Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Nov 22;104(1):104571. doi: 10.1016/j.psj.2024.104571

HSP60 inhibits DF-1 apoptosis through its mitochondrial signal peptide

Shengliang Cao a, Yanlan Li a, Lele Chen a, Xiaojing Lei a, Xiujuan Feng c, Yubao Li b,⁎
PMCID: PMC11664397  PMID: 39637657

Abstract

HSP60 is implicated in many biological functions and plays a key role in maintaining oxidative stress and preserving mitochondrial integrity. Our previous study showed that HSP60 inhibits apoptosis. In this study, we further investigated the mechanism of apoptosis inhibition by HSP60. First, the CRISPR-Cas9 system was employed to establish the HSP60 knockout DF-1 cell line (DF-1-HSP60-KO), and the apoptosis level of DF-1-HSP60-KO cell line was assessed by flow cytometry and ELISA apoptosis kit. Then, the effect of knockdout of HSP60 on relevant apoptotic factors was assessed by Western blotting and RT-PCR analysis. The results showed that compared with the control DF-1 cells, HSP60 knockdout cells indicated significantly increased apoptosis rates, decreased Bax expression, and enhanced Caspase 3 expression. This suggests that the HSP60 knockout induces apoptosis by up-regulating Caspase 3 and down-regulating Bax expression. The structure of the HSP60 mitochondrial signal peptide (MIT) protein was predicted using Pymol software, which revealed that His amino acid at the 21st position affects its spatial structure. In addition, the transfection of HSP60 mutant protein (TB) into DF-1-HSP60-KO cells and induction with Bardoxolone MethyI significantly increased the apoptosis rates and reduced cell viability compared to the wild-type HSP60 group, inducing differential changes in genes such as Bax, Bak, and Bcl-2. Together, these findings suggest that the HSP60 MIT's His amino acid at site 21 modulates the levels of genes associated with the apoptosis signaling pathway, thereby inhibiting apoptosis. This study reveals the regulatory role of HSP60 in apoptosis through its mitochondrial signal peptide, which will have potential medical value.

Keywords: Heat shock proteins 60, CRISPR-Cas9 system, Apoptosis, Mitochondrial signaling pathway

Introduction

Heat shock proteins (HSPs) are one of the most conserved known proteins. Based on the molecular weight and biological functions, HSPs can be categorized into the small molecule families (HSP40, HSP60, HSP70, and HSP90 families) and the large HSP family, each comprising different members (Wu et al., 2017). HSP synthesis is stimulated by heat or cold (Hanafi et al., 2022), pathogens (Roy et al., 2021), transportation (Zheng et al., 2020), and other stressors. Furthermore, HSPs, including HSP60, are also expressed under normal physiological conditions and are crucially involved in essential physiological functions such as correct folding and transport of cellular proteins. Moreover, HSP60 has also been found to be associated with tumorigenesis, development, and metastasis (Tang et al., 2019). Naïve HSP60 is the early form of HSP60, which is encoded by nuclear DNA and contains a MIT. Using MIT, naïve HSP60 enters the mitochondria with the assistance of the mitochondrial membrane potential and various other chaperone proteins, where MIT is cut, and the proteins undergo folding and maturation to become mitochondrial HSP60 (mtHSP60). mtHSP60 has a crucial function of correct folding of nascent proteins and the restoration of misfolded protein's normal structure (Pastore et al., 2014). In tumors, chronic disease, and other pathological states, mtHSP60 accumulates in the cytosol (Ricci et al., 2017) and interacts with survivin, P53, IKK, procaspase-3, mitochondrial respiratory chain supercomplexes, etc., to play important biological roles in apoptosis and proliferation of tumor cells. However, whether mtHSP60 is secreted from mitochondria into the cytoplasm in different tumor cells under the stimulation of different apoptosis inducers remains controversial. Naïve HSP60 and mtHSP60 have different intracytoplasmic stability. The intracytoplasmic mtHSP60 is susceptible to hydrolysis by proteases (Linden et al., 2010; Ricci et al., 2017).

There are two primary pathways of apoptosis: the mitochondria-mediated internal pathway and the death receptor-mediated external pathway. These pathways activate procaspases, thereby promoting cell membrane ruffling, chromatin condensation, and DNA breaks (Chandra et al., 2007). Studies have indicated that most HSPs promote cell survival and inhibit apoptosis (Chandra et al., 2007). However, whether HSP60 promotes or inhibits apoptosis remains controversial. Furthermore, HSP27, HSP70, and HSP90 have been observed to exhibit a protective role and inhibit apoptosis during DNA damage-induced cellular injury (Nadin et al., 2003), heat stress (Mosser et al., 2000), nutrient deficiency, and hypoxia (Beere, 2005). Moreover, it has been observed that in hypoxia-induced cardiomyocyte apoptosis, HSP60 binds Bax and prevents its translocation to the outer mitochondrial membrane, thus exerting a protective effect (Kirchhoff et al., 2002). In addition, stress-induced apoptosis of epithelial cells is mediated by HSP60, which exhibits a protective effect by activating extracellular regulated protein kinases (ERK) and inhibiting Caspase 3 activity (Zhang et al., 2004). Studies have also indicated that in various tumor cells, HSP60 expression is increased, and it inhibits tumor cell proliferation (Chandra et al., 2007). However, in HeLa cells, the HSP60 complex was observed to induce apoptosis by activating procaspase 3. Moreover, HSP60 expression was significantly elevated in oesophageal squamous epithelial cell carcinoma and ovarian cancer tissues, which can be a feature of poor prognosis (Faried et al., 2004; Guo et al., 2019). These data indicate that HSP60 differentially modulates apoptosis in different tissues and cells.

Previously, our study showed that HSP60 inhibited apoptosis in DF-1 cells (Li et al., 2024). In recent years, the CRISPR-Cas type II system encoding Cas9 has been employed in genetic engineering to provide a reliable and specific option for recombinant DNA. Therefore, to further investigate the mechanism of apoptosis inhibition by HSP60, we knocked out the HSP60 gene in the DF-1 cell line using the CRISPR-Cas9 system to further validate the molecular mechanism of HSP60 and apoptosis. In addition, the key sites where HSP60 inhibits apoptosis in DF-1 cells were also predicted by Pymol software to explore the interaction mechanism between HSP60 and apoptosis in more depth, with a view to discovering new therapeutic targets and strategies.

