Skip to main content
Microorganisms logoLink to Microorganisms
. 2024 Dec 15;12(12):2595. doi: 10.3390/microorganisms12122595

CRISPR-Cas-Based Pen-Side Diagnostic Tests for Anaplasma marginale and Babesia bigemina

Robert Muriuki 1,2, Maingi Ndichu 1, Samuel Githigia 1, Nicholas Svitek 2,*
Editors: Peter Neubauer, Brett Lidbury, Paolo Calistri, Francesco Broccolo, Marianna Marangi
PMCID: PMC11678693  PMID: 39770798

Abstract

Anaplasma marginale and Babesia bigemina are tick-borne pathogens, posing significant threats to the health and productivity of cattle in tropical and subtropical regions worldwide. Currently, detection of Babesia bigemina and Anaplasma marginale in infected animals relies primarily on microscopic examination of Giemsa-stained blood or organ smears, which has limited sensitivity. Molecular methods offer higher sensitivity but are costly and impractical in resource-limited settings. Following the development of a pen-side test for detecting Theileria parva infections in cattle, we have created two additional CRISPR-Cas12a assays targeting Anaplasma marginale and Babesia bigemina. The assays target the major surface protein 5 (MSP5) for A. marginale and rhoptry-associated protein 1a (RAP1a) for B. bigemina. These additional tests involve a 20 min recombinase polymerase amplification (RPA) reaction followed by a 60 min CRISPR-Cas12a detection with a lateral strip readout. Results demonstrate high specificity, with no cross-reactivity against other tick-borne parasites, and a limit of detection down to 102 DNA copies/µL of each target marker. The findings pave the way for sensitive and user-friendly pen-side tests to diagnose A. marginale and B. bigemina infections.

Keywords: babesiosis, anaplasmosis, pen-side test, point-of-care diagnostics, CRISPR-Cas powered diagnostics

1. Introduction

We recently developed a rapid pen-side test for Theileria parva, the causative agent of East Coast fever (ECF), using the RPA/CRISPR-Cas technologies [1]. In our desire to design better tools for the differential diagnosis of a number of other tick-borne diseases that share clinical signs, we aimed to increase our portfolio of rapid CRISPR-Cas pen-side tests targeting two additional tick-borne pathogens, Babesia bigemina and Anaplasma marginale.

These pathogens cause babesiosis and anaplasmosis, respectively, both of which are important tick-borne diseases of cattle worldwide. Bovine babesiosis is a globally distributed tick-borne protozoan disease caused by pathogenic species such as Babesia bovis, B. bigemina, and B. divergens. Clinically the disease manifests by fever, anemia, hemoglobinuria, and splenomegaly, resulting in the death of the animal [2]. In Africa, including Kenya, bovine babesiosis is caused by Babesia bigemina and Babesia bovis. Babesia bigemina is more widespread, while B. bovis is more critical and pathogenic, and they are both transmitted by Rhipicephalus ticks [3]. Another major tick-borne bacterial disease in cattle is bovine anaplasmosis, caused by intracellular bacteria known as Anaplasma and is mainly transmitted by Rhipicephalus (Boophilus) microplus ticks [4]. The causative agents in this genus are A. marginale, A. centrale, A. phagocytophilum, and A. bovis. Anaplasma marginale infects red blood cells and is highly pathogenic in cattle with a wide distribution in tropical and subtropical regions [5]. In young calves, A. marginale causes persistent fever, anemia, jaundice, lethargy, and weight loss, while in adults it causes abortion in pregnant animals, decreased milk yield in lactating animals, and death in over 50% of untreated animals [6]. Babesia bigemina and A. marginale cause mortalities and morbidities leading to losses in the production of milk, meat, and other livestock by-products. Consequently, they cause severe economic losses to livestock farmers involved in dairy and beef production in tropical and sub-tropical regions [3].

Diagnosis of these diseases has mostly relied on clinical signs [7], which is not confirmatory because most clinical signs are shared among most tick-borne diseases (TBDs) and microscopic examination of Giemsa-stained blood smears [8]. However, microscopy is relatively insensitive, and it is difficult to identify the organisms to the species level [9]. Serological methods have been applied for the detection of antibodies [10,11], but they do not show current infection. Molecular methods have been exploited for the detection of these infections, such as the reverse line blot hybridization assay [12] and the nested polymerase chain reaction (nPCR) [13,14], which have proved to be more sensitive and specific in the diagnosis of these diseases, discriminating to the species level. However, the limitation with these tests is that they require expensive equipment and specialized labor, making them unreachable to farmers in resource-limited areas that need these tests.

In our previous study [1], we developed an RPA/CRISPR-Cas12a-based pen-side assay for detecting T. parva in cattle. This assay demonstrated the ability to identify eight T. parva field strains, with a detection limit of one infected cell per 3 µL of blood. Initially, the assay was optimized using PCR as a pre-amplification step and a flow cytometry readout. To enhance field applicability, the method was then adapted to include an RPA pre-amplification step and a lateral flow strip readout. Following a similar development process, this current study describes the creation of two additional RPA/CRISPR-Cas12a-based diagnostic assays targeting the A. marginale major surface protein 5 (msp5) and B. bigemina rhoptry-associated protein 1a (RAP1a) genes.

2. Materials and Methods

The assays developed in this study were designed and optimized in a similar way as previously described in [1] and the steps summarized below (Figure 1).

Figure 1.

Figure 1

Schematic representation of the steps taken in the development of the assays. Created in BioRender. Svitek, N. (2024) BioRender.com/a88f007.

