipB	Sm	This study
S.Tm Epsilon parent 7 clone 1	T2924	ΔsteB ΔcigR ΔsspH2 ΔpipB slrP::aphT	Sm, Kan	This study
S.Tm Epsilon parent 7 clone 2	T2925	ΔsteB ΔcigR ΔsspH2 ΔpipB slrP::aphT	Sm, Kan	This study
S.Tm Epsilon parent 8 clone 1	T2935	ΔsteB ΔcigR ΔsspH2 ΔpipB slrP::aphT sifB::cat	Sm, Kan, Cm	This study
S.Tm Epsilon parent 8 clone 2	T2936	ΔsteB ΔcigR ΔsspH2 ΔpipB slrP::aphT sifB::cat	Sm, Kan, Cm	This study
S.Tm Zeta parent 1 clone 1	Z8264	ΔspvR::aphT	Sm, Kan	This study
S.Tm Zeta parent 1 clone 2	Z8265	ΔspvR::aphT	Sm, Kan	This study

^*Resistances: Sm = 50 μg/ml streptomycin, Amp = 50 μg/ml ampicillin, Cm = 15 μg/ml chloramphenicol, Kan = 50 μg/ml kanamycin.

Strain construction

All primers used for strain construction and validation are listed in Table 2. Single mutant strains were constructed using the lambda-red protocol, in which a gene of interest is replaced with an antibiotic resistance cassette flanked by FRT sites (57). Primers were designed with approximately 40 base pairs flanking the gene of interest and 20 base pairs of an antibiotic resistance cassette. Plasmids pKD3 or pKD4 were used as DNA templates in PCR reactions to amplify products suitable for gene replacement with cassettes encoding chloramphenicol (pKD3) or kanamycin (pKD4) resistance via homologous recombination. S.Tm SL1344 carrying the plasmid pKD46 was incubated for 3 hours at 30 °C in LB containing 50 μg/ml ampicillin and 10 mM arabinose. Cells were washed in ice cold water and concentrated via centrifugation, then transformed with purified DNA via electroporation. Cells were let to recover in LB for 1 hour at 37°C, then plated to LB agar plates containing either 50 μg/ml kanamycin or 15 μg/ml chloramphenicol, as required. Colonies were picked and genotyped via PCR with primers flanking the replaced gene of interest. P22 lysates were generated from these mutant strains, and used to transfer the deletion of interest to a clean strain of S.Tm SL1344, which was subsequently passaged via replating several times to promote clearance of phage and re-genotyped via PCR. Multimutants were similarly constructed by repeated rounds of P22 transduction as above. Strains bearing both chloramphenicol and kanamycin resistance (i.e. after two rounds of P22 transduction) had these resistance cassettes removed via electroporation with pCP20 encoding the Flp recombinase flippase. All strains were re-genotyped after each round of Flp-FRT recombination, to avoid unwanted recombination events at FRT scar sites.

Table 2.

Primers used in this study

Primer name	Sequence	Source	Purpose
slrP_FW	GACGACTGTGACCTCTTATTTAAA	This study	Genotyping of slrP deletion
slrP_RV	AAAAAGCGCTACAGGCGTTGG	This study	Genotyping of slrP deletion
sopD2_FW	TTTCTAAACCCAGGCTGATTCAA	This study	Genotyping of sopD2 deletion
sopD2_RV	CCATGTAATGGGTTTGACTGAAA	This study	Genotyping of sopD2 deletion
gtgA_FW	TAGGCAATGAGTCCGGCCA	This study	Genotyping of gtgA deletion
gtgA_RV	CCTTGGCAGGGCTCGCT	This study	Genotyping of gtgA deletion
sseI_FW	TATTGTGAAATTAAGACCAGGAAGA	This study	Genotyping of sseI deletion
sseI_RV	GATGTTGTTGTCGATCTCCAC	This study	Genotyping of sseI deletion
gtgE_FW	ATGCGACAATACAATAAAAACATATCA	This study	Genotyping of gtgE deletion
gtgE_RV	AGCTTCCCCGTAGGAAATTGA	This study	Genotyping of gtgE deletion
pipA_FW	GTTGGCTTTGTCTGAATCATAGC	This study	Genotyping of pipA deletion
pipA_RV	GCCCCTTTGTTTTTTTAGGCG	This study	Genotyping of pipA deletion
pipB_FW	CAAAGCTCTAAATACAAAAATCACC	This study	Genotyping of pipB deletion
pipB_RV	TGAAACTTAGGGGCGGGGTT	This study	Genotyping of pipB deletion
sifA_FW	GCGCCCGCAGTTGAGATAAA	This study	Genotyping of sifA deletion
sifA_RV	GCCTGGCAAGAGGTTACTCA	This study	Genotyping of sifA deletion
sseF_FW	CGGATGCCTCATGGAGTGA	This study	Genotyping of sseF deletion
sseG_RV	CATCGTAAGGATACTGGCAACA	This study	Genotyping of sseG deletion
srgE_FW	ATGAGTTATTGACCACTGAATTTTCT	This study	Genotyping of srgE deletion
srgE_RV	GAGTAACTTTACGACAATTGCTTC	This study	Genotyping of srgE deletion
steA_FW	CTGAAAATGTATGCCTTTGAGCAA	This study	Genotyping of steA deletion
steA_RV	TTCTGAGAATCTCTTTGCGACAC	This study	Genotyping of steA deletion
sifB_FW	AAAGCAAAAATCAGGTGTTTCACC	This study	Genotyping of sifB deletion
sifB_RV	TTCGTTCCATAGTAAATCCATTATTC	This study	Genotyping of sifB deletion
steB_FW	CTTAGTCAATGTGGACAAAAAATCAAA	This study	Genotyping of steB deletion
steB_RV	ACGGCAGAACTTCCCATAGC	This study	Genotyping of steB deletion
sseJ_FW	AAGAAGCGTAATTCCATATACACC	This study	Genotyping of sseJ deletion
sseJ_RV	CAATCGGCAGCAAAGATAGCAT	This study	Genotyping of sseJ deletion
steC_FW	CAAACTGGCAAATCAAAGAGTCT	This study	Genotyping of steC deletion
steC_RV	TTGCATCTCCGCTACAGGCT	This study	Genotyping of steC deletion
sseK3_FW	TTAAGCCCCCCCTAACCAAGTAAAAACTATCGTTTCAGAT	This study	Genotyping of sseK3 deletion
sseK3_RV	TTCACCACGGCACGCAGGTCATCCAATTTAATGGAGGTAC	This study	Genotyping of sseK3 deletion
sseK2_FW	GTCGGACTCAGGACTTAGCATTGTGACGTTAACGTTTAAA	This study	Genotyping of sseK2 deletion
sseK2_RV	TGAAAGTTCTGTAGAGAAACTTGAATGTGAAATTGAGGTA	This study	Genotyping of sseK2 deletion
steD_FW	CCTATTTAGATGATGGCTTAGCG	This study	Genotyping of steD deletion
steD_RV	CTATATAAGTCATAAGCCTCTGGT	This study	Genotyping of steD deletion
sspH2_FW	TCTGCACCTTCTGAAGCCC	This study	Genotyping of sspH2 deletion
sspH2_RV	GTCATCCGGATATTTCACCTGT	This study	Genotyping of sspH2 deletion
sseL_FW	GCAATATCTCTTGTATCGACGC	This study	Genotyping of sseL deletion
sseL_RV	GACAGCAGGTTGGCGATGT	This study	Genotyping of sseL deletion
gogB_FW	TAGGTTCTAAATCTTGCCTGAATG	This study	Genotyping of gogB deletion
gogB_RV	AAGTTGGCATGTAGTCTAGAGTTA	This study	Genotyping of gogB deletion
steE_FW	TCTTGTTGTGATGAGATTCGTATATA	This study	Genotyping of steE deletion
steE_RV	AAATCACACAATCCGGACTGAG	This study	Genotyping of steE deletion
gogA_FW	GCTTTTAGCTTAATTGATTGCGTG	This study	Genotyping of gogA deletion
gogA_RV	ATTCCATTTGAGGCTGCCATTC	This study	Genotyping of gogA deletion
pipB2_FW	TTATTATGTAACCAGACGTAAAGGG	This study	Genotyping of pipB2 deletion
pipB2_RV	TTTTACCGTCGCATACTCCTGT	This study	Genotyping of pipB2 deletion
cigR_FW	ATAAGCTGCTGTTGGCGAGC	This study	Genotyping of cigR deletion
cigR_RV	CGTAGCGAGTCAAACCTCAC	This study	Genotyping of cigR deletion
sseK1_FW	CTGGCAGGGTATTTATGTATCCTCCGGTTAATGCTTAGTT	This study	Genotyping of sseK1 deletion
sseK1_RV	AATGCCGTATATCTCCGTTCTGAACAGCACTGCGATTTTA	This study	Genotyping of sseK1 deletion
srfJ_FW	GACTGGAAACAGCGCTTTATTGATGCC	This study	Genotyping of srfJ deletion
srfJ_RV	GTCGCTTCATTAAATCCCAGCT	This study	Genotyping of srfJ deletion
spvR_FW	CATAATCCTATCCAGTAACCCC	This study	Genotyping of spvB deletion
spvR_RV	GGTGAACTACCGCTATGGAG	This study	Genotyping of spvB deletion
pipB_red_FW	CCTATAAGGAGTCGGCTCACTTCCATAAGAAGGAATCAAAATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of pipB
pipB_red_RV	TGTTTGAATACTTCTTGTTTATAAAATCCCTTTATCTCGATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of pipB
srgE red F W	ACTACACTGGGAAATCGTTGCGTGGTGGTTCCGGAGATAGATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of srgE
srgE_red_RV	AATGCCAGACTTCCGCTACCAGACGGTATACACAGTATTATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of srgE
sseJ_red_FW	TTATTTGCTAAAGCGTGTTTAATAAAGTAAGGAGGACACTATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sseJ
sseJ_red_RV	AGCTGTGTTTTGCTCAAGGCGTACCGCAGCCGATGGAACTTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sseJ
gtgA_red_FW	AATGTTAATTCCATGTAATAAAAAGGATGTGTAACTCATCATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of gtgA
gtgA_red_RV	GTGTTGTAGCATCGTGGGATTTTGCATTTTTTGATGAGTGTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of gtgA
gtgE_red_FW	TATAATTACATTAACAAAATTACTATTCGGCGAGTATATTATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of gtgE
gtgE_red_RV	AATTATCTTGGTAAAGGTTAACTATCATAAAATGGTACACTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of gtgE
sseL red F W	ATTGAGCATACCGCAATTTCACAGCTTATATACAGAAGAGATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sseL
sseL_red_RV	AGGATAAGAGCCTAATGGGATAGGCTCTAAGTACTCACCATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sseL
gogB_red_FW	ATTGAAAAAGCGCATGAAAATAGGATTCCAACCAGCCATAATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of gogB
gogB_red_RV	GCTCTATATATAAATATATTAATTGCATATTTTTTTAAAGTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of gogB
gogA_red_FW	AATGTTAATTCCATGTAATAAAAAGGATGTGTAACTCATCATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of gogA
gogA_red_RV	GTGTTGTAGCATCGTGGGATTTTGCATTTTTTGATGAGTGTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of gogA
sseFsseG_re_d_FW	AATGGTTGATACTCTTATTGCTTAAATAACAGAACGAAATATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sseFsseG
sseFsseG_red_RV	TTTAGAAAGCAATGAACATCCGGTATATACCTGAAAACGATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sseFsseG
sspH2_red_FW	CGGACAGATACTATATGTAAATTTATAAAGGTTTTTTGTTATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sspH2
sspH2_red_RV	GGAATATCTTTGTCGCACCGCACCTCATTCACCTGGTGCATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sspH2
sopD2_red_FW	TTGGATCTTGCTTTCGCGGTAAATAATCAAGGGAGTTATTATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sopD2
sopD2_red_RV	AAAAAAGGCTCCATATCAGTGGGGCCTTTTTAATGACTTTTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sopD2
steA_red_FW	GACATATAAAGCTATTGAGCAAAATTTGAAGGAGTAGGATATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of steA
steA_red_RV	AGTCTGATTTCTAACAAAACTGGCTAAACATAAACGCTTTTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of steA
steB_red_FW	TCATTATTGTTAGTTTGAAATCAATCTCAGGTAATAATCCATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of steB
steB_red_RV	CTGTGGAATAGCAATGCCGGGAAGGACATGGCATGACACTTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of steB
steC_red_FW	TTGCATGTGTATTATAATAAATTTTCAGAGGATGAGACATATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of steC
steC_red_RV	TGTGCCCCCGGCGATTCGCAGAAAAGAACGGAACTAAATGTGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of steC
sifB_red_FW	CCAGTAATGAAGTATCATATAATCACTTGTGGTCTACATTATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of sifB
sifB_red_RV	ATTGCCAGGGGATTGTAAATCCATACTATTTATGGTGTGATGTGTAGGCTGGAGCTGCTTC	This study	Lambda red replacement of sifB
slrP_red_FW	TCTGTTACTTTAGGTTACGTTCAGATCAGGTAGGGAAAATATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of slrP
slrP_red_RV	GTAAACAGGCTCTCTCCCTCTTCTGATAAACTGCGTTCAGATATGAATATCCTCCTTAGTTCC	This study	Lambda red replacement of slrP
BamHI_sopD2_FW	ATTTGGATCCACAGGCGCGAAACCAGTC	This study	Complementat ion insert for sopD2 with restriction sites
NotI_sopD2_RV	ATTTGCGGCCGCATCAAAGGCGATGTTCTGAACTT	This study	Complementat ion insert for sopD2 with restriction sites
BamHI_gtgE_FW	ATTTGGATCCTTCGGCATCGAGGTCAAAGG	This study	Complementat ion insert for gtgE with restriction sites
NotI_gtgE_RV	ATTTGCGGCCGCGGGACAGTCATCCGTTTTTAAC	This study	Complementat ion insert for gtgE with restriction sites

Chromosomal complementation of effector genes

Mutant strains deficient for sopD2 and gtgE were complemented with these genes via subcloning into a suicide vector followed by conjugation and homologous recombination into recipient strains. Briefly, PCR was used to generate amplicons comprising either sopD2 or gtgE with 1000 bp flanking regions and suitable restriction sites. Amplicons were cloned into vector pSB890 via T4 DNA ligase reactions, then used to transform electrocompetent E. coli SM10λpir. Overnight cultures of recipient strains were prepared, then combined with cultures of donor strains. Selection with sucrose and tetracycline was used to identify successful conjugation and recombination events, which were confirmed by genotyping PCR.

Whole-genome sequencing and bioinformatics analysis

Overnight cultures of multimutant strains were pelleted by centrifugation and genomic DNA was extracted using a QIAmp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions. Library preparation and short-read Illumina sequencing were performed by BMKGENE to confirm deletion of target genes and assess the degree of other polymorphisms in the genome. The resulting raw reads were cleaned by removing adaptor sequences, low-quality-end trimming and removal of low-quality reads using BBTools v 38.18 using the parameters trimq=14, maq=20, maxns=0 and minlength=45. (Bushnell, B. BBMap. Available from: https://sourceforge.net/projects/bbmap/.). The genetic changes in the strains as compared to the reference genome (GCF_000210855.2) were identified using breseq (v. 0.38) run in consensus mode with default parameters (58). Sequencing data is available from the European Nucleotide Archive (ENA) using the accession number PRJEB83585.

Animal husbandry

Animal experiments were conducted in accordance with the Swiss Federal Government guidelines in animal experimentation law (SR 455.163 TVV). Protocols used were approved by the Cantonal Veterinary Office of the canton Zurich, Switzerland (Kantonales Veterinäramt ZH licenses 108/2022, 109/2022, 158/2019, 193/2016). Animals were bred and kept under specific pathogen free conditions in individually ventilated cages (EPIC and RCHCI facilities, ETH Zurich). Wild-type C57BL/6J mice were used for all in vivo experiments described here. Mice were aged 8–10 weeks at the start of experiments, and a balanced number of males and females was used. Mice were monitored daily and scored for health status in a range of criteria per animal licence requirements, and euthanised prior to experimental endpoint if necessary.

Animal infection experiments

Mice were infected and treated following the experimental schemes described in each figure and corresponding figure legend. For infections requiring intraperitoneal injection, overnight cultures were incubated on a rotating wheel at 37 °C for 12 hours. Overnight cultures were washed in PBS then diluted to achieve approximately 10⁴ CFU/ml. For single infections (Fig 2B), mice received 100 μl of this washed solution by intraperitoneal injection giving an infectious dose of approximately 10³ CFU. For mixed infections (Fig 2D), mice received 100 μl of washed solution to achieve an inoculum of 10³ CFU comprising equivalent volumes of each strain, as required. For infections requiring oral gavage (Fig 3–5), mice were gavaged with 25mg streptomycin one day prior to infection. Overnight cultures were used to inoculate subcultures which were incubated on a rotating wheel at 37 °C for 4 hours. Subcultures were washed in PBS then aliquoted to prepare inocula comprising approximately 5×10⁷ CFU in a 50 μl volume, which was delivered to the mice by oral gavage. Faeces was collected in pre-weighed tubes containing 1 ml PBS and homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). Mice were euthanised at indicated time-points, and organs were aseptically removed. CFU per organ was quantified by plating to MacConkey agar containing 50 ug / ml streptomycin. Data for liver, spleen, and mesenteric lymph node is presented as CFU per organ, while data for faeces is presented as CFU per gram of faeces.

Measurement of genomic barcodes by qPCR

Overnight cultures were inoculated with homogenates of indicated organs to enrich for bacterial genetic material, comprising 100 μl homogenate in 2 ml LB and appropriate antibiotics. Cultures were incubated for 12 hours at 37 °C on a rotating wheel. Overnight cultures were pelleted by centrifugation and genomic DNA was extracted using a QIAmp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions. The abundance of each genetic tag was measured by qPCR as described previously (59). Relative proportions of each tag were calculated by dividing the DNA copy number of each tag by the sum of all tags within a sample.

Histology

Tissue samples were embedded in O.C.T. (Sakura), snap-frozen in liquid nitrogen, and stored at −80 °C. Cryosections were prepared at 5 μm width and mounted on glass slides, then stained with hematoxylin and eosin (H&E). Pathological evaluation was performed in a blinded manner based on the criteria described previously (27). Briefly, samples were scored on four criteria: degree of submusocal edema; infiltration of polymorphonuclear granulocytes into the lamina propria; number of goblet cells; and integrity of the epithelia. Scores for each category were combined to achieve a total score representing the pathological state of each sample.

Lipocalin-2 ELISA

Homogenised faecal samples were thawed from storage at −20 °C and centrifuged to remove faecal material. Lipocalin-2 levels in the supernatant were quantified using a Lipocalin-2 ELISA kit (R & D Systems) according to the manufacturer’s instructions. All samples were analysed in duplicate at three different dilutions (undiluted, 1:20, and 1:400), and concentrations were determined by four parameter logistic regression curve.

Gentamicin protection assay for cecal tissue

Cecal tissue was aseptically extracted from mice following euthanisation, and incubated for 30 minutes in PBS containing 400 μg/ml gentamicin to kill extracellular bacteria. Tissue was then washed rigorously six times in PBS, then homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). CFU was quantified by plating to MacConkey agar containing 50 ug / ml streptomycin.

Statistical analysis and software

GraphPad Prism was used to perform statistical tests and generate graphs. Where applicable, statistical significance was assessed by Mann-Whitney U test, as described in figure legends. BioRender was used to generate some graphical elements, including experimental schemes and Fig 6. Figures were assembled in Abode Illustrator.

Funding Statement

This work has been funded by grants from the Swiss National Science Foundation (310030B_173338/1, 310030_192567, 10.001.588) to WDH, and also supported by the NCCR Microbiomes, funded by the Swiss National Science Foundation (51NF40_180575; to SS and WDH). JPMN was supported by a Swiss Government Excellence Scholarship (2019.0843). NMA was funded by the National Institute of Health (AI083359) and The Welch Foundation (I-1704).