Materials and methods

Materials

Chicken embryo fibroblasts (DF-1 cells) were propagated in 5% CO2 at 37°C in DMEM (Gibco, SH3002) augmented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Bio-Channel, FBS01). X-tremeGENE HP DNA Transfection Reagent (Roche Applied Science, Basel, Switzerland, 06366236001) were purchased from ROCHE. Opti-MEM Transfection Diluent was acquired from Gibco (A4124802). Annexin V-APC/PI Apoptosis Detection Kit (KGA1030-50) was obtained from Key GEN Biotech. Hind III (1060S), Bgl II (1021A) and T4 ligase (2011A) were purchased from TaKaRa. Bardoxolone MethyI (S8078) was procured from Selleck. CCK-8 (C0037) was purchased from Beyotime Biotechnology. All the antibodies were procured from Proteintech and included HSP60 polyclonal (15282-1-AP, 1:10000), β-actin (81115-1-RR, 1:20000), BAX polyclonal (50599-2-lg, 1:10000), BAK polyclonal (29552-1-AP, 1:12000), Bcl-2 polyclonal (12789-1-AP, 1:10000), and Caspase 3 polyclonal (19677-1-AP, 1:2000) antibodies.

Plasmids and transfections

The HSP60 sequence (NM_001012916.2) was acquired from NCBI and analyzed with the help of sequence II 6.0 and DNA 2.0 software, the key CAC nucleotide sequence at 61–63 positions after the HSP60 MIT start codon was replaced with AAG. Furthermore, the amino acid His, corresponding to the 21st position of the MIT, was replaced with Lys. The PyMOL Molecular Graphics System (Pymol) (Pasi et al., 2012) was utilized to predict the protein structure, and the mutated protein was named TB. Then, based on the HSP60 and TB gene sequences data as well as the pEGFP-C1 vector, relevant primers were designed with Primer 5.0 software to amplify HSP60 and TB sequences using the cDNA of DF-1 cells as a template. The acquired PCR products were then ligated to the Hind III and Bgl II sites of the pEGFP-C1 vector, respectively, to obtain pEGFP-HSP60 and pEGFP-TB recombinant plasmids. DF-1-HSP60 knock-out (KO) cells were transfected with the acquired recombinant plasmids using the X-tremeGENE HP DNA Transfection Reagent, per the kit's instruction. The cells were harvested after 24 hours for cell protein extraction to analyze the expression levels of HSP60 and TB by western blotting, respectively.

HSP60 knockout in the DF-1 cells via the CRISPR-Cas9 system

For the HSP60 knockout, a previously described method with slight modifications was followed (Zhang et al., 2021). Briefly, based on the conserved region of the chicken HSP60 exon, 2 different sgRNA pairs were designed via a CRISPR Design Tool (http://crispr.mit.edu/). Then, HSP60-sgRNA1-Fwd (forward) and HSP60-sgRNA1-Rev (reverse) were phosphorylated and annealed to generate HSP60-sgRNA1, which was then inserted into the Bbs I site of PX459M (PX459 pSpCas9-2A-Puro-MCS) vector. For primer validation, HSP60-sgRNA1-Fwd and CAG-Rev were utilized. Furthermore, HSP60-sgRNA2-Fwd and HSP60-sgRNA2-Rev were phosphorylated and annealed to generate HSP60-sgRNA2, which was then inserted into the Bbs I site of the EZ-Guide-XH vector. For primer validation, HSP60-sgRNA2-Fwd and M13F were employed. Subsequently, EZ-Guide-XH-HSP60-sgRNA2 was inserted at the Xho I and Hind III sites of the PX459M-HSP60-sgRNA1 vector to form PX459M-HSP60-KO. The plasmid was then sequenced to determine the correct insertion.

PX459M-HSP60-KO plasmid was transfected into DF-1 cells for 48 h using X-tremeGENE HP DNA Transfection Reagent. The cells were then treated with puromycin (1 mg/mL) (Sigma-Aldrich, 540222) for 4 d. Then, single-cell suspension was prepared and cultured in 96-well plates in DMEM augmented with 1 mg/mL puromycin and 20% FBS. When the number of cells spread over the bottom of the 96-well plate, they were seeded in 24, 12, and 6-well plates, and transferred progressively to T25 cell vials. HSP60 DNA sequences were confirmed by sequencing, and HSP60 protein knockout was analyzed using Western Blot. Table 1 enlists the sgRNA sequences employed for this experiment.

Table 1.

Nucleotide sequence of sgRNA in the article.

sgRNA Name Sequence (5′-3′)
HSP60--sgRNA1-Fwd CACCGTGCGTGCCGCGCGCTCGCATCGG
HSP60--sgRNA1-Rev AAACCCGATGCGAGCGCGCGGCACGCAC
HSP60--sgRNA2-Fwd CACCGCCTTCGCGTACGCCCGCGTGAGG
HSP60--sgRNA2-Rev AAACCCTCACGCGGGCGTACGCGAAGGC
Open in a new tab

Apoptosis assessment via ELISA

DF-1 cells and DF-1-HSP60-KO or DF-1-HSP60-KO cells were transfected with pEGFP-C1, pEGFP-HSP60, and pEGFP-TB recombinant plasmids for 24 h. The cells were then harvested and diluted with media to 1 × 105 cells/mL volume. Then, 500 µL of cell suspension and 500 µL of complete medium were mixed in a centrifuge tube, followed by a reaction with 4, 7, and 10 µM of the pro-apoptotic reagent Bardoxolone MethyI at 37°C for 4 and 6 h, respectively. Post-apoptosis induction, cells were harvested and centrifuged at 200 g for 5 min to acquire pellet, which was resuspended in medium (1 mL), centrifuged again for 5 min at 1,500 g, re-dissolved in incubation buffer (500 µL), and mixed homogeneously, kept 30 min at 25 °C, spun again for 10 min at 20,000 g to acquire supernatant, 400 µL of which was diluted 1:10 with incubation buffer, before apoptosis level analysis per the instruction of the Cell Death Detection ELISA (Roche, 11544675001) (Li et al., 2024).

