Skip to main content
Cancer Cell International logoLink to Cancer Cell International
. 2024 Dec 24;24:429. doi: 10.1186/s12935-024-03617-6

Mitochondrial transcription elongation factor TEFM promotes malignant progression of gliomas

Yin Wang 1,#, Wenxuan Hu 2,#, Boya Zhou 3,#, Yu Zhao 4, Yufei Tang 4, Zhiyong Deng 1,✉, Minbin Chen 1,5,✉
PMCID: PMC11669239  PMID: 39719635

Abstract

Gliomas are the most common tumors of the central nervous system, with glioblastoma (GBM) being particularly aggressive and fatal. Current treatments for GBM, including surgery and chemotherapy, are limited by tumor aggressiveness and the blood-brain barrier. Therefore, understanding the molecular mechanisms driving GBM growth is essential. Mitochondria, key players in cellular energy production, have been implicated in cancer development. In this study, we investigated the expression of mitochondrial transcription elongation factor (TEFM) in gliomas and its potential role in tumor progression. Analysis of data from The Cancer Genome Atlas (TCGA) revealed that TEFM transcript levels were significantly higher in glioma tissues compared to adjacent normal tissues. High TEFM expression was associated with poor survival outcomes in glioma patients. Furthermore, TEFM was notably upregulated in glioma tissue and in primary glioma cells derived from local patients, while its expression was relatively low in normal tissues and astrocytes. Silencing or knockout of TEFM significantly inhibited glioma cell growth, proliferation, clonogenicity, migration, and invasion, while inducing apoptosis and activating caspases. In contrast, ectopic overexpression of TEFM promoted tumorigenic activity, enhancing the malignant behavior of glioma cells. Co-expression analysis identified a strong correlation between TEFM and the epithelial-mesenchymal transition (EMT) pathway in gliomas. Notably, the expression of EMT markers, such as N-cadherin and Vimentin, decreased upon TEFM knockdown or knockout. Additionally, TEFM depletion impaired mitochondrial function, disrupting the mitochondrial respiratory chain in glioma cells. In vivo experiments demonstrated that TEFM knockout effectively suppressed the growth of subcutaneous glioma xenografts in nude mice. Collectively, these findings highlight the critical role of TEFM in GBM growth and invasion, suggesting that it could serve as a promising therapeutic target for glioma treatment.

Graphical Abstract

graphic file with name 12935_2024_3617_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s12935-024-03617-6.

Keywords: Gliomas, TEFM, Mitochondria, EMT

Introduction

Gliomas, which arise from glial cells in the brain [1], are the most common tumors of the central nervous system, accounting for approximately 80% of primary malignant brain tumors [2]. Among them, glioblastoma (GBM) is particularly aggressive and lethal [3], with a poor prognosis. The median survival for patients is typically 12–15 months, and the 5-year survival rate is around 6.8% [4]. Current treatments for GBM primarily include surgical resection followed by radiation therapy and chemotherapy [5]. However, due to the tumor’s highly invasive and infiltrative nature, complete surgical removal is often unachievable. Additionally, the blood-brain barrier hinders the effective delivery of chemotherapeutic agents, further complicating treatment [6]. Therefore, understanding the molecular mechanisms underlying GBM progression is essential for developing more effective therapies.

Mitochondria are critical organelles in eukaryotic cells, functioning as the primary sites for oxidative phosphorylation and energy production [7–9]. The human mitochondrial transcription elongation factor (TEFM), also known as C17orf42, plays a crucial role in the transcriptional regulation of mitochondrial genes [10]. Its mRNA transcript is 1357 nucleotides in length and encodes 13 subunits of the oxidative phosphorylation machinery. The N-terminal region of TEFM (amino acids 1–35) acts as a mitochondrial targeting sequence, facilitating its entry into the mitochondria [11]. TEFM contains two conserved structural domains: the RuvC-type RNAase H-fold and the helix-hairpin-helix (HhH) motif, both of which are involved in DNA binding [12]. These domains facilitate the transcriptional elongation of mitochondrial DNA (mtDNA) by interacting with mitochondrial RNA polymerase (POLRMT). Studies have shown that TEFM specifically binds to POLRMT and significantly enhances mtDNA transcription elongation [12, 13]. Knockdown of TEFM in mice reduces POLRMT levels, leading to severe mitochondrial dysfunction [13]. Mitochondrial dysfunction is increasingly recognized as a key factor in a variety of diseases, including cancer [8, 14, 15].

David T. Sabatini’s team found that mitochondrial dysfunction is closely related to metabolic reprogramming in cancer cells. Studies have shown that mitochondrial damage causes tumor cells to switch to relying on anaerobic glycolysis for energy, thereby supporting their rapid proliferation. Restoring mitochondrial function helps to inhibit tumor growth [16]. Kristin S. Knudsen’s research team has identified specific mitochondrial DNA mutations in lung adenocarcinoma (LUAD) that are strongly associated with tumor cell aggressiveness and chemotherapy resistance. Repairing these mutations may help restore tumor cells’ sensitivity to chemotherapy drugs [17]. Research by Ryan’s team sheds light on the role of mtDNA mutations in immune escape and tumor immunotherapy resistance. By repairing these mutations, the effect of immunotherapy is enhanced, providing a new direction for mitochondria as immunotherapy targets [18]. Altschuler’s team took a closer look at key proteins within the mitochondria, such as ATP synthase and the mitochondrial respiratory chain complex. Studies have shown that tumor cells enhance anaerobic glycolysis and inhibit oxidative phosphorylation by altering the expression of mitochondrial proteins. By targeting these mitochondrial proteins, the researchers succeeded in enhancing the cancer cells’ sensitivity to the drug [19]. Professor Gorman and his team have found that certain mitochondrial proteins (such as VDAC1, Cyt-C, etc.) show abnormal expression in cancer, and these abnormal expressions are closely related to the drug resistance, aggressiveness and metastasis ability of tumors [20].

Jiang et al. demonstrated that loss of TEFM in the mouse heart resulted in mitochondrial cardiomyopathy with severe OXPHOS deficiency [13], and Wan et al. demonstrated that TEFM has a growth-promoting, metastatic hepatocellular carcinoma and metastasis of hepatocellular carcinoma [21].Currently, the expression of TEFM gene in glioma and its mechanism of action are not well understood. The aim of this study was to detect the expression and role of TEFM in gliomas and to investigate the potential mechanism of its biological function.