2.1. Bioinformatics Analysis

The major surface protein 5 (msp5) and the rhoptry-associated protein 1a (RAP1a) genes were used as target markers for A. marginale and B. bigemina, respectively, due to their previous use in the molecular detection of these pathogens [5,15]. Therefore, three complete coding sequences (CDS) of the Anaplasma marginale msp5 (accession numbers AY714547.1, ON456134.1, and ON456135.1) and three partial coding sequences of Babesia bigemina RAP1a (accession numbers KP893330.1, KP347558.1, and KP347559.1) were downloaded from the National Center for Biotechnology Information (NCBI). A multiple sequence alignment was carried out with these A. marginale and B. bigemina genes to identify the conserved regions in both genes. The conserved regions were then used to design CRISPR RNA (crRNA) targets as well as polymerase chain reaction (PCR) and recombinase polymerase assay (RPA) primers used for pre-amplification.

2.2. CRISPR RNA (crRNA) and RPA/PCR Primer Design

The crRNAs and primers design followed the methods described in [1]. Synthesis and purification of the crRNAs were carried out by Integrated DNA Technologies (IDT, Coralville, IA, USA). Four crRNAs, with two per gene, were designed and used in this study as shown in Table 1.

Table 1.

CRISPR RNA (crRNA) sequences specific towards msp5 and RAP1a genes used in this study.

CRISPR RNA Sequence Length
msp5 crRNA 1 rUrArA rUrUrU rCrUrA rCrUrAr rArGrU rGrUrA rGrArU rCrArG rCrArA rArArU rCrGrG rCrGrA rGrArG rGrU 41
msp5 crRNA 2 rUrArA rUrUrU rCrUrA rCrUrA rArGrU rGrUrA rGrArU rGrArU rGrCrG rArGrA rArUrU rCrArG rArUrG rCrU 41
RAP1a crRNA 1 rUrArA rUrUrU rCrUrA rCrUrA rArGrU rGrUrA rGrArU rUrUrG rUrUrA rGrCrU rUrGrU rUrGrA rArGrA rArG 41
RAP1a crRNA 2 rUrArA rUrUrU rCrUrA rCrUrA rArGrU rGrUrA rGrArU rGrGrU rArUrC rCrArG rArArG rGrCrG rUrUrG rArA 41

Two pairs of primers per target marker (F1 and R1 and F2 and R2) were designed as shown in Table 2, amplifying amplicon sizes of 108 and 122 base pairs (bp), respectively, for A. marginale and 202 and 181 bp, respectively, for B. bigemina. Each amplicon was targeted by a single crRNA. Later the primers were mixed to incorporate dual crRNAs per target by combining the forward primer of set 1 (F1) with the reverse primer of set 2 (R2) of each target marker. These modified primer sets amplified amplicon sizes of 414 and 399 bp for A. marginale and B. bigemina, respectively. Synthesis and purification of the primers were carried out by Macrogen Incorporated (Amsterdam, The Netherlands). The RPA primers designed also served as PCR primers. The designed sequences for both A. marginale and B. bigemina were run on the NBCI BLAST platform to confirm their specificity to each parasite.

Table 2.

Sequences of MSP5 and RAP1a recombinase polymerase amplification (RPA) primers designed and used in the assay to detect Anaplasma marginale and Babesia bigemina, respectively.

Primer Sequence Length
msp5 F1 GCCGTGTTCCTGGGGTACTCCTATGTGAACAA 32
msp5 R1 AGACGCGGAGGCTATGCCCTCACTTACAACTT 32
msp5 F2 CTGTTGATCCGAAAAATGACACCGTAGCCAAGC 33
msp5 R2 CTTGTAGTTTTCAACCAGGCTCTTTATGTCTGC 33
RAP1a F1 GACGCTGCCTTCATGCTTTTCAGGGAAAGTGA 32
RAP1a R1 ACAACGTAGTCATGTAGAAGTACTGCGATGCG 32
RAP1a F2 GACCGTTGACTTTACGGCGGCTAAGTTCTTCA 32
RAP1a R2 CATCATGTACTCGCCGTAGCCGCTAGCTATTT 32

2.3. DNA Preparation

The DNA used for assay optimization was extracted from tick salivary glands infected with either Anaplasma marginale or Babesia bigemina. Assay specificity was tested using DNA from other tick-borne pathogens, such as Theileria parva, Theileria mutans, and Theileria lestoquardi.

2.4. PCR and RPA Pre-Amplification of msp5 and RAP1a Gene

For specificity testing, PCR was performed in a 25 µL reaction mixture consisting of 3 µL of the DNA template, 3 µL of 10X PCR buffer, 2.4 µL of 10 µM of dNTPs mix, 5 µL of 25 mM MgCl2, 1.5 µL of 10 nM of each primer, and 1.5 units of DNA polymerase (Sigma Aldrich, St. Louis, MO, USA). The amplification protocol consisted of an initial denaturation step at 95 °C for 1 min, followed by 35 cycles of 94 °C for 10 s, 55 °C for 20 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min.

To assess the sensitivity of the assays, a high-fidelity PCR was performed to generate high-quality amplicons. The PCR was set up in a final volume of 25 µL, containing 12.5 µL of Q5® High-Fidelity 2X DNA Polymerase from New England Biolabs (Ipswich, MA, USA, Cat No. M0515), 2.5 µL of 10 nM of each primer, and 5 µL of DNA template. The amplification protocol was carried out as follows: an initial denaturation step at 98 °C for 30 s was followed by 35 cycles of 98 °C for 10 s, 55 °C for 20 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The amplicons were purified using the Zymo DNA Clean and Concentrator Kit from Zymo Research (Irvine, CA, USA, Cat. No. D4033). The purified amplicons were viewed on a 1.5% agarose gel. The copy numbers of these purified amplicons were determined using the formula below:

Number of copies (molecules)=X ng6.0221×1023 molecules/moleN660 g/mol +1×109 ng/g,

where X = amount of amplicon (ng), N = length of dsDNA amplicon, 660 g/mol = average mass of 1 bp dsDNA, 6.022 × 1023 = Avogadro’s constant, and 1 × 109 = conversion factor.