Flow cytometry analysis of apoptosis

DF-1-HSP60-KO and DF-1 cells were propagated for 12 h, or DF-1-HSP60-KO cells transfected with pEGFP-C1, pEGFP-HSP60, and pEGFP-TB recombinant plasmids for 24 h, respectively. Then, cells were treated with 7 µM Bardoxolone MethyI, collected after 4 and 6 h of dosing, respectively. The collected cells were rinsed with PBS (Beyotime Biotechnology, C0221B) twice, digested with trypsin (Beyotime Biotechnology, C0201), and centrifuged for 5 min at 1500 g to harvest 1–5 × 105 cells, which were then dissolved with 1 × Binding Buffer (500 µL), followed by Annexin V-FITC (1 µL) (Yeasen Biotechnology (Shanghai) Co., Ltd, China, 40302), and then Propidium Iodide (5 µL), and left at ambient temperature in the dark for 5 min. Flow cytometry (ThermoFisher Scientific, Invitrogen Attune CytPix) analysis was carried out for apoptosis (Em = 530 nm; Ex = 488 nm).

Real-time PCR (RT-PCR) analysis

Based on the NCBI-published sequences, primers for Bak, GAPDH, Bax, P53, Bcl-2, and Caspase 3 were designed (Table 2), relevant primer information can be found in previously published articles (Li et al., 2024). Briefly, DF-1-HSP60-KO cells and DF-1 were propagated for 12 h, or DF-1-HSP60-KO cells transfected with pEGFP-C1, pEGFP-HSP60 and pEGFP-TB recombinant plasmids for 24 h, respectively. Then, cells were treated with 7 µM Bardoxolone MethyI, collected after at 0, 1, 2, 3, 4, 5, and 6 h of dosing, respectively. Whole cellular RNA was acquired with Trizol (Invitrogen, 15596018CN), reverse transcribed with the ReverTra Ace qPCR RT kit (TOYOBO, FSQ-101), and then amplified using SYBR® Green Realtime PCR Master Mix (TOYOBO, QPK-201). Results were observed using Roche Real-Time PCR software and analysed using the 2 -ΔΔCT method. The analysis was repeated thrice with triplicates of each sample.

Table 2.

Relevant primers used in the article.

Primer name Sequence (5′-3′)
CAG-Rev GTACTGGGCACAATGCCAG
M13F TGTAAAACGACGGCCAGT
qPCR GAPDH-F TGAAAGTCGGAGTCAACGGAT
qPCR GAPDH-R TACAGCCAAAGGGCAGAAATG
qPCR BAK-F TGCAGCCCACCAAGGAGAA
qPCR BAK-R ATCGAGTGCAGCCACCCATC
qPCR BAX-F CGCCATCTTCGGCTGTTTCT
qPCR BAX-R ACGTACAGATTGGCCGTGAAGA
qPCR Bcl-2-F AGGACAACGGAGGATGGGAT
qPCR Bcl-2-R CCACGATAAACTGGGTGACTCTACT
qPCR P53-F ATCCTCACCATCCTTACACTGGA
qPCR P53-R CCTCATTGATCTCCTTCAGCATCT
qPCR Caspase3-F CATAAAAGATGGACCACGCTCAG
qPCR Caspase3-R GTATCTCGGTGGAAGTTCTTATTGT
HSP60-F GGAAGATCTATGCTCCGTTTGCCTGCAG
HSP60-R CCCAAGCTTGTTAGAACATGCCACCTCCC
HSP60 MIT-F GGAAGATCTATGCTCCGTTTGCCTGCAGTACTCCGCCAGATCAGGCCGGTGTCCAGAGCGCTCGCCCCGAAGCTCAC
HSP60 MIT-R CCCAAGCTTGTTAGAACATGCCACCTCCCATTCCTCCACCCATCCCTCCCATTCCTCCCATTGCTGGCTCTTTTTCCT
Open in a new tab

Western blot analysis

Briefly, more than three generations of actively growing, homogeneous and clear DF-1-HSP60-KO and DF-1 cells were selected and propagated in 6-well plates at 1 × 105 density for 12 h. Whereas DF-1-HSP60-KO cells transfected with pEGFP-C1, pEGFP-HSP60, and pEGFP-TB recombinant plasmids were cultured in 6-well plates for 24 h. Healthy adherent cells were then inoculated with 7 µM Bardoxolone MethyI and collected after 0, 1, 2, 3, 4, 5, and 6 h of dosing. The collected cells were lysed with RIPA lysate (Beyotime Biotechnology, P0013B) and the protein concentration of the cell lysate was determined using BCA Protein Assay Kit (Thermo Scientific, 23225). Equal amounts of different samples were boiled in a water bath for 10 min, then different groups of samples of the same protein were separated by SDS-polyacrylamide gel electrophoresis, and then the relevant proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, ISEQ00010) using a membrane transfer apparatus (Bio-Rad Laboratories, Hercules, CA, USA). After incubation with 5% BSA (Beyotime Biotechnology, ST023) overnight at 4°C or for 1 h at room temperature, the membranes were incubated with antibodies to Bax, P53, Bak, Caspase 3, Bcl-2, and β-actin for 1 h at room temperature followed by incubation of the membranes with appropriate horseradish peroxidase-conjugated anti-mouse (Beyotime Biotechnology, A0216) or anti-rabbit (Beyotime Biotechnology, A0352) secondary antibodies for 1 h. Proteins were developed with Clarity Western ECL Substrate (Bio-Rad Laboratories, 1705061) and detected by Protein Chemiluminescence Imager (Touch Imager). Protein bands were analyzed by Image J 1.41 on a grayscale. The band density was determined after comparing the grey values of the bands from different samples to the grey values of the β-actin bands at the same time, and then the analysis of variance was performed by statistics.

Statistical analysis

SPSS 23.0 software (SPSS Inc., version 27.0; Chicago, IL, USA) was employed for all statistical assessments, and the data are depicted as the mean ± standard deviation (SD) of at least three biological replicates for each condition. The inter-group statistical differences were evaluated via Student's t-test, Tukey's range test and one-way ANOVA. p-values < 0.05 indicated statistically significant difference (ns p > 0.05, # p < 0.05, ## p < 0.01, and ### p < 0.001 or ns p >0.05, * p < 0.05, ** p < 0.01, and *** p < 0.001).