Materials and methods

Ethics

Experiments was approved by the Ethics Committee of Soochow University.

Chemicals and reagents

Puromycin, antibiotics and cell culture reagents were provided by Sigma-Aldrich (St. Louis, MO). All fluorescent dyes and kits were purchased from Thermo-Fisher Invitrogen (Shanghai, China). Antibodies used in this study were obtained from Cell Signaling Technology (Beverly, MA) and Abcam (Cambridge, UK). All primers, sequences and viral constructs were provided by Genechem Co. (Shanghai, China).

Cell culture

The A172, U251 and SHG-44 glioma cell lines were obtained from the cell bank of Shanghai Institutes for Biological Sciences (Shanghai, China) and have been tested and authenticated by the cell bank of Shanghai Institutes for Biological Sciences.A172, U251MG and SHG-44 were cultured in DMEM containing 1% penicillin-streptomycin and 10% fetal bovine serum (FBS). The source and culture of primary human glioma cells and primary human astrocytes have been previously described [22, 23]. All cells used were cultured at 37 °C with 5% CO2. All cells were free of mycoplasma contamination.

Human glioma tissues

This study was approved by the Ethics Committee of Soochow University and complied with the principles of the Declaration of Helsinki. Acquisition of human tissues, including glioma tissues and surrounding normal brain tissues, has been described previously [23]. Tissues were obtained from the Second Affiliated Hospital of Soochow University. All participants provided written informed consent.

TEFM knockout

Lentiviral CRISPR/Cas-9 TEFM KO constructs were provided by Shanghai Genechem (Shanghai, China). Glioblastoma cells were transduced with lentiviral CRISPR/Cas-9 TEFM KO constructs and formed stable cells with puromycin selection, respectively. qPCR and Western blotting confirmed TEFM knockdown at mRNA and protein levels, respectively. Control cells were treated with an empty vector (Santa Cruz Biotechnology) with nonsense sgRNA. The sgRNA sequences used for TEFM KO are listed in Table 1.

Table 1.

sgRNA primer sequences

Gene name qRT-PCR primer forward (5’-3’) qRT-PCR primer reverse (5’-3’)
TEFM ATGAGCGGGTCTGTCCTCTT AGTACAGGGATGACCTCGACG
Cytb ATCACTCGAGACGTAAATTATGGCT TGAACTAGGTCTGTCCCAATGTATG
Cox1 TCTCAGGCTACACCCTAGACCA ATCGGGGTAGTCCGAGTAACGT
NDUFB8 TACAACAGGAACCGTGTGGA CTGGTTCTTTGGAGGGATCA
β-actin TCGCCTTTGCGATCCG ATGATCTGGGTCATCTTCTCG
sgRNA Target DNA sequence PAM sequence
TEFM sgRNA GAAAACCGGTTCCTGAGAAA CCG
shRNA
Seq1 5-GTGAAGCAGTTTCTCTTCGAT-3
Seq1 5-GAGCATGAATCGAAATGCAGT-3

TEFM shRNA

Lentiviral particles containing human TEFM shRNA, obtained from Santa Cruz Biotech, were used to silence the target gene. Glioma cells were inoculated into 6-well plates to 50-60% confluence and treated with lentiviral particles containing human TEFM shRNA, and control cells were transfected with lentivirus with scrambled control nonsense shRNA (“shC”). Twenty-four hours after infection, cells were further cultured for 12–14 days in complete medium containing puromycin (1.0 µg/mL). expression of TEFM at the mRNA and protein levels was consistently confirmed in established cells.

TEFM overexpression

Cells were infected with lentivirus carrying the TEFM-overexpressing construct obtained from Santa Cruz Biotech. Stable cells were established after puromycin screening. qPCR and Western blotting confirmed overexpression of the target gene at the mRNA and protein levels, respectively. Control cells were stably transduced with an empty lentiviral vector (“Vec”).

Western blotting

Protocols for protein blotting and data quantification have been extensively described previously [24, 25]. Briefly, cells were lysed in TritonX-100 lysis buffer (1% TritonX-100, 10% glycerol, 50 mM HEPES pH 7.5, 150 mM NaCl, 100 mM NaF, 1 mM PMSF, 1 mM Na3VO4, and protease inhibitor mixture) and subjected to SDS-PAGE. sds-page Afterwards, proteins were transferred to a PVDF membrane (Biorad), closed with 10% milk for 30 min, and incubated with primary antibody at 4 °C overnight. The membrane was washed three times with PBST and incubated with the secondary antibody for 2 h at room temperature. The membrane was then washed three times with PBST and subjected to a fluorescent substrate (Thermo Scientific). The signal was detected with ChemiDoc XRS + Imager (Biorad).

RNA extraction and qRT-PCR assays

RNA from GBM tissues and cell lines was extracted with the RNeasy kit (Qiagen, Hiden, Germany) and reverse transcribed to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Bioysems, CA, USA). qRT-PCR (qRT-PCR) was carried out using SYBR Green Dye (Life Technologies) on a Corbett 6200 for quantitative real-time PCR (qRT-PCR). β-actin was used as a standardised reference gene. Sequences of forward and reverse primers are provided in Table 1.

Apoptosis assays

Apoptosis was determined in GBM cells using a membrane-bound protein V (FITC-conjugated) apoptosis kit (F-6012, US Everbright Inc.), used according to the manufacturer’s instructions, and the results were analysed by flow cytometry (Beckman, Fullerton, CA). To determine apoptosis in tissues, a TUNEL assay kit purchased from Roche biotech (11684795910) was used according to the manufacturer’s instructions. The percentage of TUNEL-positive cells was analysed using a fluorescent Olympus microscope. Cells with designed genetic modifications were initially seeded in six-well plates at 1 × 105 cells per well. Cells were then cultured for 72 h and stained with TUNEL (Invitrogen, Shanghai, China). DAPI was added to stain the nuclei. Cells were visualized under a fluorescent microscope (Leica). TUNEL ratio (% versus DAPI) was recorded.

ATP contents

The lysates of the cells with the described treatments were measured by an ATP assay kit (Biyuntian, Wuxi, China) and a mitochondrial complex I activity kit (Biyuntian, Wuxi, China). The cellular ATP levels and mitochondrial complex I activity were then tested based the attached protocols.

EdU staining

The glioma cells were inoculated into a 24-well plate with 4 × 104 cells per well and cultured for 72 h. According to the attached protocol, cell proliferation was quantified using the EdU (5-ethyl-20-deoxyuridine) ApolL-567 kit (RiboBio, Guangzhou, China). EdU and DAPI fluorescent dyes were added to glioma cells and the cells were observed under a fluorescence microscope (Leica, Shanghai, China). Three random views (n = 3) were used to calculate the average EdU ratio (% vs. DAPI).

Cell counting assay kit-8 (CCK-8)

Cells with applied genetic modifications were harvested with trypsin, resuspended, and seeded in 96-well plates at 3 × 103 cells per well. Cells were incubated for applied time periods and CCK-8 solution (10 µL per well, Dojindo, Japan) was added into each well (for 2 h). The absorbance of each well was measured at 450 nm on a microplate reader (Bio-Rad Laboratories, Shanghai, China).

Mitochondrial depolarization

With the reduction of mitochondrial membrane potential (MMP) and mitochondrial depolarization, the fluorescent probe JC-1 aggregate is decomposed into a monomer form, and the fluorescence emitted by the probe changes from red to green. The genetically modified or treated cells were inoculated into six-well plates at a density of 1.2 × 105 cells per well, and incubated with JC-1 in the dark at room temperature for 20 min. The intensity of JC-1 green monomer (488 nm) was measured by flow cytometry (Becton Dickinson). Representative images of the green and red fluorescent channels of JC-1 are given.

Migration and invasion analysis

In the “Transwell” migration experiment, 3 × 104 genetically modified cells were inoculated in 200 µL serum-free medium into the upper chamber of an 8 μm Transwell filter (Corning, Shanghai, China). 800µL culture solution containing 10% FBS was added into the lower cavity. After incubation, the lower surface cells were fixed with methanol, stained with 1% crystal violet, and observed under microscope. For invasion tests, Transwell filters are always pre-coated with Matrigel (BD Biosciences, Shanghai, China). For all of the “Transwell” trials in this study, five random views were included to calculate the average number of migrating/invading cells.

Tumor xenograft mouse model

To explore the effect of TEFM on GBM tumourigenicity in vivo, 1 × 106 TEFM stable knockout or control cells were injected subcutaneously into the flanks of 4-week-old BALB/c nude mice (12 mice randomly divided into two groups). Tumour volume was measured every 6 days and continued until day 30. Mice were executed and tumours were harvested.

Statistical analyses

All experiments were conducted in triplicate, and the data are presented as the mean ± standard deviation (SD). To assess statistical differences between groups, one-way ANOVA was performed, followed by post hoc Bonferroni correction for multiple comparisons (SPSS 22.0). Statistical significance was defined as a P-value < 0.05. For comparisons between two treatment groups, a two-tailed unpaired t-test was used (Excel 2021).

Results

TEFM is highly expressed in human gliomas and correlates with poor patient prognosis

To investigate the expression of TEFM in human gliomas, we first analyzed RNA-Seq data from the TCGA database. Compared to normal brain tissue, TEFM expression was significantly elevated in both low-grade gliomas (Fig. 1A) and glioblastomas (Fig. 1B), with expression levels increasing in correlation with glioma grade (Fig. 1C). Additionally, TEFM was highly expressed in tissue samples from patients older than 60 years (Fig. 1D) and in those with IDH wild-type gliomas (Fig. 1E). We also found that TEFM expression was strongly associated with the prognosis of glioma patients. Kaplan-Meier survival analysis demonstrated a negative correlation between TEFM expression and Progress Free Interval (PFI), Disease Specific Survival (DSS), and Overall survival in glioma patients. (Fig. 1F-H). AUC curves validated the survival model (Fig. 1I). Subsequently, differential genes were screened based on TEFM expression in gliomas and subjected to GSEA enrichment analysis, which showed that the epithelial-mesenchymal transition pathway (EMT pathway) had the strongest correlation (Fig. 1J). Thus, we decided to further explore the role played by the EMT pathway in gliomas.

Fig. 1.

Fig. 1

Relative expression levels of mRNA for TEFM in unpaired samples of LGG (A) and GBM (B) tissues and normal tissues were analysed using the TCGA database. The expression of TEFM in different grades of GBM was verified according to WHO grade (G2,G3,G4) (C). The expression of TEFM was analysed based on age size ( < = 60 or > 60) (D) and IDH mutation status (WT or Mut) (E). Subsequently, the Progress Free Interval (PFI), Disease Specific Survival (DSS) and Overall survival were plotted according to the high or low expression of TEFM in gliomas (F–H). ROC curves were also plotted to assess the validity of the modified survival curve model (I). Finally, differential genes were screened for GSEA enrichment analysis based on TEFM expression in GBM, and the top 9 enriched pathways were demonstrated based on NES score (I). *p < 0.05, ***p < 0.001

TEFM is highly expressed in glioma tissues and cells

To validate the results of our bioinformatics analysis, we examined TEFM expression in 11 paired human glioma samples (“T”) and adjacent normal brain tissues (“N”). qPCR analysis (Fig. 2A) revealed significantly higher TEFM expression in glioma tissues compared to normal brain tissues. Western blot analysis further confirmed that TEFM protein levels were upregulated in six representative GBM patient samples (Fig. 2B). Additionally, immunofluorescence staining showed that TEFM co-localized with mitochondria in human glioma cells (Fig. 2C). Compared to normal brain tissue (“N1”), TEFM expression was markedly higher in glioma tissue (“T1”). Further qPCR analysis (Fig. 2D) demonstrated that TEFM mRNA expression was significantly elevated in glioma cell lines (A172, U251, SHG-44) and primary human glioma cells (P1, P2) compared to primary human astrocytes. Both TEFM mRNA (Fig. 2E) and protein (Fig. 2F) expression were also significantly increased in primary glioma cells (“P1”/“P2”) and immortalized glioma cell lines (U251, A172, SHG-44). Collectively, these findings indicate that TEFM expression is upregulated in human GBM.

Fig. 2.

Fig. 2

Shows the expression of mRNA for TEFM in tumour tissue (“T”) and paired surrounding normal brain tissue (“N”) of 11 GBM patients (A), and demonstrates 6 representative pairs of patients with TEFM protein expression and quantitative results (B). A pair of human normal brain cells (N1) and human glioma cells (T1) were selected as representatives to demonstrate the location and expression of TEFM in the cells (C, D). The mRNA (E) and protein expression (F) and quantification of TEFM in the established primary human astrocyte cell line (Astrocytes1) and human glioma cell lines (U251,A172,SHG-44) as well as in two primary human glioma cell lines (Primary glioma cell P1/P2) are shown. Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “N1”/“N”/“Astrocytes1”. The experiments were repeated thrice. scale bar = 20 μm.Tubulin was used as an internal reference

TEFM knockdown inhibits human GBM cell proliferation and migration

To determine the effect of TEFM on GBM cell function, we constructed two lentiviruses with TEFM knockdown sequences and a negative control lentivirus (shC). TEFM expression was silenced via RNA interference in the U251 glioma cell line, which exhibits relatively high TEFM expression, and in primary human glioma cells (P1). TEFM knockdown was validated by qRT-PCR and Western blotting analysis (Fig. 3A, B, D, E). Additionally, the expression of epithelial-mesenchymal transition (EMT) markers—E-cadherin, N-cadherin, and Vimentin—was evaluated by Western blotting in TEFM-knockdown U251 and primary human GBM cells. The results demonstrated that TEFM knockdown significantly reduced N-cadherin and Vimentin expression while increasing E-cadherin levels (Fig. 3C, F).

Fig. 3.

Fig. 3

U251 and primary human glioma cells (P1) were transfected using TEFM shRNA lentiviruses (shTEFM-seq1, shTEFM-seq2) and negative control shRNA lentiviruses (shC) and stable transfected cell lines were established. Subsequently, TEFM mRNA and protein expression (A–C, D–F) and protein levels of EMT-associated markers (B, E) were detected and quantitatively analysed. Cells were cultured for the indicated times and then tested for cell viability (CCK-8 OD) (G), colony formation (H), proliferation (percentage of EdU-positive nuclei) (I), cell migration and invasion ability (J–K) using the methods described and quantified above. Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “shC”. The experiments were repeated thrice. scale bar = 100 μm. β-actin was used as an internal reference

Next, we detected the effect of TEFM on GBM cell function by CCK-8 assay (Fig. 3G), colony formation assay (Fig. 3H), EdU assay (Fig. 3I), and Transwell assay (Fig. 3J). The results showed that TEFM knockdown significantly inhibited cell proliferation, migration and invasion ability of U251 and primary human glioma cells compared with negative control cells.

TEFM knockout inhibits GBM cell proliferation and migration

To further elucidate the role played by TEFM in glioma (GBM), we transduced CRISPR/Cas-9 TEFM KO constructs in primary human GBM cells and U251 cells to establish stable cell lines (“koTEFM”). Immunoblotting showed that TEFM protein expression was reduced by more than 95% in koTEFM cells, and the expression of EMT markers (E-cadherin, N-cadherin, and Vimentin) was also detected. TEFM knockout significantly reduced the expression of N-cadherin and Vimentin, and increased the expression level of E-cadherin (Fig. 4A, B).

Fig. 4.

Fig. 4

Transfection and establishment of stably transfected cell lines using TEFM sgRNA lentiviral construct (koTEFM) and control empty lentivirus (Cas9C). Protein expression and quantification results of TEFM and EMT-related markers are shown (A, B). U251 and P1 cell viability (CCK-8 OD) (C, E), colony formation (D, F), proliferation (percentage of EdU-positive nuclei) (G, H), cell migration and invasion ability (I, J) were tested after the indicated times in culture and quantified for the above results. Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “Cas9C”. The experiments were repeated thrice. scale bar = 100 μm. β-actin was used as an internal reference

Next, we investigated the effect of TEFM depletion on the function of GBM cells. The CCK-8 assay showed that the cell viability (CCK-8 OD) of koTEFM GBM cells was significantly reduced (Fig. 4C, E). Colony formation assay (Fig. 4D, F) and EdU assay (Fig. 4G, H) showed that TEFM KO significantly inhibited GBM cell proliferation.Meanwhile, the results of Transwell assay indicated that TEFM KO inhibited GBM cell migration and invasion in vitro to a large extent (Fig. 4I, J). These results suggest that the TEFM gene promotes GBM malignant progression by inducing EMT to promote cell proliferation and migration.

Overexpression of TEFM enhances the proliferative activity as well as migration and invasion of GBM cells

Next, we introduced lentiviruses overexpressing TEFM with control viruses into U251 and primary human glioma cells, resulting in enhanced TEFM expression after quantitative polymerase chain reaction (qPCR) and western blotting showed enhanced mRNA levels (Fig. 5A, C) and protein expression (Fig. 5B, D), respectively. Meanwhile, western blotting detected significantly enhanced N-cadherin and Vimentin expression in U251 and primary human glioma cells overexpressing TEFM (Fig. 5B, D).In addition, the expression of E-cadherin were significantly reduced in U251 and primary human glioma cells overexpressing TEFM (Fig. 5B, D).

Fig. 5.

Fig. 5

Establishment of TEFM overexpression (OE-TEFM) in U251 and P1 cells and empty control cell groups (Vec). The mRNA (A, C) and protein expression levels (B, D) of TEFM and the expression of EMT pathway-related markers were detected in the above cells. Cells were cultured for the indicated times and then tested for cell CCK-8 OD values (E, G), colony formation (F, H), cell proliferation (nuclear EdU staining) (I, J), cell migration and invasion capacity (K, L), and the results were quantitatively analysed.Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “Vec”. The experiments were repeated thrice. Scale bar = 100 μm. β-actin was used as an internal reference

Subsequently, functional assays were performed on U251 and primary human glioma cells overexpressing TEFM: CCK-8 assay showed that the proliferative capacity of TEFM-overexpressing U251 and primary human glioma cells was significantly enhanced (Fig. 5E, G), and colony formation assay showed that the colony formation of TEFM-overexpressing GBM cells was significantly enhanced (Fig. 5F, H).

Subsequently, EdU proliferation assays were performed on TEFM overexpressing cells after a 72-hour incubation period. These assays showed a significant increase in the proliferation rate of TEFM overexpressing GBM cells compared to the control Vec group (Fig. 5I, J). In addition, Transwell assays showed that the migration and invasion ability of GBM cells overexpressing TEFM was significantly enhanced (Fig. 5K, L).

These results further supported that the TEFM gene plays an important function in GBM cells.

TEFM silencing triggers apoptosis in GBM cells

To assess the effect of TEFM silencing on apoptosis in GBM cells, we assayed cysteine asparaginase activity in shTEFM-seq1 and koTEFM GBM cells. Immunoblotting results showed that knockdown and knockout of TEFM significantly elevated cleaved caspase-3 and cleaved caspase-9 levels in both U251 and primary human glioma cells (Fig. 6A, B). The percentage of TUNEL-positive nuclei was increased in shTEFM and koTEFM GBM cells (Fig. 6C, D), and cell flow experiments further confirmed that TEFM deletion led to an increase in apoptosis (Fig. 6E, F).

Fig. 6.

Fig. 6

U251 and P1 cells transfected with TEFM shRNA lentivirus (shTEFM-1) and negative control lentivirus (shC), as well as U251 and P1 cells transfected with TEFM sgRNA lentivirus (koTEFM) and control airborne lentivirus (Cas9C) were cultured for the indicated times to determine the protein expression levels of caspase-3 cleavages and protein expression levels of caspase-9 cleavages (A, B). And the apoptosis levels of the relevant cells were detected by TUNEL-positive nuclear ratios (C, D) and flow cytometry (E, F). Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “shC”/“Cas9C”. The experiments were repeated thrice. scale bar = 100 μm. tubulin was used as an internal reference

These results collectively demonstrate that TEFM could promote the growth of GBM by inhibiting apoptosis.

TEFM deficiency disrupts mitochondrial function in GBM cells

Since TEFM is a key factor involved in the transcriptional regulation of mitochondrial genes [10], we next examined the effect of TEFM deficiency on mitochondrial function in GBM cells. As shown, TEFM shRNA or knockout resulted in significant ROS production in U251 and primary human glioma cells (Fig. 7A, B), and the accumulation of green JC-1 monomers indicated mitochondrial depolarization in shTEFM and koTEFM GBM cells (Fig. 7C, E). In addition, increased single-stranded DNA (ssDNA) content was detected in shTEFM and koTEFM GBM cells (Fig. 7D, F), supporting that TEFM deficiency leads to mitochondrial dysfunction caused by DNA damage.

Fig. 7.

Fig. 7

U251 and P1 cells transfected with TEFM shRNA lentivirus (shTEFM-1) and negative control lentivirus (shC), as well as U251 and P1 cells transfected with TEFM sgRNA lentivirus (koTEFM) and control airborne lentivirus (Cas9C) were cultured for the indicated times. Then cellular ROS levels were detected by testing CellRox (A, B), mitochondrial depolarisation was demonstrated by assaying JC-1 green monomer intensity demonstrating the degree of mitochondrial depolarisation (C, E), DNA damage were detected by testing single-stranded DNA (ssDNA) content (D, F) and quantitatively demonstrating all results. Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “shC”/“Cas9C”. The experiments were repeated thrice. scale bar = 100 μm

Taken together, these results suggest that TEFM deficiency disrupts mitochondrial function in GBM cells.

TEFM deficiency disrupts the mitochondrial respiratory chain in GBM cells

To investigate whether TEFM-deficiency-induced mitochondrial dysfunction is attributable to the reduction of mitochondrial transcripts, we examined the expression levels of mitochondrial respiratory chain complex subunits in shTEFM and koTEFM GBM cells by qRT-PCR and protein blotting. The results showed that mRNA (Fig. 8A, C) and protein expression (Fig. 8B, D) of respiratory chain complex subunits COX2, Cyb, and NDUFB8 were significantly reduced in TEFM-deficient U251 and primary human glioma cells compared to control cells.Importantly, genetic deletion of TEFM disrupted OXPHOS and energy production compared with control shC or Cas9C genetically treated groups. Since TEFM shRNA or KO reduced mitochondrial respiratory chain complex I activity (Fig. S1A, C), the ATP content in cells taken out by TEFM was reduced (Fig. S1B, D).

Fig. 8.

Fig. 8

Culture of U251 and P1 cells transfected with TEFM shRNA lentivirus (shTEFM-1) and negative control lentivirus (shC) as well as U251 and P1 cells transfected with TEFM sgRNA lentivirus (koTEFM) and control null lentivirus (Cas9C). The mitochondrial transcript Cyb and the mitochondrial respiratory chain complex Cox2, NDUFB8 were subsequently assayed for mRNA (A, C) and protein expression levels (B, D) in cells of the TEFM knockdown group and cells of the TEFM knockout group. Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “shC”/“Cas9C”. The experiments were repeated thrice. GAPDH was used as an internal reference

TEFM knockout inhibits GBM growth in nude mice in vivo

Finally, we performed in vivo tests to assess the effect of TEFM on GBM growth. We injected TEFM knockout (koTEFM) and blank control (Cas9C) P1 cells into the flanks of nude mice at 1 × 106, respectively, to establish experimental and control groups (“day 0”). Changes in body weight of mice were measured and recorded every 6 days (Fig. 9A). Starting from the 6th day, the tumor volume of each nude mouse was measured every 6 days (Fig. 9B). The results showed that the volume of xenografts obtained from the koTEFM group was significantly lighter compared with the control group (Fig. 9B). On “Day 10” and “Day 18”, one mouse from each group was euthanized and the tumor was carefully isolated. Western blotting analysis of xenograft tissues obtained on “day 10” and “day 18” showed that TEFM protein levels were significantly reduced in koTEFM-injected xenografts (Fig. 9C, D), and protein levels of the mitochondrial transcripts COX2, Cyb, and NDUFB8 were also reduced in the xenografts obtained from the experimental groups (Fig. 9E, F). On day 30, all experimental mice were euthanized and the tumors were carefully isolated and photographed for documentation (Fig. 9H). Finally, we performed immunohistochemical staining of the tumors in both groups, and the results showed that the TEFM and Ki-67 expression levels were significantly lower in the TEFM knockdown group (Fig. 9I), further confirming that TEFM deletion inhibits the growth of human glioma cells in vivo.

Fig. 9.

Fig. 9

Twelve nude mice were randomly divided into 2 groups (6 mice in each group) and injected with P1 cells using TEFM knockout (koTEFM) or blank control (Cas9C) (day 0), followed by measurement of mouse body weights and tumor volumes at 6-day intervals (A, B), and the transplanted tumours were removed from one randomly executed nude mouse from each group on days 10 and 18, respectively, and analysed quantitatively using western TEFM expression (C, D) and mitochondria-associated transcripts (E, F) were detected and quantified by western blotting. The xenograft tumours were removed on day 30 for photographs (G) and tumour weight (H) were recorded. Finally, immunohistochemical staining was performed on the xenograft tumours of the two groups of nude mice to detect the expression of TEFM and KI-67 in the tumour tissues, and brown colour represents positive staining (I). Data were presented as mean ± standard deviation (SD, n = 3). *P < 0.05 versus “Cas9C”. The experiments were repeated thrice. β-actin was used as an internal reference

Discussion

As the main site of oxidative phosphorylation (OXPHOS), mitochondria provide a strong guarantee for cell survival and various life activities [26, 27]. Tumour cells, however, have higher anabolic activity than normal cells and therefore also have stronger mitochondrial metabolic activity [28]. It has been shown that mitochondria play an important role in tumourigenesis and development [29, 30]. Martina Bajzikova et al. demonstrated that cancer cells lacking OXPHOS due to mtDNA deletion were unable to form tumours [31], and the inhibitory effect of inhibitors of oxidative phosphorylation on tumours was confirmed by Molina JR et al. [32]. As the most malignant primary brain tumour in adults [33], the highly infiltrative and invasive nature of glioblastoma makes its eradication extremely difficult, and glioma cells are highly dependent on mitochondrial oxidative phosphorylation (OXPHOS) for ATP production [34]. Duan et al. demonstrated in their study that the glioma U251 cell line was able to convert the major metabolic pathway from glycolysis to oxidative phosphorylation (OXPHOS) to produce ATP to sustain itself [34]. Therefore, inhibition of mitochondrial oxidative phosphorylation (OXPHOS) could be a new strategy for glioma therapy.

Our results show that TEFM expression is upregulated in glioma tissues, with high expression correlating with poor prognosis in patients. This is consistent with previous studies that have linked mitochondrial dysfunction and the dysregulation of mitochondrial-related proteins to the aggressive nature of various cancers, including GBM. Specifically, TEFM overexpression promotes glioma cell proliferation, migration, and invasion, whereas TEFM depletion suppresses these processes and induces apoptosis, demonstrating its role in sustaining malignant phenotypes. Notably, TEFM’s involvement in the epithelial-mesenchymal transition (EMT) pathway underscores its contribution to the metastatic potential of glioma cells, a finding that aligns with broader research on mitochondrial proteins in cancer progression.

Mitochondrial transcription factors such as TEFM, along with other mitochondrial regulatory proteins, have increasingly been recognized as critical modulators of tumor metabolism and aggressiveness. For instance, mitochondrial transcription factor A (TFAM), which regulates mitochondrial DNA replication and transcription, has been shown to be upregulated in various cancers, contributing to altered mitochondrial function and enhanced tumor cell survival [35]. Similarly, mitochondrial transcription factor B1 (MTFB1) has been implicated in promoting cancer cell proliferation by modulating mitochondrial biogenesis and oxidative stress response [35]. Both TFAM and MTFB1 enhance mitochondrial function, facilitating a metabolic shift in cancer cells that supports their rapid growth and adaptation to hypoxic conditions. TEFM, like these factors, appears to play a central role in maintaining mitochondrial function, specifically by ensuring efficient transcription of mitochondrial genes involved in oxidative phosphorylation and ATP production.

Moreover, our findings that TEFM depletion results in impaired mitochondrial respiratory chain function, with decreased expression of critical subunits like COX2, Cyb, and NDUFB8, further links TEFM to mitochondrial bioenergetics and the maintenance of cellular energy. This observation is consistent with research showing that alterations in the mitochondrial respiratory chain often lead to metabolic reprogramming in cancer cells, promoting tumorigenesis and resistance to cell death [36]. Sovilj et al. found increased/decreased expression of mitochondria-encoded respiratory complex subunits and stable/unstable mitochondrial transcription elongation factor TEFM in Bax/Bak-deficient U87 cells. Down-regulation of TEFM expression using shRNAs attenuates mitochondrial respiration in Bax/Bak-deficient U87 cells. It is suggested that (post-translational) regulation of TEFM levels in glioma cells regulates the levels of mitochondrial respiratory complex subunits [37].The connection between mitochondrial dysfunction and cancer has been well-established, with numerous studies identifying mitochondrial transcription factors as key drivers of the metabolic shifts that underlie cancer cell survival, invasion, and resistance to therapies.

The data from in vivo experiments further corroborate the in vitro findings, showing that TEFM knockout (koTEFM) significantly inhibits glioma growth in xenograft models, thus reinforcing the potential of targeting TEFM for therapeutic intervention. Taken together, these results place TEFM within a network of mitochondrial proteins that regulate cellular bioenergetics and tumor progression. Given its involvement in both mitochondrial function and the regulation of the EMT pathway, TEFM emerges as a promising candidate for novel therapeutic strategies aimed at disrupting mitochondrial function to inhibit GBM progression.

Future studies will need to explore the broader implications of TEFM dysregulation in other cancer types and the detailed molecular mechanisms by which TEFM modulates mitochondrial activity and interacts with other key signaling pathways. Targeting TEFM, possibly in combination with other metabolic inhibitors or EMT pathway modulators, could provide a novel and effective approach to overcoming the challenges of treating highly aggressive cancers such as glioblastoma.

Conclusion

Taken together, overexpressed TEFM is an important mitochondrial protein for glioblastoma (GBM) cell growth and represents as a new and promising diagnostic/therapeutic target.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (557.9KB, docx)

Acknowledgements

This project was completed by Institute for Excellence in Clinical Medicine of Kunshan First People’s Hospital and Soochow University.

Author contributions

All authors declare that the article has no conflict of interest.

Funding

This certificate verifies that its holder has been awarded a fellowship from the China Postdoctoral Science Foundation(Certificate Number: 2023M741486) and the National Natural Science Foundation of China (82403043).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of the First People’s Hospital of Kunshan, Jiangsu University and written informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. All experiments were conducted following the Guide for the Care and Use of Laboratory Animals (China)(Number: 202403A0778).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yin Wang, Wenxuan Hu and Boya Zhou contributed equally to this work.

Contributor Information

Zhiyong Deng, Email: yichun1988@yeah.net.

Minbin Chen, Email: mbinchen@163.com.

References

  • 1.Quinones A, Le A. The multifaceted glioblastoma: from genomic alterations to metabolic adaptations. Adv Exp Med Biol. 2021;1311:59–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang LM, Englander ZK, Miller ML, Bruce JN. Malignant glioma. Adv Exp Med Biol. 2023;1405:1–30. [DOI] [PubMed] [Google Scholar]
  • 3.van Solinge TS, Nieland L, Chiocca EA, Broekman MLD. Advances in local therapy for Glioblastoma - taking the fight to the tumour. Nat Rev Neurol. 2022;18(4):221–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zlochower A, Chow DS, Chang P, Khatri D, Boockvar JA, Filippi CG. Deep learning AI applications in the imaging of Glioma. Top Magn Reson Imaging. 2020;29(2):115–0. [DOI] [PubMed] [Google Scholar]
  • 5.Bilmin K, Kujawska T, Grieb P. Sonodynamic therapy for gliomas. Perspectives and prospects of selective sonosensitization of glioma cells. Cells. 2019;8(11). [DOI] [PMC free article] [PubMed]
  • 6.Sun X, Turcan S. From laboratory studies to clinical trials: temozolomide use in IDH-Mutant gliomas. Cells. 2021;10(5). [DOI] [PMC free article] [PubMed]
  • 7.Ashton TM, McKenna WG, Kunz-Schughart LA, Higgins GS. Oxidative phosphorylation as an emerging target in Cancer Therapy. Clin Cancer Res. 2018;24(11):2482–90. [DOI] [PubMed] [Google Scholar]
  • 8.Yang Y, Karakhanova S, Hartwig W, D’Haese JG, Philippov PP, Werner J, Bazhin AV. Mitochondria and mitochondrial ROS in Cancer: novel targets for Anticancer Therapy. J Cell Physiol. 2016;231(12):2570–81. [DOI] [PubMed] [Google Scholar]
  • 9.Birsoy K, Possemato R, Lorbeer FK, Bayraktar EC, Thiru P, Yucel B, Wang T, Chen WW, Clish CB, Sabatini DM. Metabolic determinants of cancer cell sensitivity to glucose limitation and biguanides. Nature. 2014;508(7494):108–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Minczuk M, He J, Duch AM, Ettema TJ, Chlebowski A, Dzionek K, Nijtmans LG, Huynen MA, Holt IJ. TEFM (c17orf42) is necessary for transcription of human mtDNA. Nucleic Acids Res. 2011;39(10):4284–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hillen HS, Parshin AV, Agaronyan K, Morozov YI, Graber JJ, Chernev A, Schwinghammer K, Urlaub H, Anikin M, Cramer P, Temiakov D. Mechanism of transcription anti-termination in human mitochondria. Cell. 2017;171(5):1082–e109313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Posse V, Shahzad S, Falkenberg M, Hallberg BM, Gustafsson CM. TEFM is a potent stimulator of mitochondrial transcription elongation in vitro. Nucleic Acids Res. 2015;43(5):2615–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jiang S, Koolmeister C, Misic J, Siira S, Kuhl I, Silva Ramos E, Miranda M, Jiang M, Posse V, Lytovchenko O, Atanassov I, Schober FA, Wibom R, Hultenby K, Milenkovic D, Gustafsson CM, Filipovska A, Larsson NG. TEFM regulates both transcription elongation and RNA processing in mitochondria. EMBO Rep. 2019;20(6). [DOI] [PMC free article] [PubMed]
  • 14.Cheng Z, Ristow M. Mitochondria and metabolic homeostasis. Antioxid Redox Signal. 2013;19(3):240–2. [DOI] [PubMed] [Google Scholar]
  • 15.Weinberg SE, Chandel NS. Targeting mitochondria metabolism for cancer therapy. Nat Chem Biol. 2015;11(1):9–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kupek E, Liberali R, Assis MAA. Time trend estimation of food consumption in repeated studies with different versions of food questionnaire among Brazilian schoolchildren aged 7 to 11 years. Cien Saude Colet. 2022;27(2):665–76. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang X, Li Y, Terranova M, Ortmann S, Kehraus S, Gerspach C, Kreuzer M, Clauss M, Hummel J. A pilot investigation on the effect of induced saliva flow on digestive parameters in sheep, and a comparison with cattle. J Anim Physiol Anim Nutr (Berl). 2023;107(5):1176–86. [DOI] [PubMed] [Google Scholar]
  • 18.Gupta R, Arora K, Roy SS, Joseph A, Rastogi R, Arora NM, Kundu PK. Platforms, advances, and technical challenges in virus-like particles-based vaccines. Front Immunol. 2023;14:1123805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yamada-Okahara N, Kyo A, Hirayama K, Yamamoto M, Kohno T, Honda S. Practical treatment options for persistent central serous chorioretinopathy and early visual and anatomical outcomes. Jpn J Ophthalmol. 2023;67(3):295–300. [DOI] [PubMed] [Google Scholar]
  • 20.Nakamura S, Inada E, Saitoh I, Sato M. Recent genome-editing approaches toward post-implanted fetuses in mice. BioTech (Basel). 2023;12(2). [DOI] [PMC free article] [PubMed]
  • 21.Wan L, Wang Y, Zhang Z, Wang J, Niu M, Wu Y, Yang Y, Dang Y, Hui S, Ni M, Wan B, Bao D. Elevated TEFM expression promotes growth and metastasis through activation of ROS/ERK signaling in hepatocellular carcinoma. Cell Death Dis. 2021;12(4):325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Guo YZ, Chen G, Huang M, Wang Y, Liu YY, Jiang Q, Cao C, Liu F. TIMM44 is a potential therapeutic target of human glioma. Theranostics. 2022;12(17):7586–602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhang YM, Zhang ZQ, Liu YY, Zhou X, Shi XH, Jiang Q, Fan DL, Cao C. Requirement of Galphai1/3-Gab1 signaling complex for keratinocyte growth factor-induced PI3K-AKT-mTORC1 activation. J Invest Dermatol. 2015;135(1):181–91. [DOI] [PubMed] [Google Scholar]
  • 24.Cao C, Huang X, Han Y, Wan Y, Birnbaumer L, Feng GS, Marshall J, Jiang M, Chu WM. Galpha(i1) and galpha(i3) are required for epidermal growth factor-mediated activation of the Akt-mTORC1 pathway. Sci Signal. 2009;2(68):ra17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Marshall J, Zhou XZ, Chen G, Yang SQ, Li Y, Wang Y, Zhang ZQ, Jiang Q, Birnbaumer L, Cao C. Antidepression action of BDNF requires and is mimicked by Galphai1/3 expression in the hippocampus. Proc Natl Acad Sci U S A. 2018;115(15):E3549–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Annesley SJ, Fisher PR. Mitochondria in health and disease. Cells. 2019;8(7). [DOI] [PMC free article] [PubMed]
  • 27.Nunnari J, Suomalainen A. Mitochondria: in sickness and in health. Cell. 2012;148(6):1145–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mitsuishi Y, Taguchi K, Kawatani Y, Shibata T, Nukiwa T, Aburatani H, Yamamoto M, Motohashi H. Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell. 2012;22(1):66–79. [DOI] [PubMed] [Google Scholar]
  • 29.Cadassou O, Jordheim LP. OXPHOS inhibitors, metabolism and targeted therapies in cancer. Biochem Pharmacol. 2023;211:115531. [DOI] [PubMed] [Google Scholar]
  • 30.Zong WX, Rabinowitz JD, White E. Mitochondria Cancer Mol Cell. 2016;61(5):667–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bajzikova M, Kovarova J, Coelho AR, Boukalova S, Oh S, Rohlenova K, Svec D, Hubackova S, Endaya B, Judasova K, Bezawork-Geleta A, Kluckova K, Chatre L, Zobalova R, Novakova A, Vanova K, Ezrova Z, Maghzal GJ, Magalhaes Novais S, Olsinova M, Krobova L, An YJ, Davidova E, Nahacka Z, Sobol M, Cunha-Oliveira T, Sandoval-Acuna C, Strnad H, Zhang T, Huynh T, Serafim TL, Hozak P, Sardao VA, Koopman WJH, Ricchetti M, Oliveira PJ, Kolar F, Kubista M, Truksa J, Dvorakova-Hortova K, Pacak K, Gurlich R, Stocker R, Zhou Y, Berridge MV, Park S, Dong L, Rohlena J, Neuzil J. Reactivation of Dihydroorotate dehydrogenase-driven pyrimidine biosynthesis restores Tumor Growth of respiration-deficient cancer cells. Cell Metab. 2019;29(2):399–416. e10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Molina JR, Sun Y, Protopopova M, Gera S, Bandi M, Bristow C, McAfoos T, Morlacchi P, Ackroyd J, Agip AA, Al-Atrash G, Asara J, Bardenhagen J, Carrillo CC, Carroll C, Chang E, Ciurea S, Cross JB, Czako B, Deem A, Daver N, de Groot JF, Dong JW, Feng N, Gao G, Gay J, Do MG, Greer J, Giuliani V, Han J, Han L, Henry VK, Hirst J, Huang S, Jiang Y, Kang Z, Khor T, Konoplev S, Lin YH, Liu G, Lodi A, Lofton T, Ma H, Mahendra M, Matre P, Mullinax R, Peoples M, Petrocchi A, Rodriguez-Canale J, Serreli R, Shi T, Smith M, Tabe Y, Theroff J, Tiziani S, Xu Q, Zhang Q, Muller F, DePinho RA, Toniatti C, Draetta GF, Heffernan TP, Konopleva M, Jones P, Di Francesco ME. and J.R. Marszalek, An inhibitor of oxidative phosphorylation exploits cancer vulnerability. Nat Med. 2018;24(7):1036–1046. [DOI] [PubMed]
  • 33.Cloughesy TF, Cavenee WK, Mischel PS. Glioblastoma: from molecular pathology to targeted treatment. Annu Rev Pathol. 2014;9:1–25. [DOI] [PubMed] [Google Scholar]
  • 34.Duan K, Liu ZJ, Hu SQ, Huo HY, Xu ZR, Ruan JF, Sun Y, Dai LP, Yan CB, Xiong W, Cui QH, Yu HJ, Yu M, Qin Y. Lactic acid induces lactate transport and glycolysis/OXPHOS interconversion in glioblastoma. Biochem Biophys Res Commun. 2018;503(2):888–94. [DOI] [PubMed] [Google Scholar]
  • 35.Floriano JF, Willis G, Catapano F, Lima PR, Reis F, Barbosa AMP, Rudge MVC, Emanueli C. Exosomes could offer New options to combat the long-term complications inflicted by gestational diabetes mellitus. Cells. 2020;9(3). [DOI] [PMC free article] [PubMed]
  • 36.Hitotsuyanagi Y. Design and synthesis of analogues of RA-VII-an antitumor bicyclic hexapeptide from Rubiae radix. J Nat Med. 2021;75(4):752–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sovilj D, Kelemen CD, Dvorakova S, Zobalova R, Raabova H, Kriska J, Hermanova Z, Knotek T, Anderova M, Klener P, Filimonenko V, Neuzil J, Andera L. Cell-specific modulation of mitochondrial respiration and metabolism by the pro-apoptotic Bcl-2 family members Bax and Bak. Apoptosis. 2024;29(3–4):424–38. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (557.9KB, docx)

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from Cancer Cell International are provided here courtesy of BMC

RESOURCES