After determining the copy numbers, dilutions were prepared ranging from 1010 to 100 copies/µL for each target. One microliter of each dilution was used as a template for both PCR and RPA preamplification. All the assays were first optimized with PCR as a preamplification step and flow cytometry as the readout before switching to RPA and lateral flow strip readout (Figure 1).

The RPA reaction mixture was performed in a 50 µL reaction system using the commercially available TwistAmp basic kit (TwistDx, Cambridge, UK). A master mix (44.5 µL) consisting of 29.5 µL of rehydration buffer, 2.4 µL of each primer (forward and reverse primers, 10 μM), and 10.2 µL of nuclease-free water was added to the lyophilized pellet and mixed by gentle pipetting. Three microliters of DNA template were added to the reaction tubes. Then, 2.5 µL of magnesium acetate (280 mM) was placed on the tube lid. The tubes were gently closed and centrifuged. These tubes were immediately incubated at 39 °C for 20 min. For the sensitivity assays, the DNA template was reduced to 1 µL.

2.5. CRISPR-Cas12a Detection

The Lachnospiraceae bacterium Cas12a (Lba Cas12a) trans-cleavage assays for the single crRNA approach were performed as described previously [1]. The reaction was carried out in a 30 µL reaction volume. Firstly, the Cas12a ribonucleoprotein was formed by preparation of a master mix that included 2 µL of Lba Cas12a (500 nM, New England Biolabs, M0653T), 3 µL of crRNA 1 (500 nM), 3 µL of 10X NEBuffer™ r2.1, and 18 µL of nuclease-free water and pipetted into reaction tubes. The tubes were incubated at 25 °C for 15 min, after which 1 µL of ssDNA fluorescent probe (500 nM) and 3 µL of pre-amplified DNA template were added. The reaction was mixed gently and spun and immediately incubated at 37 °C for 1 h. The dual crRNA approach Lba Cas12a assays were performed in a similar manner but adjusted slightly by replacing 3 µL of nuclease-free water with an equal volume of crRNA 2 (500 nM).

2.6. Flow Cytometry Assay

The assay was carried out as previously described in [1]. The data analysis was performed by calculating the fluorescence intensity ratio using the following formula: MFIbeads+probe/MFIsample. All graphs were generated with the GraphPad Prism 10.3.1 software.

2.7. Lateral Flow Strip Assay

To read the detection result using the lateral flow assay, 10 µL of the sample to be analyzed was added to 100 μL of the HybriDetect assay buffer and mixed gently. A lateral flow strip was placed into the mixture and incubated for 3 min at room temperature. After which they were removed, and results interpreted immediately. A sample was considered positive when the test band (upper band) appeared significantly stained, while negative samples only had the control line (lower band) visibly stained.

3. Results

3.1. The Single crRNA (crRNA1)/CRISPR-Cas12a Assay Is Highly Specific

To ensure the specificity of the Cas12a-based assays for A. marginale and B. bigemina, we tested these PCR-Cas12a reactions using the DNA from these parasites as well as the Theileria species T. parva, T. mutans, and T. lestoquardi. The specificity was tested using a single crRNA per target. Data obtained from the single crRNA approach showed that only A. marginale and B. bigemina samples demonstrated trans-cleavage of the fluorescent probe, while the same was not observed in the Theileria species (Figure 2).

Figure 2.

Figure 2

Histogram representation of the flow cytometry-based readout for the specificity of the PCR/Cas12a assays using the single crRNA approach for (a) A. marginale and (b) B. bigemina.

3.2. The Single crRNA (crRNA 1)/CRISPR-Cas12a Assay Demonstrates Fair Sensitivity

The limit of detection for both A. marginale and B. bigemina assays was determined using purified PCR amplicons with the flow cytometry readout and using a single crRNA approach. The A. marginale-specific test was able to detect up to 105 DNA copies of the msp5 gene per µL, while the B. bigemina-specific test was slightly more sensitive with a detection limit of 104 DNA copies of the RAP1a gene per µL (Figure 3).

Figure 3.

Figure 3

Flow cytometry readout for the sensitivity of the PCR-Cas12a assays. (a) Sensitivity of the A. marginale assay with a single crRNA (1), (b) Sensitivity of the B. bigemina-specific test with a single crRNA (1).

3.3. The Dual crRNA/CRISPR-Cas12a Assay Is Highly Specific

Since the assay using a single crRNA was not sensitive enough, we decided to add an additional crRNA, targeting a larger amplicon, to each test to improve their sensitivity. The first step was to assess the specificity of the PCR-Cas12a dual crRNA assay for each test. The results with the dual crRNA were consistent with those observed using the single crRNA, as again only the A. marginale or the B. bigemina samples elicited the trans-cleavage of the FAM-biotin probe when their respective primer pairs and crRNAs were used (Figure 4).

Figure 4.

Figure 4

Histogram representation of the flow cytometry-based readout for the specificity of the PCR-Cas12a assays using dual crRNAs for (a) A. marginale and (b) B. bigemina.

3.4. The Dual crRNA/CRISPR-Cas12a Assay Demonstrates Enhanced Sensitivity

The sensitivity of the assays using dual crRNAs per target was then tested. A significant increase from 102- to 103-fold in assay sensitivity with both tests was observed. The limit of detection for both tests improved to 102 DNA copies per μL for each target gene (Figure 5).

Figure 5.

Figure 5

Flow cytometry readout for the sensitivity of the PCR-Cas12a assays using two crRNAs per target gene. (a) Sensitivity of the A. marginale assay with dual crRNAs, (b) sensitivity of the B. bigemina-specific test with dual crRNAs.

3.5. Developing a Field Deployable-Based Lateral Flow-Based Assay

After optimizing the assays using the PCR pre-amplification step and a flow cytometry-based readout, we transitioned to using RPA reactions for the pre-amplification step. Additionally, the readout format was changed from flow cytometry to lateral flow strips to enhance the test’s ease of use in the field or on farms. Based on the results from both specificity and sensitivity assays, the dual crRNA approach was chosen for the lateral flow-based assay. The specificity of the RPA-Cas12 assay was first evaluated, showing consistent results with those obtained with the PCR-Cas12a assay, confirming the specificity of the A. marginale and B. bigemina tests following this change in protocol (Figure 6).

Figure 6.

Figure 6

Specificity of the RPA-Cas12a assay for Anaplasma marginale and Babesia bigemina using the lateral flow readout format. (a) Lateral flow assay specificity for A. marginale: 1. A. marginale positive sample, 2. B. bigemina, 3. T. parva, 4. T. mutans, 5. T. lestoquardi, and 6. no template control. (b) Lateral flow strip assay specificity for B. bigemina: 7. B. bigemina positive sample, 8. A. marginale, 9. T. parva, 10. T. mutans, 11. T. lestoquardi, and 12. no template control.

Finally, the sensitivity of the RPA-Cas12a assays for both A. marginale and B. bigemina was tested. Due to the previously acquired flow cytometry results and the availability of lateral flow strips, the sensitivity of the RPA-Cas12a assays was tested with DNA dilution ranging from 103 to 100 copies/µL. Results show that both A. marginale and B. bigemina-specific tests were able to detect again up to 102 DNA copies of the target gene per µL, although both tests seemed to cleave 102 copies/µL partially (Figure 7).

Figure 7.

Figure 7

Sensitivity of the RPA-Cas12a assay for Anaplasma marginale and Babesia bigemina. (a) Lateral flow assay limit of detection for Anaplasma marginale: 1. 103 DNA copies/µL, 2. 102 DNA copies/µL, 3. 101 DNA copies/µL, 4. 100 DNA copies/µL, and NTC: no template control. (b) Lateral flow strip sensitivity for B. bigemina: 1. 103 DNA copies/µL, 2. 102 DNA copies/µL, 3. 101 DNA copies/µL, 4. 100 DNA copies/µL, and NTC: no template control.

4. Discussion

New CRISPR-Cas12a-based assays coupled with RPA and lateral flow strip readouts for the detection of Anaplasma marginale and Babesia bigemina infections are described. The tests were first optimized with a PCR pre-amplification step and flow cytometry readouts. Subsequently, they were adapted for field compatibility by using RPA and lateral flow strips to create a more field-friendly diagnostic tool. The developed assays demonstrate high specificity and sensitivity that can be applied in the control and management of these infections.

The Anaplasma marginale-specific test is based on the major surface protein 5 (MSP5), due to its conserved nature [16], and has thus been used to develop other molecular assays such as a quantitative real-time PCR [17] and a semi-nested PCR for detecting anaplasmosis infections in carrier animals [5]. The CRISPR-Cas12a assay based on the msp5 gene exhibited high specificity, especially when tested against commonly occurring tick-borne parasites such as B. bigemina, T. parva, T. mutans, and T. lestoquardi. The results were consistent when using a single or dual crRNA approach and regardless of the readout method. The assays demonstrated higher sensitivity using dual crRNA reactions as compared to using a single crRNA targeting the same genes. The dual crRNA approach enhanced the limit of detection (LOD) by three logs to 102 DNA copies/µL. This limit of detection is within the range of other CRISPR-Cas-based tests achieving similar LODs as our assay [18,19,20].

When comparing the sensitivity and specificity of our CRISPR-Cas assays with already existing tests for both A. marginale and B. bigemina, our test falls below the sensitivity median of A. marginale and B. bigemina specific tests (Table 3, Figure 8a) and on the sensitivity median value compared to other developed CRISPR-Cas-based assays (Figure 8b).

Table 3.

Comparison of the sensitivity and specificity of existing diagnostic tests for A. marginale and B. bigemina.

Title Assay and Gene Target Sensitivity and Specificity Reference
Anaplasma marginale
RPA-CRISPR/Cas12a assay for the diagnosis of bovine Anaplasma marginale infection RPA-CRISPR-Cas12a assay,
major surface protein 4 (MSP4)
Sensitivity of 4 copies/µL of msp4 gene
No cross-reactivity observed when tested with DNA from Babesia bovis, T. orientalis, and T. evansi
[21]
Specific molecular detection and characterization of Anaplasma marginale in Mongolian Cattle Nested PCR based on the msp5 gene Sensitivity: limit of detection was 200 copies/µL of the msp5 gene
No cross-reactivity when tested against Ehrlichia canis, E. muris, Ehrlichia sp., Anaplasma bovis, A. centrale, A. platys, Anaplasma sp. closely related to A. phagocytophilum of Japan, A. phagocytophilum, Theileria orientalis, Babesia bovis, and B. ovata
[14]
Molecular detection of Anaplasma marginale infection in carrier cattle Semi-nested PCR, major surface protein 5 Sensitivity limit of detection of 30 infected erythrocytes per ml of blood
No cross-reactivity when tested against Theileria annulata, Babesia bigemina, and Trypanosoma evansi
[5]
Real-time PCR assay with an endogenous internal amplification control for detection and quantification of Anaplasma marginale in bovine blood TaqMan Quantitative PCR, based on major surface protein 1 (msp1α) gene Sensitivity: Able to detect up to 1 copy of the msp1 gene
No cross-reactivity observed when tested with closely related Anaplasma spp.: A. centrale, A. bovis, A. phagocytophilum, A. ovis-positive, and A. platys
[22]
Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR TaqMan-based real-time PCR assay based on the msp1b gene Sensitivity: 101 DNA copies of the msp1b gene and 30 Anaplasma-infected erythrocytes mL−1 of blood
No cross-reactivity with other pathogens, including A. centrale, A. bovis, A. ovis, A. phagocytophilum, B. bovis, B. bigemina, T. annulata, and T. buffeli
[23]
Comparison of three nucleic acid-based tests for detecting Anaplasma marginale and Anaplasma centrale in cattle Three nucleic acid tests for A. marginale based on the msp1b gene
RLB, nested PCR, and qPCR
Sensitivity: 2500 copies of the msp1β gene for RLB, 250 copies of the same gene by nPCR and qPCR
No cross-reactivity when tested against Anaplasma sp., A. phagocytophilum, B. bovis, and Theileria parva
[24]
CRISPR-Cas-based pen-side diagnostic tests for Anaplasma marginale and Babesia bigemina RPA-Ca12a assay based on msp5 gene Sensitivity: 100 copies/µL of msp5 gene
No cross-reactivity when tested against T. parva, T. mutans, Babesia bigemina, and T. lestoquardi DNA
Our test.
Babesia bigemina
Molecular detection and identification of Babesia bovis and Babesia bigemina in cattle in northern Thailand Nested PCR based on RAP1a gene for B. bigemina Sensitivity: The detection limit was equivalent to a parasitemia of 0.00000001%
No cross-reactivity when tested against DNA from B. bovis, T. orientalis, T. gondii, and N. caninum
[25]
A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigemina SYBR green qPCR based on the cytochrome B gene Sensitivity of 1000 copies, translating to 0.1 fg of DNA
No cross-reactivity observed when tested against T. annulata, T. buffeli, T. equi, and B. caballi
[26]
Development of TaqMan-based real-time PCR assays for diagnostic detection of Babesia bovis and Babesia bigemina TaqMan assay based on the 18S rRNA The sensitivity of the test is at 2.5 parasites/µL of infected blood
No cross-reaction observed when tested against DNA from Theileria parva, Trypanosoma evansi, and Neospora caninum
[27]
Rapid and sensitive detection of Babesia bovis and Babesia bigemina by loop-mediated isothermal amplification combined with a lateral flow dipstick A LAMP-LFP assay based on the cytochrome B gene Sensitivity of 0.8 g of Babesia bigemina DNA
No cross-reactivity with DNA from Babesia bovis, Theileria sergenti, Theileria ovis, Theileria equi, and Toxoplasma gondii
[28]
Development and standardization of a loop-mediated isothermal amplification (LAMP) test for the detection of Babesia bigemina LAMP technique based on the ama-1 gene Sensitivity of 0.00000001% of parasitemia
Highly specific with no cross-reactivity observed when tested with DNA from B. bovis, Anaplasma marginale, A. phagocytophilum, A. centrale, Trypanosoma theileri, Bos taurus, Homo sapiens, Rhipicephalus microplus, and Neospora caninum
[29]
CRISPR-Cas-based pen-side diagnostic tests for Anaplasma marginale and Babesia bigemina RPA-Ca12a assay based on RAP1a gene Sensitivity: 100 copies/µL of RAP1a gene
No cross-reactivity when tested against T. parva, T. mutans, Babesia bigemina, and T. lestoquardi DNA
Our test.

The use of two or more crRNAs has been employed in several CRISPR-Cas12a-based assays, leading to improved sensitivity. Similar studies have also observed enhanced sensitivity when using multiple crRNAs [21,30]. As we worked on developing and optimizing our A. marginale-specific CRISPR/Cas12a assay, we noted that Sutipatanasomboon et al. [21] had just recently described a similar assay but targeting another gene, the major surface protein 4, using a fluorescent or colorimetric lateral flow dipstick readout.

Figure 8.

Figure 8

Sensitivity comparison between our test and other tests. (a) Sensitivity of other diagnostic tests for Anaplasma marginale and Babesia bigemina in comparison to our tests (light blue dot) [references taken from Table 3 where data of copy numbers was available], and (b) other CRISPR-Cas diagnostic tests that use copy numbers as a measure of limit of detection: 42 copies/µL [20], 50 copies/µL [31], 50 copies/µL [32], 74 copies/µL [33], 94 copies/µL [34], 100 copies/µL [35], 100 copies/µL [36], 100 copies/µL [37], 100 copies/µL [38], 200 copies/µL [39], 200 copies/µL [40], and 250 copies/µL [41].

In regard to B. bigemina, the rhoptry-associated protein 1a (RAP1a) is a highly conserved gene that has been utilized in several molecular diagnostic test developments [3,15,23,24]. The RAP1a-based Cas12a assay we developed showed no cross-reactivity when tested against related tick-borne pathogens, including T. mutans, T. parva, T. lestoquardi, and A. marginale. The B. bigemina-specific test again demonstrated higher sensitivity when targeting a larger amplicon of 399 bp using two crRNAs.

The PCR/RPA primer sequences and CRISPR RNAs used in this study were analyzed for specificity using the BLAST platform. All sequences from Anaplasma marginale aligned precisely with its major surface protein 5. Similarly, Babesia bigemina sequences showed the same level of specificity. This specificity is critical, especially for CRISPR RNAs, as even slight mismatches can impair the trans-cleavage activity of Cas12a enzymes. We successfully avoided such mismatches. For both species, the top 100 BLAST hits corresponded exclusively to A. marginale and B. bigemina. Moreover, this was also confirmed experimentally for B. bigemina with closely related apicomplexan parasites.

When the pre-amplification step was modified from PCR to RPA, and the readout format was switched to lateral flow-based strips, the RPA-Cas12a assay remained highly specific and sensitive, with a sensitivity comparable to that of the assay using PCR and flow cytometry for data acquisition. The B. bigemina-specific RPA-Cas12a described in this study is the first of its kind, as there is currently no pen-side diagnostic for bovine babesiosis.

As these are innovative tests, further research is necessary to assess their performances using a larger set of samples from both infected ticks and infected animals in parallel to the already existing molecular diagnostic tests for these diseases. Additionally, clinical validation with blood samples will be of critical importance in establishing the clinical effectiveness of these diagnostic tests. Future work will focus on having a single multiplex test that can differentially diagnose anaplasmosis, babesiosis, and East Coast fever by combining these individual tests with a recently developed test by our team for the detection of T. parva in cattle [1].

In summary, this study demonstrates that the CRISPR-Cas12a tests that we developed are highly specific, with no cross-reactivity observed with other related pathogens, and sensitive tools that offer an alternative method for the detection of A. marginale and B. bigemina. These tests are easy to perform as well as rapid, delivering results in less than two hours. With their ability to facilitate on-site diagnosis or field-based point-of-care testing, these tests hold significant potential for the control and management of these two important tick-borne diseases.

Acknowledgments

This work was funded in whole or in part by the United States Agency for International Development (USAID) Bureau for Resilience and Food Security under Agreement #7200AA20CA00022 as part of the Feed the Future Innovation Lab for Animal Health (AHIL). We want to give our special thanks to the International Livestock Research Institute (ILRI) Tick Unit for providing DSGs that were used in the optimization of the assays. Special thanks also go to all team members of the AHIL for lively discussions, as well as to FlowJo for the free license to run the flow cytometry analysis software given to scientists in Africa.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12122595/s1, Figure S1. Heat map representation of the mean fluorescence intensities for Anaplasma marginale specificity using a single crRNA approach; Figure S2. Heat map representation of the mean fluorescence intensities for Anaplasma marginale specificity using a dual crRNA approach; Figure S3. Heat map representation of the mean fluorescence intensities for Anaplasma marginale sensitivity using a single crRNA approach; Figure S4. Heat map representation of the mean fluorescence intensities for Anaplasma marginale sensitivity using a dual crRNA approach; Figure S5. Heat map representation of the mean fluorescence intensities for Babesia bigemina specificity using a single crRNA approach; Figure S6. Heat map representation of the mean fluorescence intensities for Babesia bigemina specificity using a dual crRNA approach; Figure S7. Heat map representation of the mean fluorescence intensities for Babesia bigemina sensitivity using a single crRNA approach; Figure S8. Heat map representation of the mean fluorescence intensities for Babesia bigemina sensitivity using a dual crRNA approach.

Author Contributions

R.M.: conceptualization, data curation, formal analysis, methodology, validation, writing—original draft, writing—review and editing. M.N.: supervision, writing—review and editing. S.G.: supervision, writing—review and editing. N.S.: conceptualization, funding acquisition, methodology, project administration, supervision, validation, writing—original draft, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The raw flow cytometry data (mean fluorescence intensities) can be accessed through the Supplementary Materials file.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was funded in whole or in part by the United States Agency for International Development (USAID) Bureau for Resilience and Food Security under Agreement #7200AA20CA00022 as part of the Feed the Future Innovation Lab for Animal Health (AHIL). Any opinions, findings, conclusions, or recommendations expressed here are those of the authors alone.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Muriuki R., Ndichu M., Githigia S., Svitek N. Novel CRISPR-Cas-powered pen-side test for East Coast fever. Int. J. Parasitol. 2024;54:507–521. doi: 10.1016/j.ijpara.2024.04.009. [DOI] [PubMed] [Google Scholar]
  • 2.Wagner G.G., Holman P., Waghela S. Babesiosis and heartwater: Threats without boundaries. Vet. Clin. N. Am. Food Anim. Pract. 2002;18:417–430. doi: 10.1016/S0749-0720(02)00027-0. [DOI] [PubMed] [Google Scholar]
  • 3.Moumouni P.F.A., Aboge G.O., Terkawi M.A., Masatani T., Cao S., Kamyingkird K., Jirapattharasate C., Zhou M., Wang G., Liu M., et al. Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya. Parasit. Vectors. 2015;8:496. doi: 10.1186/s13071-015-1106-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.M’ghirbi Y., Bèji M., Oporto B., Khrouf F., Hurtado A., Bouattour A. Anaplasma marginale and A. phagocytophilum in cattle in Tunisia. Parasit. Vectors. 2016;9:556. doi: 10.1186/s13071-016-1840-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Singh H., Jyoti, Haque M., Singh N.K., Rath S.S. Molecular detection of Anaplasma marginale infection in carrier cattle. Ticks Tick. Borne. Dis. 2012;3:55–58. doi: 10.1016/j.ttbdis.2011.10.002. [DOI] [PubMed] [Google Scholar]
  • 6.Brown C.G. Dynamics and impact of tick-borne diseases of cattle. Trop. Anim. Health Prod. 1997;29:1S–3S. doi: 10.1007/BF02632905. [DOI] [PubMed] [Google Scholar]
  • 7.Kanyari P.W., Kagira J. The role of parasitic diseases as causes of mortality in cattle in a high potential area of central Kenya: A quantitative analysis. Onderstepoort J. Vet. Res. 2000;67:157–161. [PubMed] [Google Scholar]
  • 8.Nyabongo L., Kanduma E.G., Bishop R.P., Machuka E., Njeri A., Bimenyimana A.V., Nkundwanayo C., Odongo D.O., Pelle R. Prevalence of tick-transmitted pathogens in cattle reveals that Theileria parva, Babesia bigemina and Anaplasma marginale are endemic in Burundi. Parasit. Vectors. 2021;14:6. doi: 10.1186/s13071-020-04531-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gachohi J.M., Ngumi P.N., Kitala P.M., Skilton R.A. Estimating seroprevalence and variation to four tick-borne infections and determination of associated risk factors in cattle under traditional mixed farming system in Mbeere District. Kenya Prev. Vet. Med. 2010;95:208–223. doi: 10.1016/j.prevetmed.2010.03.015. [DOI] [PubMed] [Google Scholar]
  • 10.Knowles D., de Echaide S.T., Palmer G., McGuire T., Stiller D., McElwain T. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J. Clin. Microbiol. 1996;34:2225–2230. doi: 10.1128/jcm.34.9.2225-2230.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Goff W.L., Johnson W.C., Molloy J.B., Jorgensen W.K., Waldron S.J., Figueroa J.V., Matthee O., Adams D.S., McGuire T.C., Pino I., et al. Validation of a competitive enzyme-linked immunosorbent assay for detection of Babesia bigemina antibodies in cattle. Clin. Vaccine Immunol. 2008;15:1316–1321. doi: 10.1128/CVI.00150-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oura C.A.L., Bishop R.P., Wampande E.M., Lubega G.W., Tait A. Application of a reverse line blot assay to the study of haemoparasites in cattle in Uganda. Int. J. Parasitol. 2004;34:603–613. doi: 10.1016/j.ijpara.2003.12.012. [DOI] [PubMed] [Google Scholar]
  • 13.Terkawi M.A., Huyen N.X., Shinuo C., Inpankaew T., Maklon K., Aboulaila M., Ueno A., Goo Y.-K., Yokoyama N., Jittapalapong S., et al. Molecular and serological prevalence of Babesia bovis and Babesia bigemina in water buffaloes in the northeast region of Thailand. Vet. Parasitol. 2011;178:201–207. doi: 10.1016/j.vetpar.2011.01.041. [DOI] [PubMed] [Google Scholar]
  • 14.Ybañez A.P., Sivakumar T., Battsetseg B., Battur B., Altangerel K., Matsumoto K., Yokoyama N., Inokuma H. Specific molecular detection and characterization of Anaplasma marginale in Mongolian cattle. J. Vet. Med. Sci. 2013;75:399–406. doi: 10.1292/jvms.12-0361. [DOI] [PubMed] [Google Scholar]
  • 15.Ibrahim H.M., Moumouni P.F.A., Mohammed-Geba K., Sheir S.K., Hashem I.S., Cao S., Terkawi M.A., Kamyingkird K., Nishikawa Y., Suzuki H., et al. Molecular and serological prevalence of Babesia bigemina and Babesia bovis in cattle and water buffalos under small-scale dairy farming in Beheira and Faiyum Provinces. Egypt Vet. Parasitol. 2013;198:187–192. doi: 10.1016/j.vetpar.2013.08.028. [DOI] [PubMed] [Google Scholar]
  • 16.Watthanadirek A., Junsiri W., Minsakorn S., Poolsawat N., Srionrod N., Khumpim P., Chawengkirttikul R., Anuracpreeda P. Molecular and recombinant characterization of major surface protein 5 from Anaplasma marginale. Acta Trop. 2021;220:105933. doi: 10.1016/j.actatropica.2021.105933. [DOI] [PubMed] [Google Scholar]
  • 17.Bacanelli G.M., Ramos C.A.N., Araújo F.R. Molecular diagnosis of Anaplasma marginale in cattle: Quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene. Pesqui. Veterinária Bras. 2014;34:29–33. doi: 10.1590/S0100-736X2014000100005. [DOI] [Google Scholar]
  • 18.Chen J.S., Ma E., Harrington L.B., Da Costa M., Tian X., Palefsky J.M., Doudna J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360:436–439. doi: 10.1126/science.aar6245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liang Y., Lin H., Zou L., Zhao J., Li B., Wang H., Lu J., Sun J., Yang X., Deng X., et al. CRISPR-Cas12a-Based Detection for the Major SARS-CoV-2 Variants of Concern. Microbiol. Spectr. 2021;9:e0101721. doi: 10.1128/Spectrum.01017-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Patchsung M., Jantarug K., Pattama A., Aphicho K., Suraritdechachai S., Meesawat P., Sappakhaw K., Leelahakorn N., Ruenkam T., Wongsatit T., et al. Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA. Nat. Biomed. Eng. 2020;4:1140–1149. doi: 10.1038/s41551-020-00603-x. [DOI] [PubMed] [Google Scholar]
  • 21.Sutipatanasomboon A., Wongsantichon J., Sakdee S., Naksith P., Watthanadirek A., Anuracpreeda P., Blacksell S.D., Saisawang C. RPA-CRISPR/Cas12a assay for the diagnosis of bovine Anaplasma marginale infection. Sci. Rep. 2024;14:7820. doi: 10.1038/s41598-024-58169-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kovalchuk S.N., Babii A.V., Arkhipova A.L. Real-time PCR assay with an endogenous internal amplification control for detection and quantification of Anaplasma marginale in bovine blood, Ticks Tick. Borne. Dis. 2020;11:101334. doi: 10.1016/j.ttbdis.2019.101334. [DOI] [PubMed] [Google Scholar]
  • 23.Carelli G., Decaro N., Lorusso A., Elia G., Lorusso E., Mari V., Ceci L., Buonavoglia C. Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR. Vet. Microbiol. 2007;124:107–114. doi: 10.1016/j.vetmic.2007.03.022. [DOI] [PubMed] [Google Scholar]
  • 24.Chaisi M.E., Baxter J.R., Hove P., Choopa C.N., Oosthuizen M.C., Brayton K.A., Khumalo Z.T., Mutshembele A.M., Mtshali M.S., Collins N.E. Comparison of three nucleic acid-based tests for detecting Anaplasma marginale and Anaplasma centrale in cattle. Onderstepoort J. Vet. Res. 2017;84:e1–e9. doi: 10.4102/ojvr.v84i1.1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cao S., Aboge G.O., Terkawi M.A., Yu L., Kamyingkird K., Luo Y., Li Y., Goo Y.-K., Yamagishi J., Nishikawa Y., et al. Molecular detection and identification of Babesia bovis and Babesia bigemina in cattle in northern Thailand. Parasitol. Res. 2012;111:1259–1266. doi: 10.1007/s00436-012-2960-4. [DOI] [PubMed] [Google Scholar]
  • 26.Buling A., Criado-Fornelio A., Asenzo G., Benitez D., Barba-Carretero J.C., Florin-Christensen M. A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigemina. Vet. Parasitol. 2007;147:16–25. doi: 10.1016/j.vetpar.2007.03.031. [DOI] [PubMed] [Google Scholar]
  • 27.Kim C., Yokoyama N., Fujisaki K., Suzuki H., Xuan X., Igarashi I., Herbas M.S., Iseki H. Development of TaqMan-based real-time PCR assays for diagnostic detection of Babesia bovis and Babesia bigemina. Am. J. Trop. Med. Hyg. 2007;77:837–841. doi: 10.4269/ajtmh.2007.77.837. [DOI] [PubMed] [Google Scholar]
  • 28.Yang Y., Li Q., Wang S., Chen X., Du A. Rapid and sensitive detection of Babesia bovis and Babesia bigemina by loop-mediated isothermal amplification combined with a lateral flow dipstick. Vet. Parasitol. 2016;219:71–76. doi: 10.1016/j.vetpar.2016.02.004. [DOI] [PubMed] [Google Scholar]
  • 29.Lizarazo-Zuluaga A.P., Carvajal-Gamez B.I., Wilkowsky S., Cravero S., Trangoni M., Mosqueda J. Development and standardization of a Loop-mediated isothermal amplification (LAMP) test for the detection of Babesia bigemina. Front. Vet. Sci. 2022;9:1056355. doi: 10.3389/fvets.2022.1056355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zeng M., Ke Y., Zhuang Z., Qin C., Li L.Y., Sheng G., Li Z., Meng H., Ding X. Harnessing Multiplex crRNA in the CRISPR/Cas12a System Enables an Amplification-Free DNA Diagnostic Platform for ASFV Detection. Anal. Chem. 2022;94:10805–10812. doi: 10.1021/acs.analchem.2c01588. [DOI] [PubMed] [Google Scholar]
  • 31.Jain P., Rananaware S., Vesco E., Shoemaker G., Anekar S., Sandoval L.S., Meister K., Macaluso N., Nguyen L. Programmable RNA detection with CRISPR-Cas12a. Res. Sq. 2023:preprint. doi: 10.21203/rs.3.rs-2549171/v1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jiang Y., Hu M., Liu A.-A., Lin Y., Liu L., Yu B., Zhou X., Pang D.-W. Detection of SARS-CoV-2 by CRISPR/Cas12a-Enhanced Colorimetry. ACS Sens. 2021;6:1086–1093. doi: 10.1021/acssensors.0c02365. [DOI] [PubMed] [Google Scholar]
  • 33.Huyen D.T., Reboud J., Quyen D.T., Cooper J.M., Velavan T.P., Trung N.T., Song L.H. An isothermal CRISPR- based lateral flow assay for detection of Neisseria meningitidis. Ann. Clin. Microbiol. Antimicrob. 2024;23:28. doi: 10.1186/s12941-024-00688-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tang C., Wu J., Chen Q., Wang Y. CRISPR-Cas Detection Coupled with Isothermal Amplification of Bursaphelenchus xylophilus. Plant Dis. 2023;107:1703–1713. doi: 10.1094/PDIS-07-22-1648-SR. [DOI] [PubMed] [Google Scholar]
  • 35.Arizti-Sanz J., Freije C.A., Stanton A.C., Petros B.A., Boehm C.K., Siddiqui S., Shaw B.M., Adams G., Kosoko-Thoroddsen T.-S.F., Kemball M.E., et al. Streamlined inactivation, amplification, and Cas13-based detection of SARS-CoV-2. Nat. Commun. 2020;11:5921. doi: 10.1038/s41467-020-19097-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fozouni P., Son S., Derby M.D.d.L., Knott G.J., Gray C.N., D’ambrosio M.V., Zhao C., Switz N.A., Kumar G.R., Stephens S.I., et al. Amplification-free detection of SARS-CoV-2 with CRISPR-Cas13a and mobile phone microscopy. Cell. 2021;184:323–333.e9. doi: 10.1016/j.cell.2020.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Joung J., Ladha A., Saito M., Kim N.-G., Woolley A.E., Segel M., Barretto R.P., Ranu A., Macrae R.K., Faure G., et al. Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing. N. Engl. J. Med. 2020;383:1492–1494. doi: 10.1056/NEJMc2026172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Xiong E., Jiang L., Tian T., Hu M., Yue H., Huang M., Lin W., Jiang Y., Zhu D., Zhou X. Simultaneous Dual-Gene Diagnosis of SARS-CoV-2 Based on CRISPR/Cas9-Mediated Lateral Flow Assay. Angew. Chem. Int. Ed. 2021;60:5307–5315. doi: 10.1002/anie.202014506. [DOI] [PubMed] [Google Scholar]
  • 39.Li C., Lin N., Feng Z., Lin M., Guan B., Chen K., Liang W., Wang Q., Li M., You Y., et al. CRISPR/Cas12a Based Rapid Molecular Detection of Acute Hepatopancreatic Necrosis Disease in Shrimp. Front. Vet. Sci. 2022;8:819681. doi: 10.3389/fvets.2021.819681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yuan C., Tian T., Sun J., Hu M., Wang X., Xiong E., Cheng M., Bao Y., Lin W., Jiang J., et al. Universal and Naked-Eye Gene Detection Platform Based on the Clustered Regularly Interspaced Short Palindromic Repeats/Cas12a/13a System. Anal. Chem. 2020;92:4029–4037. doi: 10.1021/acs.analchem.9b05597. [DOI] [PubMed] [Google Scholar]
  • 41.Jiao J., Kong K., Han J., Song S., Bai T., Song C., Wang M., Yan Z., Zhang H., Zhang R., et al. Field detection of multiple RNA viruses/viroids in apple using a CRISPR/Cas12a-based visual assay. Plant Biotechnol. J. 2021;19:394–405. doi: 10.1111/pbi.13474. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The raw flow cytometry data (mean fluorescence intensities) can be accessed through the Supplementary Materials file.


Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES