Exogenous salicylic acid reduces cadmium content in spinach (Spinacia oleracea L.) shoots under cadmium stress

Abstract

Background

Consumption of leafy vegetables is a primary route of cadmium (Cd) exposure in the human body. Salicylic acid (SA) is a major stress signaling molecule that alleviates Cd toxicity in various plants. Our study aimed to investigate the effects of different SA concentrations on spinach growth, cadmium accumulation, and stress resistance physiology under cadmium stress (50 µmol/L).

Results

Cd stress significantly markedly decreased spinach growth and biomass, reduced its photosynthetic efficiency, increased activities of antioxidative enzymes, and upregulated the relative expression of several genes involved in cadmium absorption and transport compared to the control. The exogenous application of SA mitigated the harmful effects of Cd in spinach. 0.8 and 1.6 mmol/L SA significantly increased spinach root length, plant height, and biomass and decreased the Cd content in shoots by 30.03 and 17.35% compared to the Cd-treated group. Moreover, SA alleviated the yellowing of leaves caused by Cd stress. Exogenous SA ameliorated Cd toxicity in spinach by reducing reactive oxygen species, malondialdehyde, proline, and soluble protein levels. Exogenous SA application reduced Cd absorption in spinach leaves by downregulating the expression of genes involved in Cd transport, such as SoHMA4-like, SoNramp3.1-like, SoNramp6-like, and SoNramp7.2-like. Principal component analysis and correlation analysis showed that exogenous SA application under Cd stress was correlated with plant Cd content, photosynthetic pigment content, and relative expression of Cd absorption and transportation-related genes.

Conclusions

To summarize, these findings indicate that SA mitigates Cd toxicity in spinach by reversing the adverse effects of Cd stress on plant growth and reducing Cd accumulation in the shoots.

Introduction

The contamination of farmland with cadmium (Cd) is increasing due to intensified agricultural practices globally. Cadmium accumulation results in substantial adverse effects on animals and plants [1]. Elevated Cd levels affect crop yield and quality and can accumulate in the human body through the food chain, posing a risk to both agricultural soil ecology and health [2, 3]. Therefore, it is imperative to prevent Cd absorption in the human body through the consumption of contaminated crops or vegetables [4]. Numerous studies have demonstrated that high concentrations of Cd affect plant germination, inhibit plant growth, and promote yellowing of plant tissues and organs and leaf senescence, ultimately reducing plant yield [5–7]. Cd stress reduces the chlorophyll content and biomass of Salix variegata Franch by disrupting chloroplast structure [8]. Furthermore, prolonged exposure to Cd stress can result in flower abortion [9]. Cadmium is primarily absorbed and transported through transporters of essential plant nutrients such as zinc, iron, copper, and manganese into different cell compartments and plant tissues. These transport mechanisms are regulated by interactions with plant mineral nutrients and are modulated at transcriptional and post-translational levels [10]. Previous studies have indicated that exogenous plant hormones, such as salicylic acid, 5-aminolevulinic acid, jasmonic acid, tryptophan, and abscisic acid, activate plant defense mechanisms and reduce cadmium toxicity in plants [11–16].

Salicylic acid is an important defense-regulating hormone in plants [17]. The role of SA in local immunity, systemic acquired resistance, and responses to biotic and abiotic plant stress responses is associated with several protective properties against several plant diseases and stresses [18]. Ma et al. reported that exogenous SA enhanced salt stress tolerance in pepper by regulating ion absorption, gene expression, and post translational modifications [19]. However, previous studies have shown that SA-related signals are associated with plant adaptation to heavy-metal stress [20]. Exogenous SA treatment alleviated cadmium toxicity in potatoes by increasing their relative water content and SA content while reducing the contents of malondialdehyde and reactive oxygen species [11]. Moreover, SA reduced Cd accumulation in rice by regulating OsHD-Zip, and OsLCD expression [21]. At the same time, SA could enhance Cd resistance in rice by regulating the binding capacity of Cd to the cell wall [22]. However, there are few reports on the effects of SA on the transport and accumulation of Cd in vegetables under Cd stress.

Consumption of leafy vegetables is a primary route for Cd exposure in the body [23, 24]. Previous research demonstrated that leafy vegetables exhibited the highest heavy metal accumulation capacity, whereas melon vegetables had the lowest accumulation [25]. Liu et al. reported that edible leaves or stems of crops are markedly contaminated with Cd compared to seeds or fruits [26]. As a representative of leafy vegetables, Spinach is highly susceptible to Cd pollution compared to other crops, posing a risk to human health throughout the food chain [27]. Waheed et al. demonstrated that exposure to 50 µmol/L Cd stress significantly reduced the biomass, plant height, leaf area, and leaf length of spinach, consistent with our preliminary test results [28]. Therefore, we used 50 µmol/L Cd to induce Cd stress in this study. However, the precise physiological mechanisms of exogenous SA in reducing the detrimental effects of Cd on spinach growth and its accumulation in spinach have not been elucidated. Therefore, our study aimed to explore the effects of SA on spinach growth indicators, photosynthetic parameters, antioxidant enzyme activity, and cadmium content under cadmium stress conditions to provide a basis for safe vegetable production.

Materials and methods

Materials

The experimental material used in this study was the “Greenway TY771” spinach variety. Seeds were purchased from Chengdu Seed Station (Chengdu, China). The Hoagland nutrient solution was used as a nutrient source during spinach cultivation, and CdCl₂·2.5H₂O (analytical grade) was used as the Cd source. SA was obtained from Sigma-Aldrich (St. Louis, MO, USA).

Experimental design

This study was conducted at the Chengdu Campus of Sichuan Agricultural University between August 2022 and December 2023. Uniform-sized healthy spinach seeds were washed thrice with ultrapure water, soaked with clean ultrapure water for 6 h, and evenly distributed in petri dishes containing wet filter paper. The petri dishes were then placed in a 24 ℃ artificial incubator for germination. Subsequently, the sprouted seeds were planted in a seedling tray containing perlite and vermiculite (v: v = 1:1) and transferred to an artificial incubator. Half-strength Hoagland nutrient solution was added daily to the tray, and the incubator was set to 24/18 ℃ (day/night) and a 14/10 h (day/night) photoperiod under a 200 µmol/m²/s light intensity. Seedlings exhibiting rapid and consistent growth at the four-true-leaf stage were selected and transplanted into 10 × 10 cm (depth × height) nutrient containers containing perlite. One plant was transplanted to each container, and the containers were transferred to a plastic dish (with a height of 8 cm) containing full-strength Hoagland’s nutrient solution, which was replaced every 3 days.

Three days after the transplantation of the seedlings, the spinach leaves were sprayed with ultrapure water and SA solutions at different concentrations (0.2 mmol/L, 0.4 mmol/L, 0.8 mmol/L, and 1.6 mmol/L). After 3 days of pretreatment, all treatment groups except the CK (control without Cd and SA spraying) were treated with a Hoagland nutrient solution containing 50 µmol/L Cd and different concentrations of an SA solution. The treatments were administered once every three days, for a total of three times. Different concentrations of the SA solution were sprayed four times (pretreatment once and treatment thrice after adding Cd) during the experiment. We ensured that at least 30% of the nutrient solution flowed out to prevent Cd accumulation in the nutrient bowl during nutrient solution replacement. The six treatments applied in this experiment were as follows: CK (the control without Cd and SA spraying), Cd (50 µmol/L Cd and without SA spraying), Cd + SA0.2 (50 µmol/L Cd + 0.2 mmol/L SA), Cd + SA0.4 (50 µmol/L Cd + 0.4 mmol/L SA), Cd + SA0.8 (50 µmol/L Cd + 0.8 mmol/L SA) and Cd + SA1.6 (50 µmol/L Cd + 1.6 mmol/L SA). The temperature was maintained at 24/18 ℃ (day/night), with a relative humidity of 75 – 80%, a light cycle of 14/10 h (day/night), and the strength of illumination in the artificial culture room was maintained at 300 µmol/m²/s throughout the experiment. The pots were randomly rearranged regularly to reduce the impact of edge effects and effectively prevent and control pests and diseases.

Sample analysis

Spinach samples were collected 10 days after the final exogenous SA treatment, and the growth and morphological indicators of the entire plants were evaluated. Subsequently, fresh root and shoot samples were freeze-dried in liquid nitrogen and stored at -80 ℃ in an ultra-low temperature freezer to determine physiological and quality indicators. Shoot, and root samples were fixed in an oven at 105 ℃ for 15 min and then dried at 75 ℃ to a constant weight to determine Cd content.

Morphological observations and determination of plant growth and biomass

Ten days after the last spray application of SA, we performed a phenotypic assessment regarding the growth status and leaves of the spinach plants and recorded the observed phenotypic differences. The plant height and root length of spinach plants were measured to the nearest millimeter using a ruler. Subsequently, the spinach shoots and roots were washed with tap water and rinsed thrice with deionized water, followed by oven-drying at 105 ℃ for 15 min and 75 ℃ to constant weight for dry biomass determination.

Determination of photosynthetic pigment contents

The second and third functional leaves from the shoot tip (n = 3) were harvested to determine the contents of photosynthetic pigments (chlorophyll a, chlorophyll b, and carotenoid) using the ethanol and acetone extraction methods described previously [28]. Briefly, the leaves were soaked in equal volumes of ethanol and acetone for 24 h until they were bleached. Then, the spectrophotometry values were measured in the ethanol and acetone solutions and used to calculate the photosynthetic pigment content.

Determination of photosynthetic parameters

The leaves used for the determination of photosynthetic pigment contents were used to determine the net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), and intercellular CO₂ concentration (Ci) using a LI-6400XT portable photosynthetic system (LI-COR Inc., Lincoln, NE). The photosynthetic parameters were manually set at 25 ℃, 1000 µmol/m²/s light intensity, and a CO₂ concentration of 400 µmol/mol [28].

Determination of membrane peroxidation

The proline content in the plants was determined using the sulfosalicylic acid method, whereas the soluble protein and sugar contents were determined using the Coomassie brilliant blue G-250 method and anthrone-ethyl acetate methods, respectively. Malondialdehyde levels were determined using the thiobarbituric acid method. All assays were conducted according to the methods described by Tang et al. and Liang et al. [28, 29].

Determination of antioxidant enzyme activities and levels of reactive oxygen species

Antioxidant enzyme activity assays were conducted following previously described methods [29]. Superoxide dismutase (SOD) activity was evaluated using the nitroblue tetrazolium method, peroxidase (POD) activity using the guaiacol method, and catalase (CAT) activity using the ultraviolet (UV) absorption method. The O₂⁻ and H₂O₂ contents were determined by the trace method using a reagent kit purchased from Beijing Solarbio Science &Technology Co., Ltd. (Beijing Solarbio Science &Technology Co., Ltd. Beijing, China).

Determination of cd content

Plant samples (0.5 g) were digested in a 4:1 nitric acid: perchloric acid solution (v: v) for 12 h to a clear solution, filtered and diluted to a volume of 50 mL. Subsequently, the Cd content was then determined using an iCAP 6300 ICP spectrometer (Thermo Scientific, Waltham, MA, USA) [30]. The translocation factor (TF) was determined as the shoot Cd content divided by the root Cd content [31].

Determination of the relative expression of genes related to cd uptake and transport in spinach

Total RNA was extracted from all samples using an RNA prep pure plant kit (TIANGEN Biochemical Technology Co., Ltd, Beijing, China), according to the manufacturer’s instructions. The RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit (TAKARA Bio Co., Ltd., Japan). All primers were synthesized by Shenggong Biotechnology Co., Ltd. (Shenggong Biotechnology Co., Ltd., Beijing, China), as shown in Table 1. Biomarker 2X SYBR Green Fast qPCR Mix fluorescent dyes were purchased from Yugong Biotechnology Co., Ltd (Yugong Biotechnology Co., Ltd., Lianyungang, China). The 18 S rRNA gene was used as an internal reference [32], and the 2^−ΔΔCT method was used to calculate the relative expression levels of target genes.

Table 1.

Primers used for real-time fluorescence quantitative polymerase chain reaction (RT-qPCR) validation

Gene	Gene ID	Forward primer (5’-3’)	Reverse Primer (5’-3’)
SoHMA3-like	LOC110778383	CAATGGCTAGCAGTTGCAGC	CTATAGTGCCAGCTTCGGTGT
SoHMA4-like	LOC110801776	GCATCAGAGAGGCTTCTGTCG	CCAATCCCCATAAGGTGGAAGC
SoNramp3.1-like	LOC110798462	GGACCCTGATGAAAATGAAGCAGA	TGCTTCCACCTCTATAACCCCATAT
SoNramp3.2-like	LOC110793365	CCACCAACCAATTATTCGAGGATG	TGCTATGCTCATCAGAAACCCTG
SoNramp6-like	LOC110805077	ATGGCGACGTCAAATGAGCAG	AGACAAGGAACCCAGGACCCA
SoNramp7.2-like	LOC110801340	AGAAGGAATCGAGAAGGTCTGGA	AGTAGGAGCTTCATCAAAGTGTTTG
18 S		CCATAAACGATGCCGACCAG	AGCCTTGCGACCATACTCCC

Statistical analyses

Data were compiled and organized using Excel 2016 software (Microsoft Corp., Redmond, WA, USA), and statistical analyses were conducted using SPSS 25.0 statistical software (IBM, Armonk, NY, USA). Differences across the groups were determined by one-way ANOVA followed by Duncan’s multiple range test at a p < 0.05 significance level. Data are presented as the means of three biological replicates ± standard error (SE). Principal component and correlation analyses were performed to explore the relationship between various indicators. Figures were generated using Origin Pro 2021 software (Northampton, Massachusetts, USA).

Results

SA mitigates the impact of cd on plant biomass and growth

Cd stress significantly inhibited spinach growth compared with the control (Fig. 1A) and caused yellowing of leaf margins and accelerated leaf senescence (Fig. 1B). Spinach plants treated with Cd exhibited significantly reduced plant height, root length, shoot biomass, and root biomass (Fig. 1C, D, E, F). Application of 0.8 mmol/L SA alleviated the growth inhibition induced by Cd on spinach and alleviated leaf senescence (Fig. 1A, B). Moreover, the addition of 0.8 mmol/L SA significantly increased spinach plant height by 9.26% compared to the group treated with Cd alone (Fig. 1C). Spinach root length and biomass proportionally increased with increased SA concentrations applied under Cd stress (Fig. 1D, E). Application of 1.6 mmol/L SA increased spinach’s root length and root biomass by 36.04% and 81.85% compared to the group treated with Cd alone (Fig. 1D, F). These results indicate that exogenous SA can alleviate the growth inhibition of Cd on spinach by promoting its growth, abrogating leaf senescence, and increasing plant height, root length, shoot biomass, and root biomass.

Fig. 1.

Effects of Cd and SA on phenotype and growth of spinach plants under different treatment conditions. (A) Plant phenotype. (B) Leaf phenotype. (C) Plant height. (D) Root length. (E) Shoot biomass (DW). (F) Root biomass (DW). CK: the control without Cd and SA spraying; Cd: 50 µmol/L Cd and without SA spraying; Cd + SA0.2: Cd + 0.2 mmol/L SA; Cd + SA0.4: Cd + 0.4 mmol/L SA; Cd + SA0.8: Cd + 0.8 mmol/L SA; Cd + SA1.6: Cd + 1.6 mmol/L SA. Data are average values ± SE of 3 replicate samples. Values with different letters are significantly different (p < 0.05). Same as below

Exogenously applied SA application increases photosynthetic parameters

Cd stress significantly reduced the Ci, Tr, Gs, and Pn parameters in spinach leaves by 17.80%, 38.01%, 45.03%, and 30.77%, respectively, compared to the CK group (Fig. 2). Ci, Tr, and Gs levels in spinach leaves under Cd stress conditions initially increased and then decreased with an increase in the concentration of applied SA (Fig. 2A, B, C). Application of 0.8 mmol/L SA increased Ci, Tr, and Gs in spinach leaves by 21.54%, 63.82%, and 95.43%, respectively, relative to the group only treated with Cd t (Fig. 2A, B, C). In addition, exogenous spraying of 0.8 mmol/L and 1.6 mmol/L SA under Cd stress increased the Pn of spinach leaves by 36.15% and 36.83%, respectively, compared to the group treated with Cd only (Fig. 2D). These results indicate that the exogenous application of SA could alleviate the damage caused by Cd stress to spinach by enhancing photosynthesis in leaves.

Fig. 2.

Effects of Cd and SA on photosynthesis of spinach plants under different treatment conditions. (A) Ci, intercellular CO₂ concentration; (B) Tr, transpiration rate; (C) Gs, stomatal conductance; (D) Pn, net photosynthetic rate

Exogenously applied SA increases the content of photosynthetic pigment constituents

Cd stress significantly reduced the contents of chlorophyll and carotenoid in spinach leaves relative to the CK group (Fig. 3). Chlorophyll a, chlorophyll b, total chlorophyll, and carotenoid contents in spinach leaves initially increased and then decreased with an increase in the concentration of exogenously applied SA under Cd stress (Fig. 3). Spray application of 0.8 mmol/L SA increased the contents of chlorophyll a, chlorophyll b, total chlorophyll, and carotenoid in spinach leaves by 42.64%, 47.61%, 44.28%, and 56.97%, respectively, compared with the CK group (Fig. 3). These results indicated that the application of exogenous SA abrogated the Cd-mediated photosynthetic inhibition in spinach by increasing the content of photosynthetic pigments in spinach leaves, with 0.8 mmol/L SA identified as the optimal concentration.

Fig. 3.

Effects of Cd and SA on photosynthetic pigment content of spinach plants under different treatment conditions. (A) Chlorophyll a content; (B) Chlorophyll b content; (C) Total chlorophyll content; (D) Carotenoid content

Exogenously applied SA alleviates membrane lipid peroxidation and modulates the levels of osmoregulatory compounds

Plants treated with Cd alone exhibited a significant increase in the content of proline, malondialdehyde, soluble sugar, and soluble proteins by 52.26%, 34.28%, 26.56%, and 98.42%, respectively, compared with the CK group (Fig. 4). Malondialdehyde, soluble sugar, and soluble protein contents in the leaves of spinach subjected to Cd stress decreased gradually with an increase in the concentration of exogenously applied SA (Fig. 4B, C, D). Treatment of the plants with 1.6 mmol/L SA decreased the contents of proline, malondialdehyde, soluble sugars, and soluble proteins in spinach leaves by 23.49%, 20.70%, 37.19%, and 24.07%, respectively, compared to plants treated with Cd alone (Fig. 4). Therefore, exogenous SA could alleviate the toxicity of Cd to spinach by reducing the levels of osmoregulatory and lipid peroxidation compounds that accumulated under Cd stress.

Fig. 4.

Effects of Cd and SA on the osmotic adjustment substance of spinach plants under different treatment conditions. (A) Proline; (B) Malondialdehyde; (C) Soluble sugar; (D) Soluble protein

Exogenously applied SA modulates the contents of reactive oxygen species

Cd stress markedly increased the levels of O₂⁻ and H₂O₂ in spinach by 48.68% and 40.29%, respectively, compared with the CK group (Fig. 5A, B). Increased exogenously applied SA concentration decreased the O₂^·- content in plants under Cd stress. Treatment of spinach plants with 0.8 mmol/L SA and 1.6 mmol/L SA decreased the O₂^·− content by 18.58% and 24.93% compared to the group treated with Cd alone, respectively (Fig. 5A). Similarly, the H₂O₂ content decreased with an increase in SA concentration. Application of 0.4 mmol/L, 0.8 mmol/L, and 1.6 mmol/L SA decreased the H₂O₂ content by 13.15%, 16.41%, and 17.81% compared to the group only treated with Cd, respectively (Fig. 5B). These results indicate that SA could alleviate the oxidative damage caused by Cd in spinach leaves by reducing the levels of O₂⁻ and H₂O₂ under Cd stress conditions.

Fig. 5.

Effects of Cd and SA on reactive oxygen content and activity of antioxidant enzymes in spinach plants under different treatment conditions. (A)O₂^·− content; (B)H₂O₂ content, (C) Peroxidase (POD) activity, (D) Superoxide dismutase (SOD) activity, (E) Catalase (CAT) activity

Exogenously applied SA modulated the activities of antioxidant enzymes to alleviate oxidative stress induced by Cd stress

Spinach leaves exhibited significantly increased POD, SOD, and CAT activities after treatment with Cd by 93.65%, 4.24%, and 39.93%, respectively, compared with the CK group (Fig. 5C, D, E). Notably, SA significantly reduced the CAT activity of spinach leaves subjected to Cd stress. The CAT activity was reduced by 22.60% and 15.56% after treatment with 0.8 mmol/L and 1.6 mmol/L SA, respectively, compared with the Cd-treated group (Fig. 5E). Moreover, the application of 0.4 mmol/L SA reduced the POD activity of spinach leaves under Cd stress by 3.44% compared with the Cd-treated group (Fig. 5C). SA enhanced the SOD activity of spinach under Cd stress, with 0.8 mmol/L and 1.6 mmol/L SA resulting in a 31.00% and 27.99% increase, respectively, compared with the group only treated with Cd (Fig. 5D). These results indicated that SA could decrease the oxidative damage to spinach caused by Cd by modulating the activities of antioxidant enzymes.

SA reduces cd accumulation in spinach shoots

Initially, the Cd content in shoots and the translocation factor of spinach treated with Cd decreased, but it subsequently increased in response to an increase in SA concentration (Fig. 6A, C). In contrast, no significant changes were observed in the Cd content of the root (Fig. 6B). Under Cd stress, the application of 0.4 mmol/L, 0.8 mmol/L, and 1.6 mmol/L SA resulted in a decrease in Cd content in spinach shoots by 10.77%, 30.03%, and 17.35%, respectively, compared to Cd treatment alone (Fig. 6A). Application of 0.8 and 1.6 mmol/L SA to spinach plants subjected to Cd stress decreased Cd translocation by 31.79% and 21.96%, respectively (Fig. 6C). These findings indicated that exogenous SA could reduce the Cd content in spinach shoots by reducing Cd translocation, with the most optimal effects observed at 0.8 mmol/L SA.

Fig. 6.

Effects of Cd and SA on cadmium (Cd) content and Cd translocation factor. (A) Cd content in the shoot, (B) Cd content in the root, (C) Translocation factor

Exogenously applied SA modulated the expression of genes implicated in cd uptake and transport

Cd stress significantly increased the relative expression levels of SoHMA3-like, SoHMA4-like, SoNramp3.2-like, and SoNramp6-like genes by 114.40%, 341.83%, 194.87%, and 258.22%, respectively compared to CK (Fig. 7A, B, C, D). Conversely, Cd stress down-regulated the relative expression of SoNramp3.1-like and SoNramp7.2-like compared to CK (Fig. 7F, I). Exogenous SA increased SoHMA3-like expression. Compared to Cd alone, SoHMA3-like expression increased by 38.45% and 49.69% after application of 0.8 and 1.6 mmol/L SA (Fig. 7D). On the contrary, exogenous SA application downregulated the expression of SoHMA4-like, SoNramp3.1-like, SoNramp6-like, and SoNramp7.2-like compared with the group treated with Cd only. The expression of SoHMA4-like, SoNramp3.1-like, SoNramp6-like, and SoNramp7.2-like decreased by 63.10%, 35.15%, 25.20%, and 68.03% after treatment with 1.6 mmol/L SA compared to the group treated solely with Cd (Fig. 7E, F, H, I). Based on these findings, SA could alleviate Cd stress on spinach by regulating the expression levels of genes involved in Cd absorption and transport.

Fig. 7.

Effects of different exogenous SA on gene expression of SoHMA3-like (A), SoHMA4-like (B), SoNramp3.1-like (C), SoNramp3.2-like (D), SoNramp6 (E), SoNramp7.2-like (F) in spinach under cadmium (Cd) stress

Principal component (PCA) and correlation analysis

PCA was performed to explore the combined impact of the variation in various physiological indicators and the expression of genes involved in Cd uptake and transport in spinach responses under Cd stress after treatment with different concentrations of SA. PC1 and PC2 explained 61.1% and 18.4% of the variance, respectively. The different treatments were distinctly clustered, with insignificant differences observed between 0.8 mmol/L and 1.6 mmol/L SA. However, the other treatments exhibited significantly different clustering along the PCA axis (Fig. 8A). A significant negative correlation was observed between the CK and Cd treatments in PC1. Additionally, the 0.8 mmol/L and 1.6 mmol/L SA treatments exhibited significant negative correlations with the Cd treatment in PC1 and PC2. Most indicators lay on the negative side of PC1 and, at the same time, on the positive side of PC2 (Fig. 8B). The Cd content in spinach, translocation factor, and expression of genes associated with Cd uptake and transport (SoHMA3-like, SoNramp3.2-like, and SoNramp6-like) were positively related with PC1 and PC2 (Fig. 8B). The PCA results showed that the impact of SA could be explained by changes in Cd content, photosynthetic pigment content, and relative expression levels of genes involved in Cd uptake and transport.

Fig. 8.

PCA analysis and correlation analysis. (A) PCA score plot; (B) PCA loading plot, (C) Correlation heat map

Correlation analysis was performed to further comprehensively visualize the relationship between the various indicators of Cd stress, with the results presented as a heat map (Fig. 8C). Plant growth and biomass were positively correlated with the contents of photosynthetic pigments (p ≤ 0.01) (Fig. 8C). Conversely, plant growth and biomass were significantly negatively correlated with CAT activity levels, reactive oxygen species content (H₂O₂ and O₂^·−), Cd content, and the expression of SoHMA4-like and SoNramp6-like (p ≤ 0.01) (Fig. 8C). The Cd content was significantly positively correlated with the levels of proline, malondialdehyde, soluble proteins, POD, CAT activities, and H₂O₂ and O₂^·−levels (Fig. 8C). In addition, POD and SOD activities and the expression of SoNramp3.1-like and SoNramp7.2-like exhibited insignificant correlation with most indicators (p ≤ 0.01) (Fig. 8C).

Discussion

Crop yield can be majorly affected by the excessive accumulation of heavy metals in the soil. Numerous studies have demonstrated that the exogenous application of different compounds can reduce heavy metal accumulation in vegetables [33]. The results of our study indicated that cadmium stress negatively affected the growth of spinach, significantly reducing plant biomass and height and accelerating leaf senescence and yellowing at the leaf edges. Cd stress markedly affected wheat growth, causing a significant decrease in biomass accumulation, consistent with the present results [34]. Recent studies reported the role of salicylic acid as a protective agent against abiotic (cold, heat, salt, heavy metal) stress and biotic stress in plants [35]. Notably, the application of salicylic acid could mitigate the adverse effects of high temperatures on rapeseed by increasing the activity of antioxidant enzymes [36]. Salicylic acid conferred cadmium tolerance on soybean and rice seedlings [37, 38]. Li et al. demonstrated that the Cd-stress-mediated growth inhibition in potatoes was significantly alleviated after exogenous SA application [11]. Similarly, the present study demonstrated that the growth and biomass of spinach subjected to Cd stress significantly increased after treatment with 0.8 and 1.6 mmol/L SA compared to plants subjected to Cd stress alone (Fig. 1). These findings indicate that SA alleviates the growth inhibition effect induced by Cd stress in spinach.

The photosynthesis process is extremely sensitive to changes in the environment. Cd stress affects plant photosynthesis through two processes. Firstly, Cd causes stomatal limitations, which limits the entry of CO₂ into stomata or the release of O₂, thereby affecting photosynthesis [39]. Secondly, Cd affects the process through non-stomatal limitations by reducing chlorophyll content through the disruption of the thylakoid structure in chloroplasts, ultimately inhibiting photosynthesis [40]. In our study, cadmium stress substantially reduced the levels of photosynthetic parameters and contents of photosynthetic pigments. As demonstrated in a previous study, exogenous SA reversed the reduction in plant photochemical efficiency induced by Cd stress and alleviated Cd toxicity in Arabidopsis thaliana [17]. In addition, Obono et al. reported that under cadmium stress conditions, exogenously applied SA significantly increased the chlorophyll content in Chinese cabbage, thereby alleviating Cd toxicity in the plants [41]. In the current study, 0.8 and 1.6 mmol/L SA significantly enhanced the photosynthetic rate of spinach under cadmium stress conditions and increased the contents of photosynthetic pigments, consistent with previous findings. These observations can be attributed to the effects of SA in alleviating Cd stress in plants by increasing the contents of photosynthetic pigments, such as chlorophyll, and enhancing carbamylating enzyme activities, ultimately increasing the rate of photosynthesis [42–44].

Cadmium stress promotes excessive production of H₂O₂ and O₂⁻ in plants, which can damage proteins, lipids, and other biomolecules, exacerbating the Cd toxicity in plants [45]. Malondialdehyde is a critical indicator of cellular lipid peroxidation, offering insights into the degree of damage to plant cell membranes [46]. Su et al. observed that Cd stress significantly increased H₂O₂ and O₂^·− and proline contents in tobacco leaves and roots [40]. In the current study, Cd stress significantly increased the content of reactive oxygen species, antioxidant enzyme activities, and the levels of proline, malondialdehyde, soluble proteins, and soluble sugars in spinach leaves. Previous studies reported that the application of SA could alleviate Cd stress by enhancing antioxidant enzyme activities and inhibiting the production of excessive H₂O₂ and O₂^·− in plants [17, 47]. Moreover, Guo et al. observed that exogenous application of SA in tomato subjected to Cd stress reduced malondialdehyde content and increased CAT activity [48]. SA can act directly as an antioxidant, scavenging excessive H₂O₂ produced in peas under Cd stress conditions [49]. A study by Lu et al. demonstrated that SA significantly reversed the increase in SOD, POD, and CAT activities induced by Cd stress in duckweed leaves [50]. Similarly, we observed that exogenous SA alleviated Cd toxicity in spinach by reducing the contents of reactive oxygen species, malondialdehyde, soluble sugars and soluble proteins, and CAT activity.

Application of SA to plants can inhibit the transport of Cd from the roots to the aboveground parts. For example, a study by Raza et al. showed that SA markedly reduced Cd uptake and ameliorated Cd-induced inhibition of radish root growth [51]. Similar results were observed in wheat, ryegrass, and rice [52–54]. The results of this study indicate that SA reduced the Cd content and translocation factor in the aboveground organs of spinach, which is consistent with previous research findings. Research has demonstrated that plants lack transport proteins specifically designated for Cd transport in plants. Cd is transported through ion transport proteins, such as Nramp and HMA family proteins [55, 56]. Majumdar et al. demonstrated that the application of SA in rice seedlings subjected to Cd stress upregulated OsHMA3 and OsPCS1 genes and downregulated OsNRAMP2 [57]. Moreover, Huang et al. reported that SA could alleviate the toxicity of Cd on rice by modulating OsNRAMP5 and OsHMA3 gene expression [38]. Our research results indicate that SA potentially reduced Cd absorption in spinach leaves by downregulating the relative expression of SoHMA4-like, SoNramp3.1-like, SoNamp6-like, and SoNramp7.2-like genes. Thus, exogenous SA can reduce spinach shoot Cd uptake. SA can mitigate cadmium toxicity in spinach by reducing the content of reactive oxygen species, promoting photosynthesis, and downregulating the expression of genes involved in Cd transport (Fig. 9). PCA analysis and correlation analysis indicated that the Cd content was significantly positively correlated with the proline levels, malondialdehyde, soluble proteins, POD activity, CAT activity, and reactive oxygen species content. However, the mechanisms underlying these results should be further studied.

Fig. 9.

Schematic diagram of the mechanisms underlying Cd toxicity alleviation by exogenously applied SA to spinach plants

Conclusions

Based on the results of our study, 0.8 and 1.6 mmol/L of exogenously applied SA alleviated the inhibition of spinach growth induced by Cd stress. Furthermore, SA enhanced photosynthesis and increased the levels of photosynthetic pigments in spinach under Cd stress. Moreover, SA could abrogate the oxidative damage induced by Cd by reducing the contents of reactive oxygen species and osmoregulatory substances. In addition, 0.8 and 1.6 mmol/L SA application decreased Cd absorption in spinach leaves by downregulating the relative expression of SoHMA4-like, SoNramp3.1-like, SoNramp6-like, and SoNramp7.2-like genes, resulting in reduced Cd content in spinach shoots. In summary, the application of 0.8 and 1.6 mmol/L SA could effectively mitigate the toxicity of Cd in spinach.

Author contributions

Wen Tang: Investigation, data curation, writing-original draft. Le Liang: Investigation, data curation. Haixing Yang: Data curation. Xuena Yu: Data curation. Xudong Ye: Investigation, data curation. Yongdong Xie: Investigation. Rulong Li: Investigation. Lijin Lin: Investigation. Zhi Huang: Investigation. Bo Sun: Investigation. Guochao Sun: Investigation. Li Liu: Investigation. Huanxiu Li: Conceptualization. Yi Tang: Conceptualization, writing-review and editing.

Funding

This work was supported by Sichuan Innovation Team Project of National Modern Agricultural Industry Technology System (Grant No SCCXTD-2024-5).

Data availability

All data generated or analysed during this study are included in this published article [and its supplementary information files].

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.