Results

Establishment of HSP60-KO cell lines

To verify the role of HSP60 on apoptosis, EZ-Guide-XH and PX459M vectors were administered 2 guide HSP60 RNAs, respectively (Fig. 1A). The results of recombinant plasmid PCR and double enzyme cleavage are presented in Fig. 1B. The DF-1 cells were transfected with double knockout plasmid PX459M-HSP60-KO, and puromycin screening was used to screen positive clones. After DNA sequencing, it was validated that the fragment at the 51–209 base site was deleted (Fig. 1C). Furthermore, western blotting was employed to evaluate HSP60 protein levels. The data revealed that HSP60 was not expressed in the KO cell line relative to normal DF-1 cells (Fig. 1D).

Fig. 1.

Fig 1

Open in a new tab

DF-1-HSP60-KO in the DF-1 cell line. (A) Plasmid mapping of Px459M (pSpCas9-2A-Puro-MCS) and EZ-GuideXH. (B) Results of PCR analysis of recombinant plasmid and double enzyme digestion. (Left) PCR analysis of recombinant plasmids. (Right) Recombinant plasmids were verified by double digestion with Xho I and Hind III enzymes. (C) Comparative results of HSP60 partial gene in monoclonal DF-1-HSP60-KO cell line and DF-1 cells. (D) Results of Western Blot assay of DF-1-HSP60-KO cells. After the cells were cultured in flat dishes for 24 h, relevant cellular protein samples were collected and then analyzed by Western Blot using HSP60 protein antibody.

The impact of HSP60 knockout on apoptosis

Apoptosis levels in DF-1-HSP60-KO cells were detected using ROCHE ELISA Apoptosis Detection Kit and flow cytometry. The data acquired from ELISA revealed that the apoptosis rate in the DF-1-HSP60-KO cells was markedly higher than that observed in the DF-1 wild-type (WT) cells after 4 h of Bardoxolone MethyI treatment, a pro-apoptotic reagent tested at 0, 4, 7, and 10 µM (p < 0.01) (Fig. 2A). Furthermore, after 6 h of Bardoxolone MethyI treatment, the apoptosis rate of DF-1-HSP60-KO cells was notably higher than DF-1 WT cells at 0, 4, and 7 µM drug concentrations (p < 0.01). Whereas at 10 µM drug concentration, the cells indicated the highest mortality rate, and there was no significant difference between DF-1-HSP60-KO and DF-1 WT cell lines (p > 0.05) (Fig. 2A). These results were verified by flow cytometry (Fig. 2B-C). The results indicated that the apoptosis rate of the DF-1-HSP60-KO cells was substantially increased than that of the DF-1 WT cells after 4 h of Bardoxolone MethyI treatment (p < 0.01), and there was no marked difference between the DF-1-HSP60-KO and the DF-1 WT cells after 6 h of induction (p > 0.05). Overall, these results suggest that HSP60 exerted anti-apoptotic effects within the DF-1 cell line.

Fig. 2.

Fig 2

Open in a new tab

The influence of HSP60 knockout on cell apoptosis. (A) ELISA was performed to determine the effect of HSP60 knockout on apoptosis. Levels of apoptosis induced by Bardoxolone MethyI at 4 h (left) and 6 h (right). (B) Detection of apoptosis level after knockout of HSP60 by flow cytometry. (C) Statistical results of apoptosis levels determined by flow cytometry. *p < 0.05; **p < 0.01, ***p < 0.001, ns p > 0.05.

Impact of HSP60-KO on the apoptosis signaling pathway

Our previous research revealed that HSP60 knockdown or overexpression affected the levels of related genes in the apoptosis signaling pathway (Li et al., 2024). In this research, the levels of Bcl-2, Caspase 3, Bak, HSP60, P53, Bax, and GAPDH transcript in DF-1 WT and HSP60-KO cells were assayed at different time points after Bardoxolone MethyI (7 µM) induction (Fig. 3A). HSP60 was not detected in the DF-1-HSP60-KO cells. In DF-1-HSP60-KO cells, the Bax transcripts showed a decreasing trend at 2–5 h, and Bak transcript levels were stabilized at 1–4 h and were markedly higher than those of the DF-1 WT cells at the later stage. Furthermore, the transcript levels of Bcl-2 were lower in the Bardoxolone MethyI treatment cells than in the DF-1 WT cells. Moreover, P53 transcript levels were not significantly variable compared to the DF-1 WT cells. The transcript levels of Caspase 3 in the DF-1-HSP60-KO cells were notably higher than the DF-1 WT cells at 0–3 h. In addition, the HSP60, BAX, BAK, Bcl-2, P53, and Caspase 3 protein levels were also evaluated by western blotting. The data is shown in Fig. 3B. In DF-1-HSP60-KO cells, the expression of Bax and Bak proteins was reduced than the DF-1 WT cells, whereas the expression of Bax proteins was the same as those of the genes. Consistently with gene expression levels, the protein levels of Caspase 3 were higher in the DF-1-HSP60-KO cells than in the DF-1 WT cells. Furthermore, BCL-2 protein expression was higher than in the DF-1 WT cells.

Fig. 3.

Fig 3

Open in a new tab

Effect of DF-1-HSP60-KO on apoptosis signaling pathway. (A) Validation of Bax, P53, Bcl-2, Caspase 3, and Bak transcript levels in DF-1-HSP60-KO cells. (B) Verification of Bcl-2, HSP60, Bax, Caspase 3, and Bak protein expression in DF-1-HSP60-KO cells. (C) Statistical results of relative β-actin expression levels of Bcl-2, Bax, HSP60, Bak, and Caspase 3 proteins in DF-1-HSP60-KO cells. *p < 0.05; **p < 0.01, ***p < 0.001, nsp > 0.05.

The effect of HSP60 MIT on cell apoptosis

To further investigate the inhibitory effect of HSP60 on apoptosis in DF-1 cells, Pymol was utilized to predict the HSP60 protein's MIT structure, whose 21-position amino acid H affects the protein conformation (Fig. 4A). Briefly, HSP60 MIT mutant plasmid pEGFP-TB (H21K) was constructed and subjected to DNA sequencing, which showed that the pEGFP-HSP60 recombinant plasmid was free of mutation and the HSP60 MIT 21 amino acid position was mutated in the pEGFP-TB recombinant plasmid (Fig. 4B). The recombinant plasmids of pEGFP-C1, pEGFP-HSP60, and pEGFP-TB were expressed normally in the DF-1-HSP60-KO cells (Fig. 4B).

Fig. 4.

Fig 4

Open in a new tab

The effect of HSP60 MIT on cell apoptosis. (A) Structure prediction of HSP60 MIT mutant protein. (B) Recombinant plasmid sequencing results (top). DF-1-HSP60-KO cells were transfected with empty vector, wild-type pEGFP-HSP60, and mutant pEGFP-TB plasmid. Fluorescence microscopic analysis of transfected cells after 24 h (down). (C) ELISA was performed to evaluate the effect of HSP60 MIT mutation on apoptosis. Apoptosis levels induced by Bardoxolone MethyI at (left) 4 h and (right) 6 h. (D) Apoptosis rates in HSP60 MIT mutants were detected by flow cytometry in DF-1-HSP60-KO cells. (E) Statistical results of apoptosis levels were assessed by flow cytometry. Compared with the pEGFP-C1 group samples in the same group, *p < 0.05; **p < 0.01, ***p < 0.001, nsp > 0.05. Compared with the pEGFP-HSP60 and pEGFP-TB group samples in the same group, #p < 0.05, ##p < 0.01, ###p < 0.001, nsp > 0.05.

DF-1-HSP60-KO cell line was transfected with pEGFP-HSP60, pEGFP-TB recombinant plasmid, and pEGFP-C1 empty vector and then treated with different concentrations of Bardoxolone MethyI for 4 and 6 h to induce apoptosis. The ELISA indicated that in the pEGFP-TB cells, the apoptosis rate was notably increased (p < 0.01) than in the pEGFP-HSP60 cells (Fig. 4C). Flow cytometry results validated that the apoptosis level was increased after the mutation of MIT 21 amino acid in HSP60 (Fig. 4D-E). Overall, these data indicated that amino acid His at position 21 of HSP60 MIT is crucially involved in the inhibition of apoptosis by HSP60.

The effect of HSP60 MIT on the apoptosis signaling pathway

DF-1-HSP60-KO cells were transfected with pEGFP-HSP60, pEGFP-TB, and pEGFP-C1 for 24 h and then treated with 7µM Bardoxolone MethyI before their Bax, P53, Bak, Caspase3, Bcl-2, and GAPDH transcript levels were detected at 0, 1, 2, 3, 4, 5, and 6 h after induction. It was observed that compared with the pEGFP-HSP60 cells, the pEGFP-TB cells had increased levels of Bax, Bak, and Bcl-2 transcripts before 1 h, which decreased after 1 h. In addition, the transcript levels of P53 and Caspase 3 were significantly increased (Fig. 5A). Compared with the pEGFP-C1 cells, the transcript levels of Bax, Bak, and Bcl-2 were markedly higher in the pEGFP-HSP60 cells, while those of Caspase 3 and P53 were lower. Meanwhile, compared with pEGFP-C1, the transcription levels of Bax and Bcl-2 were elevated in pEGFP-TB cells, while the transcription levels of Caspase 3 and P53 were lower. But, the increased levels of Bax and Bcl-2 and decreased levels of Caspase 3 and P53 induced in pEGFP-TB cells were significantly lower than those in pEGFP-HSP60 cells, while the transcription level of Bak in pEGFP-TB cells was opposite to that in pEGFP-HSP60 cells. The above results also indicate that the 21st amino acids of HSP60 MIT play a key role in its inhibition of cell apoptosis (Fig. 5A). This research also studied the protein levels of these transcripts by Western blot. It was revealed that compared with the pEGFP-HSP60 cells, the expression of Bcl-2 and Caspase 3 proteins in the pEGFP-TB group was consistent with their gene transcription levels, whereas there were differences in Bax and Bak (Fig. 5B-C). ELISA and flow cytometry experiments jointly verified that the HSP60-induced apoptosis level was elevated after the mutation of amino acid 21st in HSP60 MIT and affected the expression of apoptosis signaling pathway-related genes. Therefore, it was inferred that HSP60 may modulate apoptosis by altering the expression of Bax/Bcl-2/Caspase3 proteins and other apoptotic factors in the apoptosis signaling pathway via MIT.

Fig. 5.

Fig 5

Open in a new tab

The effect of HSP60 MIT on apoptosis signaling pathway. (A) Validation of Bax, HSP60, Bak, Bcl-2, Caspase 3, P53 transcript levels at different times after HSP60 MIT mutation treated with 7 µM Bardoxolone MethyI. (B) Validation of Bak, HSP60, Caspase 3, Bax, and Bcl-2 expression at different times after HSP60 MIT mutation cells treated with 7 µM Bardoxolone MethyI. (C) Statistical results of Bax, HSP60, Bak, Caspase 3, and Bcl-2 proteins in HSP60 MIT mutation cells relative to β-actin levels. Compared with the pEGFP-C1 group samples in the same group, *p < 0.05, **p < 0.01, ***p < 0.001, nsp > 0.05. Compared with the pEGFP-HSP60 and pEGFP-TB group samples in the same group, #p < 0.05, ##p < 0.01, ###p < 0.001, nsp > 0.05.

Discussion

HSP60 is a molecular chaperone protein that has been observed to protect cells from various stresses, such as heat stress (Balakrishnan et al., 2023). Furthermore, HSP60 modulates cellular processes, including protein folding, membrane trafficking, and protein degradation. Several studies have indicated that HSP60 modulates programmed cell death or apoptosis (Cristaldi et al., 2023; Singh et al., 2024). Apoptosis is a coordinated series of biochemical events that results in the deliberate killing of cells, essential for maintaining tissue integrity and preventing cancer (Nagata, 2018). Aberrant apoptosis can cause various diseases, such as cancer, neurodegenerative disorders, and autoimmune diseases (Fan et al., 2018). During physiological conditions, HSP60 is present in the mitochondria; however, in certain pathological conditions such as cancer, HSP60 accumulates in the cytoplasm (Ricci et al., 2017). The intracytoplasmic HSP60 is composed of mtHSP60 and naïve HSP60 (Ricci et al., 2017), and their structural differences promote their different roles in cell proliferation/apoptosis mechanisms (Caruso Bavisotto et al., 2017; Linden et al., 2010). It has been observed that apoptosis inducer BMD-188 promotes the translocation of mtHSP60 into the cytosol from mitochondria, thereby reducing mtHSP60 and increasing cytosolic HSP60. mtHSP60 in the cytosol directly interacts with procaspase-3, which increases caspase-3 maturation and promotes cell apoptosis (Chandra et al., 2007). Therefore, understanding the regulatory mechanisms of apoptosis is essential for establishing novel therapeutic strategies. Our previous study indicated that HSP60 knockdown or overexpression promotes or inhibits apoptosis levels (Li et al., 2024).

Here, the role of HSP60 on apoptosis was further investigated by establishing the DF-1-HSP60-KO cells via the CRISPR-Cas system. The successful establishment of the DF-1-HSP60-KO cell line was verified by western blot and gene sequencing, and it was deleted from the position at 51–209 bp. ELISA and flow cytometry confirmed that DF-1-HSP60-KO cells had increased apoptosis levels and decreased cell survival. HSP60 is a key regulator of apoptosis, and its involvement in this process is multifaceted (Singh et al., 2024). It has been indicated that HSP60 predominantly modulates apoptosis by interacting with caspases, a cysteine protease family that forms the apoptotic executioner cascade (Kumar et al., 2019). HSP60 binds to and enhances the activity of caspases, thereby stimulating downstream effector caspases and promoting apoptosis. Moreover, HSP60 also interacts with the Bcl-2 protein family, which are key apoptosis modulators. HSP60 binds to pro-apoptotic Bax and Bak, preventing their insertion into the mitochondrial membrane and subsequent activation of the apoptotic cascade. Moreover, HSP60 binds with the anti-apoptotic proteins Bcl-2 and Bcl-xL to enhance their stability and function, thereby inhibiting apoptosis (Shan et al., 2003). The literature has indicated that HSP60 interacts with various signaling molecules, including kinases, phosphatases, and ubiquitin ligases, among which its interaction with oncoprotein P53 is markedly significant. In the absence of HSP60, P53 activity is increased, which causes pro-apoptotic genes up-regulation and anti-apoptotic genes down-regulation (Caruso Bavisotto et al., 2020; Hu et al., 2021). This research showed that Bax and Bak expression was reduced in the DF-1-HSP60-KO cells compared to the DF1 cells, while Bcl-2 and Caspase3 expression was increased. Furthermore, Bak and Bcl-2 gene transcript and protein expression levels were inconsistent. It has been observed that HSP60 interacts with the PI3K/Akt signaling pathway, which is crucially involved with cell metabolism and survival (Mulati et al., 2022). DF-1-HSP60-KO may disrupt this pathway, reducing cell survival and increasing susceptibility to apoptosis. HSP60 knockdout may result in aberrant mitochondrial function, triggering mitochondria-associated apoptotic pathways and causing differences in related protein and transcript gene levels. Mitochondria are important intracellular organs that modulate energy metabolism and apoptosis. HSP60, as a mitochondrial protein chaperone, is closely associated with protein folding and assembly within mitochondria. HSP60 knockdown may promote abnormal protein folding in mitochondria (Fan et al., 2019), inducing impaired mitochondrial function and increasing the release of endogenous apoptotic factors in the mitochondria (e.g., cytochrome C). The literature suggests (Fan et al., 2019) that in HSP60-KO mouse cardiomyocytes, the permeability of the outer mitochondrial membrane is increased, cytochrome C secretion is enhanced, and the activity of caspase-9 as well as caspase-3 is markedly elevated, which ultimately leads to apoptosis. Once cytochrome C is released into the cytoplasm, it binds to the apoptotic protein Apaf-1 (Apoptotic Protease Activating Factor-1) to form the cytochrome C-Apaf-1 complex, which activates Caspase 9, a member of the cysteine family of cytosolic aspartic enzymes. The activated Caspase 9, in turn, stimulates executive Caspases such as Caspase 3, which promotes a series of apoptotic responses in the cell. Here, the expression of Caspase 3 was notably elevated in the DF-1 cells, and the level of apoptosis significantly increased after HSP60 knockdout, indicating that there are differences in apoptosis regulation by HSP60 in different cells and tissues.

Naïve HSP60 is present in the cell cytoplasm and is the initial form of HSP60 comprising MIT. With the assistance of mitochondrial membrane potential and other chaperone proteins, naïve HSP60 can enter the mitochondria, where the MIT is cleaved, followed by HSP60 proteolytic folding and maturation (Pastore et al., 2014). However, it remains controversial whether mtHSP60 is secreted from mitochondria into the cytoplasm in different tumour cells in response to different apoptosis inducers. (Chandra et al., 2007). This research indicated that the HSP60 MIT 21st amino acid markedly enhanced apoptosis levels. However, the alterations in the relevant apoptosis signaling genes induced HSP60 mutation were opposite or attenuated to the effects of the DF-1 WT cell. Since HSP60, as a molecular chaperone protein, participates in the folding and stabilizing of multiple apoptosis-related proteins (Chandra et al., 2007; Faried et al., 2004; Linden et al., 2010; Singh et al., 2024).

HSPs play important functions in poultry physiology, stress response and overall poultry health. In intensive production systems, poultry are exposed to a variety of stressful conditions including high temperatures due to climate change, heavy metals, etc. that may cause impairment of the immune system and oxidative stress, which in turn can lead to negative impacts on production performance and meat quality (Abare et al., 2023; Balakrishnan et al., 2023). As in other organisms, poultry re-establish normal protein conformation by using HSPs as chaperone proteins to maintain cellular homeostasis and promote stress tolerance (Abare et al., 2023). Relevant literature reported that HSPs are involved in oxidative stress-mediated inflammatory injury in chicken liver induced by excess Mn through the NF-κB pathway(Zhao et al., 2015). Arsenic poisoning increased the expression levels of proteins such as Hsp60 and Hsp70 in chicken gastrointestinal tissues (Liu et al., 2021). In this study, we found that His amino acid at position 21 of HSP60 MIT plays a key role in the inhibition of apoptosis in DF-1 cells by HSP60, and this finding will also contribute to the development of new approaches to reduce the negative effects of stress on poultry. But what is the specific mechanism by which HSP60 inhibits apoptosis in DF-1 cells? is the focus of our future research.

Conclusion

In summary, this investigation established DF-1-HSP60-KO cell lines to verify that the HSP60 inhibits apoptosis predominantly by altering the expression of Bax, Bak, Bcl-2, Caspase 3, and other factors in the apoptosis signaling pathway. Furthermore, it was observed that the 21st amino acid in the MIT of HSP60 was the key site to exert its anti-apoptotic effect. This research provides a comprehensive understanding of how HSP60 modulates apoptosis and the basis for discovering new therapeutic targets and methods.

Author's contributions

S.C., Y.L., Y.L., and X.F. conducted the research and interpreted the results. S.C., Y.L., L.C., and X.L. contributed to data analysis and helped draft the manuscript. All authors have read and agreed to the published version of the manuscript.

Declaration of competing interest

The authors declare no competing interests.

Acknowledgments

This work was supported by The Natural Science Foundation of Shandong Province (Grant number ZR2020MC175), The Key Research and Development Program of Shandong Province (Grant number 2022CXGC010606), The Natural Science Foundation of Shandong Province (Grant number ZR2023QC082), The National Natural Science Foundation of China (Grant number 32372957).

References

  1. Abare M.Y., Rahayu S., Tugiyanti E. Review: the role of heat shock proteins in chicken: insights into stress adaptation and health. Res. Vet. Sci. 2023;165 doi: 10.1016/j.rvsc.2023.105057. [DOI] [PubMed] [Google Scholar]
  2. Balakrishnan K.N., Ramiah S.K., Zulkifli I. Heat shock protein response to stress in poultry: a review. Animals. (Basel) 2023;13(2):317. doi: 10.3390/ani13020317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beere H.M. Death versus survival: functional interaction between the apoptotic and stress-inducible heat shock protein pathways. J. Clin. Invest. 2005;115:2633–2639. doi: 10.1172/JCI26471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Caruso Bavisotto C., Alberti G., Vitale A.M., Paladino L., Campanella C., Rappa F., Gorska M., Conway de Macario E., Cappello F., Macario A.J.L., Gammazza A.M. Hsp60 Post-translational modifications: functional and pathological consequences. Front. Mol. Biosci. 2020;7:95. doi: 10.3389/fmolb.2020.00095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caruso Bavisotto C., Nikolic D., Marino Gammazza A., Barone R., Lo Cascio F., Mocciaro E., Zummo G., Conway de Macario E., Macario A.J.L., Cappello F., Giacalone V., Pace A., Barone G., Palumbo Piccionello A., Campanella C. The dissociation of the Hsp60/pro-caspase-3 complex by bis(pyridyl)oxadiazole copper complex (CubipyOXA) leads to cell death in NCI-H292 cancer cells. J. Inorg. Biochem. 2017;170:8–16. doi: 10.1016/j.jinorgbio.2017.02.004. [DOI] [PubMed] [Google Scholar]
  6. Chandra D., Choy G., Tang D.G. Cytosolic accumulation of HSP60 during apoptosis with or without apparent mitochondrial release. J. Biol. Chem. 2007;282(43):31289–31301. doi: 10.1074/jbc.M702777200. [DOI] [PubMed] [Google Scholar]
  7. Cristaldi M., Buscetta M., Cimino M., La Mensa A., Giuffrè M.R., Fiore L., Carcione C., Bucchieri F., Rappa F., Coronnello C., Sciaraffa N., Amato S., Aronica T.S., Lo Iacono G., Bertani A., Pace E., Cipollina C. Caspase-8 activation by cigarette smoke induces pro-inflammatory cell death of human macrophages exposed to lipopolysaccharide. Cell Death Dis. 2023;14(11):773. doi: 10.1038/s41419-023-06318-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fan F., Duan Y., Yang F., Trexler C., Wang H., Huang L., Li Y., Tang H., Wang G., Fang X., Liu J., Jia N., Chen J., Ouyang K. Deletion of heat shock protein 60 in adult mouse cardiomyocytes perturbs mitochondrial protein homeostasis and causes heart failure. Cell Death Differ. 2019;27(2):587–600. doi: 10.1038/s41418-019-0374-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fan X.-X., Pan H.D., Li Y., Guo R.-J., Leung E.L.-H., Liu L. Novel therapeutic strategy for cancer and autoimmune conditions: modulating cell metabolism and redox capacity. Pharmacol. Ther. 2018;191:148–161. doi: 10.1016/j.pharmthera.2018.06.010. [DOI] [PubMed] [Google Scholar]
  10. Faried A., Sohda M., Nakajima M., Miyazaki T., Kato H., Kuwano H. Expression of heat-shock protein Hsp60 correlated with the apoptotic index and patient prognosis in human oesophageal squamous cell carcinoma. Eur. J. Cancer (1965) 2004;40(18):2804–2811. doi: 10.1016/j.ejca.2004.08.013. [DOI] [PubMed] [Google Scholar]
  11. Guo J., Li X., Zhang W., Chen Y., Zhu S., Chen L., Xu R., Lv Y., Wu D., Guo M., Liu X., Lu W., Deng H. HSP60-regulated mitochondrial proteostasis and protein translation promote tumor growth of ovarian cancer. Sci. Rep. 2019;9(1):12628. doi: 10.1038/s41598-019-48992-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hanafi S.A., Zulkifli I., Ramiah S.K., Chung E.L.T., Awad E.A., Sazili A.Q. Prenatal thermal stress affects acute-phase proteins, heat shock protein 70, and circulating corticosterone in developing broiler embryos and neonates. J. Therm. Biol. 2022;109 doi: 10.1016/j.jtherbio.2022.103328. [DOI] [PubMed] [Google Scholar]
  13. Hu X., Li H., Ip T.K.-Y., Cheung Y.F., Koohi-Moghadam M., Wang H., Yang X., Tritton D.N., Wang Y., Wang Y., Wang R., Ng K.-M., Naranmandura H., Tse E.W.-C., Sun H. Arsenic trioxide targets Hsp60, triggering degradation of p53 and survivin. Chem. Sci. 2021;12(32):10893–10900. doi: 10.1039/d1sc03119h. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kirchhoff S.R., Gupta S., Knowlton A.A. Cytosolic heat shock protein 60, Apoptosis, and Myocardial Injury. Circulation. 2002;105(24):2899–2904. doi: 10.1161/01.cir.0000019403.35847.23. [DOI] [PubMed] [Google Scholar]
  15. Kumar S., O'Malley J., Chaudhary A.K., Inigo J.R., Yadav N., Kumar R., Chandra D. Hsp60 and IL-8 axis promotes apoptosis resistance in cancer. Br. J. Cancer. 2019;121(11):934–943. doi: 10.1038/s41416-019-0617-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li Y., Cao S., Li Y. Mechanistic study of heat shock protein 60-mediated apoptosis in DF-1 cells. Poult. Sci. 2024;103(6) doi: 10.1016/j.psj.2024.103619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Linden R., Chun J.N., Choi B., Lee K.W., Lee D.J., Kang D.H., Lee J.Y., Song I.S., Kim H.I., Lee S.-H., Kim H.S., Lee N.K., Lee S.Y., Lee K.-J., Kim J., Kang S.W. Cytosolic Hsp60 is involved in the NF-κB-dependent survival of cancer cells via IKK regulation. PLoS One. 2010;5(3):e9422. doi: 10.1371/journal.pone.0009422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu Y., Yu M., Cui J., Du Y., Teng X., Zhang Z. Heat shock proteins took part in oxidative stress-mediated inflammatory injury via NF-κB pathway in excess manganese-treated chicken livers. Ecotoxicol. Environ. Saf. 2021;226 doi: 10.1016/j.ecoenv.2021.112833. [DOI] [PubMed] [Google Scholar]
  19. Mosser D.D., L Bourget A.W.C., Meriin A.B., Sherman M.Y., Morimoto R.I., Massie B. The chaperone function of hsp70 is required for protection against. stress-induced apoptosis Mol. Cell. Biol. 2000;20(19):7146–7159. doi: 10.1128/mcb.20.19.7146-7159.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Mulati S., Jiang R., Wang J., Tao Y., Zhang W. 6-Shogaol exhibits a promoting effect with tax via binding HSP60 in non-small-cell lung cancer. Cells. 2022;11(22):3678. doi: 10.3390/cells11223678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Nadin S.B., Vargas-Roig L.M., Cuello-Carrión F.D., Ciocca D.R. Deoxyribonucleic acid damage induced by doxorubicin in peripheral blood mononuclear cells possible roles for the stress response and the deoxyribonucleic acid repair process. Cell Stress Chaperones. 2003;8(4):361–372. doi: 10.1379/1466-1268(2003)008<0361:dadibd>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nagata S. Apoptosis and clearance of apoptotic cells. Annu. Rev. Immunol. 2018;36:489–517. doi: 10.1146/annurev-immunol-042617-053010. [DOI] [PubMed] [Google Scholar]
  23. Pasi M., Tiberti M., Arrigoni A., Papaleo E. xPyder: A PyMOL plugin to analyze coupled residues and their networks in protein structures. J. Chem. Inf. Model. 2012;52(7):1865–1874. doi: 10.1021/ci300213c. [DOI] [PubMed] [Google Scholar]
  24. Pastore A., Vilasi S., Carrotta R., Mangione M.R., Campanella C., Librizzi F., Randazzo L., Martorana V., Marino Gammazza A., Ortore M.G., Vilasi A., Pocsfalvi G., Burgio G., Corona D., Palumbo Piccionello A., Zummo G., Bulone D., Conway de Macario E., Macario A.J.L., San Biagio P.L., Cappello F. Human Hsp60 with its mitochondrial import signal occurs in solution as heptamers and Tetradecamers remarkably stable over a wide range of concentrations. PLoS One. 2014;9(5):e97657. doi: 10.1371/journal.pone.0097657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ricci C., Carrotta R., Rappa G.C., Mangione M.R., Librizzi F., San Biagio P.L., Amenitsch H., Ortore M.G., Vilasi S. Investigation on different chemical stability of mitochondrial Hsp60 and its precursor. Biophys. Chem. 2017;229:31–38. doi: 10.1016/j.bpc.2017.07.008. [DOI] [PubMed] [Google Scholar]
  26. Roy S., Jariyapan N., Bates M.D., Bates P.A. Molecular identification of two newly identified human pathogens causing leishmaniasis using PCR-based methods on the 3′ untranslated region of the heat shock protein 70 (type I) gene. PLoS. Negl. Trop. Dis. 2021;15(11) doi: 10.1371/journal.pntd.0009982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Shan Y.-X., Liu T.-J., Su H.-F., Samsamshariat A., Mestril R., Wang P.H. Hsp10 and Hsp60 modulate Bcl-2 family and mitochondria apoptosis signaling induced by doxorubicin in cardiac muscle cells. J. Mol. Cell Cardiol. 2003;35(9):1135–1143. doi: 10.1016/s0022-2828(03)00229-3. [DOI] [PubMed] [Google Scholar]
  28. Singh M.K., Shin Y., Han S., Ha J., Tiwari P.K., Kim S.S., Kang I. Molecular chaperonin HSP60: current understanding and future prospects. Int. J. Mol. Sci. 2024;25(10):5483. doi: 10.3390/ijms25105483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tang H., Teng R., Zhao X., Wang X., Xu L., Deng H., Liu X. Isotope tracing assisted metabolic profiling: application to understanding HSP60 silencing mediated tumor progression. Anal. Chim. Acta. 2019;1047:93–103. doi: 10.1016/j.aca.2018.09.067. [DOI] [PubMed] [Google Scholar]
  30. Wu J., Liu T., Rios Z., Mei Q., Lin X., Cao S. Heat shock proteins and cancer. Trends Pharmacol. Sci. 2017;38(3):226–256. doi: 10.1016/j.tips.2016.11.009. [DOI] [PubMed] [Google Scholar]
  31. Zhang H., Zhang H., Cao S., Sui C., Song Y., Zhao Y., Liu S. Knockout of p53 leads to a significant increase in ALV-J replication. Poult. Sci. 2021;100(10) doi: 10.1016/j.psj.2021.101374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang L., Pelech S., Uitto V.-J. Bacterial GroEL-like heat shock protein 60 protects epithelial cells from stress-induced death through activation of ERK and inhibition of caspase 3. Exp. Cell Res. 2004;292(1):231–240. doi: 10.1016/j.yexcr.2003.08.012. [DOI] [PubMed] [Google Scholar]
  33. Zhao P., Zhang K., Guo G., Sun X., Chai H., Zhang W., Xing M. Heat shock protein alteration in the gastrointestinal tract tissues of chickens exposed to arsenic trioxide. Biol. Trace Elem. Res. 2015;170(1):224–236. doi: 10.1007/s12011-015-0462-9. [DOI] [PubMed] [Google Scholar]
  34. Zheng W., Liu B., Hu W., Cui Y. Effects of transport stress on pathological injury and main heat shock protein expression in the respiratory system of goats. J. Anim. Physiol. Anim. Nutr. (Berl) 2020;105(1):1–13. doi: 10.1111/jpn.13430. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES