Skip to main content
NCBI home page
Animal Models and Experimental Medicine logoLink to Animal Models and Experimental Medicine
. 2024 Dec 9;7(6):793–801. doi: 10.1002/ame2.12515

Chondrogenic commitment of human umbilical cord blood and umbilical cord‐derived mesenchymal stem cells induced by the supernatant of chondrocytes: A comparison study

Xingfu Li 1,2, Zhenhan Deng 3,✉, Wei Lu 1,✉
PMCID: PMC11680488  PMID: 39648793

Abstract

Background

Native cartilage has low capacity for regeneration because it has very few progenitor cells. Human umbilical cord blood‐derived mesenchymal stem cells (hUCB‐MSCs) and human umbilical cord‐derived MSCs (hUC‐MSCs) have been employed as promising sources of stem cells for cartilage injury repair. Reproduction of hyaline cartilage from MSCs remains a challenging endeavor. The paracrine factors secreted by chondrocytes possess the capability to induce chondrogenesis from MSCs.

Methods

The conditioned medium derived from chondrocytes was utilized to induce chondrogenic differentiation of hUCB‐MSCs and hUC‐MSCs. The expression levels of collagen type I alpha 1 chain (Col1a1), collagen type II alpha 1 chain (Col2a1), and SRY‐box transcription factor 9 (SOX9) were assessed through quantitative real‐time polymerase chain reaction (qRT‐PCR), Western blot (WB), and immunofluorescence (IF) assays. To elucidate the mechanism of differentiation, the concentration of transforming growth factor‐β1 (TGF‐β1) in the conditioned medium of chondrocytes was quantified using enzyme‐linked immunosorbent assay (ELISA). Meanwhile, the viability of cells was assessed using Cell Counting Kit‐8 (CCK‐8) assays.

Results

The expression levels of Col2a1 and SOX9 were found to be higher in induced hUC‐MSCs compared to those in induced hUCB‐MSCs. The conditioned medium of chondrocytes contained TGF‐β1. The CCK‐8 assays revealed that the proliferation rate of hUC‐MSCs was significantly higher compared to that of hUCB‐MSCs.

Conclusions

The chondrogenic potential and proliferation capacity of hUC‐MSCs surpass those of hUCB‐MSCs, thereby establishing hUC‐MSCs as a superior source of seed cells for cartilage tissue engineering.

Keywords: cartilage diseases, chondrogenic differentiation, mesenchymal stem cells

Native cartilage has low capacity for regeneration because it has very few progenitor cells. Mesenchymal stem cells (MSCs) derived from both human umbilical cord blood (hUCB) and human umbilical cord (hUC) have been used as stem cell sources for cartilage injury repair. However, production of hyaline cartilage from MSCs remains problematic. The paracrine factors released by chondrocytes could induce chondrogenic differentiation of MSCs. We induced chondrogenesis of hUCB‐derived MSCs (hUCB‐MSCs) and hUC‐derived MSCs (hUC‐MSCs) using culture medium from chondrocytes. We analyzed the expression of collagen type I alpha 1 (Col1a1), collagen type II alpha 1 (Col2a1), and SRY‐box 9 (SOX 9), by quantitative real‐time polymerase chain reaction (qRT‐PCR), Western blot, and immunofluorescence assays. To elucidate the differentiation mechanism, we further analyzed the transforming growth factor‐β1 (TGF‐β1) concentration in the culture medium of chondrocytes by enzyme‐linked immunosorbent assay (ELISA). Meanwhile, Cell Counting Kit‐8 (CCK‐8) assays were used to evaluate cell viability. The hUC‐MSCs had higher chondrogenic differentiation potential than hUCB‐MSCs. We found that the culture medium of chondrocytes contained TGF‐β1, which was the likely cause of chondrogenic differentiation. In addition, we found that hUC‐MSCs had higher proliferation ability than hUCB‐MSCs by testing the cell viability after differentiation. Overall, we compared the chondrogenic potential of hUCB‐MSCs and hUC‐MSCs after induction with chondrocyte culture medium and found that hUC‐MSCs showed higher differentiation potential and higher proliferation ability than hUCB‐MSCs. So, compared to hUCB‐MSCs, hUC‐MSCs are a better source of chondrocytes for cartilage repair under induction with chondrocyte culture medium.

graphic file with name AME2-7-793-g004.jpg

1. INTRODUCTION

Due to the limited regenerative capacity of chondrocytes, repairing cartilage defects is a major issue in orthopedic. 1 Since the development of autologous chondrocyte implantation (ACI) for joints, it has been used to treat cartilage defects. 2 However, the limited availability of cartilage sources and the dedifferentiation observed in monolayer culture of chondrocytes pose significant challenges to the widespread application of autologous chondrocyte‐based therapies. 3 It is remarkable that mesenchymal stem cells (MSCs) have shown promise as a cartilage repair option, leading recent studies to shift the focus from ACI to MSCs therapy. 4 , 5 , 6

Several protocols have been established for the induction of MSC chondrogenic differentiation. However, it is challenging to recapitulate all properties of native cartilage tissue, because a single chondrogenic media formula does not include all the elements needed for complete chondrogenic differentiation. The paracrine factors released by chondrocytes can induce chondrogenic differentiation of MSCs while also suppressing hypertrophy. 7 , 8 Therefore, a co‐culture system has been developed for the chondrogenic differentiation. We aim to explore the potential of chondrocyte conditioned medium, abundant in paracrine factors, for inducing chondrogenic differentiation of human umbilical cord blood‐derived MSCs (hUCB‐MSCs) and human umbilical cord‐derived MSCs (hUC‐MSCs).

The MSCs derived from various adult tissues, including bone marrow, adipose tissue, synovium, dermis, and others, exhibit characteristics of facile collection, remarkable proliferative capacity, and a stable stem cell phenotype. However, their collection process is invasive and subject to ethical and legal constraints. 9 , 10 , 11 , 12 Therefore, significant challenges persist in promoting the clinical application of adult MSCs for the construction of tissue‐engineered cartilage. However, the hUC represents a plentiful source of MSCs including hUCB‐MSCs and hUC‐MSCs. These two cell types are promising candidate sources for cartilage repair due to the outstanding wound healing activity, noninvasive resource acquisition, high proliferative potential, and low immunogenicity. 13 , 14 , 15 Both hUCB‐MSCs and hUC‐MSCs can differentiate into chondrocytes under the correct conditions, but it is unclear which cell type is better suited for cartilage repair. 16 , 17 Wharton's jelly (the gelatinous substance constituting the structure of the umbilical cord) has a higher yield of MSCs compared to hUCB, making the production of hUC‐MSCs more efficient than hUCB‐MSCs. In addition to higher yields, the culture process of hUC‐MSCs is less complicated than that of hUCB‐MSCs, as hUC‐MSCs can easily be obtained by isolating and culturing Wharton's jelly from the umbilical cord. However, hUCB‐MSCs require a density gradient concentration process, which is both time‐consuming and expensive. In addition, hemolysis in the process of umbilical cord blood collection impedes the isolation of hUCB‐MSCs. 18 , 19 , 20 Therefore, based on the cell production process, hUC‐MSCs are a better cell source for MSCs therapy than hUCB‐MSCs.

The product of subsequent chondrogenic differentiation is of greater significance than the ease of source cell production. In this study, we addressed this matter by comparing the levels of chondrocyte‐specific gene expression in both cell types following induction with conditioned medium derived from chondrocytes.

2. MATERIALS AND METHODS

2.1. Tissue collection

The collection of hUC and hUCB samples, as well as cartilage specimens, was ethically approved by the Ethics Committee of Shenzhen Second People's Hospital (IRB no: 2024‐101‐01YJ). Informed consents were obtained from all donors before the study. The hUC and hUCB samples were obtained from normal full‐term infants using a normal saline system supplemented with heparin as anticoagulants. All sample collection and subsequent separation processes were completed within 6 h. The hUC and hUCB were collected from donors without complication. 21 The cartilage tissues were collected from the donors' knee joint with traumatic osteoarthritis and were manipulated within 6 h.

2.2. Cell culture

The Wharton jelly derived from hUC was sectioned into tissue blocks measuring 2 mm3 and placed in a 10‐cm Petri dish containing culture medium for MSCs (MesenGro, StemRD, USA). The tissue blocks were incubated in a cell incubator with 5% CO2, and the culture medium was refreshed every 72 h. 22 The hUC‐MSCs were digested using 0.25% trypsin/EDTA (Hyclone, USA) upon reaching an 80% confluent monolayer and subsequently subcultured at a density of 2.0 × 104 cells/cm2. The passage 3 (P3) cells were employed for cellular induction.

hUCB was diluted 1:1 with saline containing 100 U/mL heparin. hUCB‐MSCs were extracted from diluted hUCB using Ficoll–Paque density gradient centrifugation. 23 hUCB‐MSCs were seeded into culture flasks at a density of 2.0 × 104 cells/cm2 and cultured in the cell incubator. The medium was replaced every 72 h during the following period. hUCB‐MSCs were amplified as previously described. The P3 cells were employed for cellular induction.

The cartilage samples were collected and minced into 1 mm3 tissue blocks, which were then digested in DMEM‐basic (Gibco, USA) supplemented with 1 mg/mL collagenase type II (WBC, UK) at 37°C on a shaker for 8 h. 24 Chondrocytes were harvested after filtration and seeded in chondrocytes culture medium (DMEM‐F12, 10% fetal bovine serum [FBS], 10 μg/L basic fibroblast growth factor [bFGF], and 0.1 mg/mL penicillin–streptomycin [P/S]) at a density of 2.0 × 104 cells/cm2. The chondrocytes were amplified as previously described.

2.3. Identification of hUC‐MSCs and hUCB‐MSCs

hUC‐MSCs were resuspended in saline at a concentration of 3 × 105 cells/50 μL and incubated with anti‐CD105, CD73, CD34, CD45 antibodies (BD, USA). 25 The hUC‐MSCs were incubated with IgG‐PE and IgG‐FITC as the control group. The samples were processed using a FACSCanto II flow cytometer (BD, USA). hUCB‐MSCs were treated in the same way.

2.4. Characterization of trilineage differentiation potential in hUC‐MSCs and hUCB‐MSCs

The hUC‐MSCs and hUCB‐MSCs were, respectively, cultured in specific differentiation medium to assess their potential for differentiation into various lineages, including chondrogenic, adipogenic, and osteogenic cells. After a 14‐day induction period, the cells were subsequently stained with toluidine blue (TB), alizarin red, and Oil Red O. 26 The acidic proteoglycan stained by TB indicated the chondrogenic cell formation. Alizarin red stain of calcium nodules demonstrated osteogenic cell formation. The detection of lipid‐rich vacuole accumulation in MSCs using Oil Red O revealed adipogenic induction. After a 2‐week induction period, the expression levels of aggrecan (ACN), type II collagen alpha 1 chain (Col2a1), SRY‐related HMG box‐9 (SOX9), osteocalcin, runt‐related transcription factors 2 (Runx2), and primary productivity algorithm round robin (PPARr) were quantified using quantitative real‐time polymerase chain reaction (qRT‐PCR). The forward and reverse primer pairs are listed in Table 1.

TABLE 1.

Primer sequences employed for quantitative real‐time polymerase chain reaction (qRT‐PCR).

Genes Forward primer (5′–3′) Reverse primer (5′–3′)
ACN CCACTGGAGAGGACTGCGTAG GGTCTGTGCAAGTGATTCGAG
SOX9 GACGTGCAAGCTGGGAAA CGGCAGGTATTGGTCAAACTC
Col2a1 CGCCACGGTCCTACAATGTC GTCACCTCTGGGTCCTTGTTCAC
Col1a1 GACATGTTCAGCTTTGTGGACCTC GGGACCCTTAGGCCATTGTGTA
Runx2 CCCGTGGCCTTCAAGGT CGTTACCCGCCATGACAGTA
Osteocalcin CACTCCTCGCCCTATTGGC CCCTCCTGCTTGGACACAAAG
PPARγ2 TCTGGGAGATTCTCCTATTGGC CTGGAAGACAACTACAAGAG
GAPDH GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA
Open in a new tab

2.5. Chondrogenic induction of hUC‐MSCs and hUCB‐MSCs

The two types of MSCs (P3) and the conditioned medium derived from chondrocytes (P1) were utilized. The two types of MSCs (48 000 cells/well) were, respectively, cultured with the chondrocyte conditioned medium for 21 days. 27 The two types of MSCs cultured alone were used as the blank control groups. The cells were divided randomly into four groups (n = 5/group): blank control group 1 (hUCB‐MSCs cultured alone); blank control group 2 (hUC‐MSCs cultured alone); induced group 1 (hUCB‐MSCs cultured with the conditioned medium of chondrocytes); induced group 2 (hUC‐MSCs cultured with the conditioned medium of chondrocytes).

2.6. Immunofluorescence analysis of the hyaline cartilage‐specific marker protein

Types II collagen (COL2) as a typical marker protein of hyaline cartilage was examined using immunofluorescence (IF). After chondrogenic induction, the cells were fixed using a 4% paraformaldehyde solution and subsequently rinsed with phosphate buffer saline (PBS). All samples were blocked using 5% bovine serum albumin (BSA) and subsequently incubated using mouse monoclonal antibodies against COL2 (R&D, USA) at a dilution of 1:100. After 12 h, all samples were washed thrice and Goat‐Anti‐Mouse IgG (MP, USA) was used to incubate the samples at 1:200 dilutions. After 1 h, the samples were washed and subsequently incubated with DAPI at a dilution of 1:1000 for 10 min. 28 After the removal of DAPI, the fluorescent staining results were analyzed using a laser confocal microscope.

2.7. qRT‐PCR analysis

According to the manufacturer's instructions, all samples were collected and subsequently subjected to total RNA extraction using Trizol reagent (Invitrogen, USA). The synthesis of complementary DNA (cDNA) was performed subsequent to the extraction of total RNA. The expression levels of SOX9, Col1a1, and Col2a1 were measured using qRT‐PCR, with GAPDH serving as an internal reference control. 29 The forward and reverse primer pairs are listed in Table 1.

2.8. Western blot assay

All samples were subjected to protein extraction by incubating them in RIPA lysis buffer on ice for 15 min. The proteins were transferred to PVDF membrane after gel electrophoresis. The PVDF membrane was incubated with 5% skim milk/TBS at room temperature (RT) for 1 h, followed by overnight incubation at 4°C with primary antibodies (Abcam, UK), including mouse anti‐COL1 at 1:500 dilutions, mouse anti‐SOX9 at 1:2000 dilutions, mouse anti‐COL2 at 1:1000 dilutions, and mouse anti‐GAPDH at 1 μg/mL. After the incubation, the PVDF membrane was washed using TBST (0.1% Tween 20) and subsequently incubated with an HRP‐conjugated secondary antibody (diluted at 1:1000) for 1 h. 30 The signal from Western blot (WB) images was measured and analyzed using Pierce TM ECL Western Blotting Substrate on an LAS‐300 Imager (Fujifilm).

2.9. Enzyme‐linked immunosorbent assay

The concentration of transforming growth factor‐β1 (TGF‐β1) in the conditioned medium of the induction system was quantified using an enzyme‐linked immunosorbent assay (ELISA) kit specific for TGF‐β1 (R&D, USA). After chondrogenic induction, all samples were subjected to centrifugation at 4°C for 5 min at 3000 g. The supernatants were harvested and frozen at −80°C until analysis. 31 The absorbance was measured at wavelengths of 450 and 550 nm using Multiskan FC (Thermo).

2.10. Assessment of cellular proliferation

The hUC‐MSCs and hUCB‐MSCs were individually cultured in 96‐well plates at a cellular density of 3000 cells/well, utilizing either MSC culture medium or conditioned medium of chondrocytes. The cell viability was assessed at days 0, 2, 4, 6, 8, and 10 using a Multiskan FC. The CCK‐8 solution (10 μL) was added to each well, and the cells were subsequently cultured for 4 h. 32 During this period, formazan pigment accumulated in viable cells. The viable count was measured using the Multiskan FC based on the optical density of formazan pigment at 450 nm.

2.11. Statistical analysis

The significance of the data was analyzed using SPSS statistical analytical software (version 18.0; IBM, USA). The data were collected from three independent experiments, and the differences between the groups were assessed using the Student's t‐test. The statistical significance was determined when the p‐value fell below 0.05.

3. RESULTS

3.1. Identification of hUC‐MSCs and hUCB‐MSCs

Primary hUCB‐MSCs and hUC‐MSCs exhibit a spindle‐shaped morphology, growing in organized parallel or spiral arrangements and forming cohesive cell clusters. The cell morphology of hUCB‐MSCs and hUC‐MSCs in the P3 generation remained essentially consistent with that of primary cells (Figure 1A). However, general observation of the cell culture process revealed that hUCB‐MSCs exhibited a more sparse growth pattern compared to hUC‐MSCs, with a significantly slower growth rate.

FIGURE 1.

FIGURE 1

Open in a new tab

Identification of human umbilical cord blood‐derived mesenchymal stem cells (hUCB‐MSCs) and human umbilical cord‐derived mesenchymal stem cells (hUC‐MSCs). (A) Morphological observation of hUCB‐MSCs and hUC‐MSCs, scale bar = 100 μm. (B) Flow cytometry (FC) analysis of surface markers on hUCB‐MSCs. (C) FC analysis of surface markers on hUC‐MSCs.

The flow cytometry (FC) analysis revealed that both populations of MSCs exhibited positive staining for markers associated with MSCs (CD105, CD73) and negative staining for markers associated with hematopoietic stem cells (CD34) and leukocytes (CD45) (Figure 1B,C).

3.2. Multi‐lineage differentiation capacity of hUCB‐MSCs and hUC‐MSCs

The TB staining demonstrated the synthesis of glycosaminoglycans in both types of MSCs following chondrogenic induction. Alizarin red staining revealed the formation of mineralized nodules in both types of MSCs following osteogenic induction. Oil red O staining indicated the presence of lipid‐rich vacuoles in both types of MSCs following adipogenic induction (Figure 2A).

FIGURE 2.

FIGURE 2

Open in a new tab

Multi‐lineage differentiation of human umbilical cord‐derived mesenchymal stem cells (hUC‐MSCs) and human umbilical cord blood–derived mesenchymal stem cells (hUCB‐MSCs) (n = 3/group). (A) Chemical staining results of hUC‐MSCs and hUCB‐MSCs following trilineage differentiation, scale bar = 100 μm. (B) Quantitative real‐time polymerase chain reaction (qRT‐PCR) analysis of hUC‐MSCs following trilineage differentiation. (C) qRT‐PCR analysis of hUCB‐MSCs following trilineage differentiation. AI, adipogenic induction; CI, chondrogenic induction; OI, osteogenic induction; *p < 0.05, **p < 0.01, ***p < 0.001.

The expression levels of chondrogenic‐specific genes (ACN, Col2a1, SOX9), osteogenic‐specific genes (osteocalcin, Runx2), and adipogenic‐specific gene (PPARr) were significantly higher in the induced groups compared to those in the control groups (p < 0.05; Figure 2B,C).

3.3. Chondrogenic differentiation of hUCB‐MSCs and hUC‐MSCs

The induced groups exhibited significantly elevated levels of SOX9 expression compared to the blank control groups (p < 0.05, Figure 3A). The expression level of SOX9 in hUC‐MSCs was higher compared to that in hUCB‐MSCs within induced groups (p < 0.05; Figure 3A). The expression levels of Col2a1 were observed to be upregulated in the induced groups, and hUC‐MSCs had a significantly higher expression level of Col2a1 than hUCB‐MSCs (p < 0.05; Figure 3A). The expression levels of Col1a1 were comparable between the two induced groups. However, the expression levels of Col1a1 in the induced groups were significantly lower compared to those observed in hUCB‐MSCs cultured alone, yet higher than those detected in hUC‐MSCs cultured alone (p < 0.05; Figure 3A).

FIGURE 3.

FIGURE 3

Open in a new tab

The detection outcomes of genes and proteins associated with chondrogenesis (n = 5/group). (A) Messenger RNA (mRNA) expression levels of the chondrocyte‐related genes (Sox9, Col2a1, and Col1a1). (B) Detection of the chondrocyte‐related proteins (SOX9, COL2, and COL1) using Western blot (WB). (C) Immunofluorescence (IF) staining of the chondrocyte‐related protein (COL2), scale bars = 100 μm. (D) Quantitative analysis of WB results. (E) Quantification of IF results. a, human umbilical cord blood‐derived mesenchymal stem cells (hUCB‐MSCs) cultured alone; b, human umbilical cord‐derived mesenchymal stem cells (hUC‐MSCs) cultured alone; c, hUCB‐MSCs cultured with the conditioned medium of chondrocytes; d, hUC‐MSCs cultured with the conditioned medium of chondrocytes; ns, no significance; *p < 0.05, **p < 0.01, ***p < 0.001.

The WB analysis results demonstrated a significant upregulation of SOX9 and COL2 protein expression levels in the induced groups compared to the blank control groups (p < 0.05; Figure 3B,D). In the induced groups, hUC‐MSCs exhibited elevated levels of COL2 and SOX9 proteins and a decreased level of COL1 protein compared to hUCB‐MSCs (p < 0.05; Figure 3B,D).

The IF staining results revealed a significant upregulation of the COL2 fluorescent signal in the induced groups compared to the control groups (p < 0.01; Figure 3C,E). In the induced groups, hUC‐MSCs exhibited an enhanced COL2 fluorescent signal compared to hUCB‐MSCs (p < 0.01; Figure 3C,E).

3.4. Cell viability analysis

The ELISA analysis revealed that the hUC‐MSCs induced groups exhibited significantly elevated levels of TGF‐β1 compared to the control groups (p < 0.001; Figure 4A) and the hUCB‐MSCs induced groups also exhibited increased levels of TGF‐β1 (p < 0.05, Figure 4A), explaining the chondrogenic induction property of the conditioned medium of chondrocytes.

FIGURE 4.

FIGURE 4

Open in a new tab

The detection results of cell secretion and proliferation (n = 5/group). (A) Enzyme‐linked immunosorbent assay (ELISA) quantification of transforming growth factor‐ β1 (TGF‐β1). (B) Cell Counting Kit‐8 (CCK‐8) analysis of cell proliferation. a, human umbilical cord blood–derived mesenchymal stem cells (hUCB‐MSCs) cultured alone; b, human umbilical cord‐derived mesenchymal stem cells (hUC‐MSCs) cultured alone; c, hUCB‐MSCs cultured with the conditioned medium of chondrocytes; d, hUC‐MSCs cultured with the conditioned medium of chondrocytes; *p < 0.05, **p < 0.01, ***p < 0.001.

The CCK‐8 analysis revealed that the proliferative capacity of hUC‐MSCs surpasses that of hUCB‐MSCs in all experimental groups (Figure 4B). The induced hUC‐MSCs exhibited significantly enhanced proliferative capacity compared to the other experimental groups, thereby further substantiating the superior potential of hUC‐MSCs as a promising cell source for cartilage regeneration.

4. DISCUSSION

The differentiation potential of both hUCB‐MSCs and hUC‐MSCs into chondrocytes has been fully demonstrated in this study. The chondrogenic potential and proliferative capacity of hUC‐MSCs were found to surpass those of hUCB‐MSCs, indicating that hUC‐MSCs exhibit superior suitability as seed cells for cartilage tissue engineering. In addition, the presence of TGF‐β1, a pivotal growth factor known to induce differentiation of MSCs into chondrocytes, was confirmed in the conditioned medium of chondrocytes, thereby reaffirming previous research findings.

Recently, there has been great progress in the cartilage repair using ACI. 33 However, in a monolayer culture setting, the population of dedifferentiated chondrocytes undergoes proliferation, necessitating alternative cell sources for cartilage tissue engineering. Clinical trials have been conducted to investigate the potential of mesenchymal stem cells derived from bone marrow (BMSCs) as a cell source for articular cartilage repair. 34 The acquisition of BMSCs necessitates invasive and distressing procedures, whereas these concerns are not applicable to hUCB‐MSCs and hUC‐MSCs. In this study, the FC analysis revealed the expression of stem cell–specific surface antigens in both hUCB‐MSCs and hUC‐MSCs, whereas chemical staining demonstrated their ability to differentiate into chondrocytes, osteocytes, and adipocytes. The findings of our investigation suggest that both hUCB‐MSCs and hUC‐MSCs exhibit promising potential as candidate cells for cartilage tissue engineering.

Recombinant growth factors have the potential to induce MSCs toward chondrogenic differentiation. 25 , 35 However, a singular formulation of chondrogenic differentiation medium incorporating recombinant growth factors fails to encompass all the essential components necessary for achieving optimal chondrogenic differentiation. Moreover, the production of recombinant growth factors for clinical applications incurs substantial costs. 36 Paracrine factors released by chondrocytes can induce chondrogenic differentiation of MSCs. 37 The presence of the key growth factor, TGF‐β1, necessary for chondrogenic differentiation, was also confirmed in the conditioned medium of chondrocytes. 38 Therefore, we cultured hUCB‐MSCs and hUC‐MSCs in chondrocyte conditioned medium to investigate the efficacy and cost‐effectiveness of these paracrine factors in inducing chondrogenic differentiation. According to the results of IF and WB analysis, both induced hUCB‐MSCs and hUC‐MSCs exhibited significantly elevated expression levels of COL2, a marker protein indicative of hyaline cartilage, in comparison to the blank control groups. The findings of our study have demonstrated the potential of both hUCB‐MSCs and hUC‐MSCs to undergo chondrogenic differentiation upon induction with the conditioned medium of chondrocytes. Therefore, our cost‐effective approach may offer a promising strategy for utilizing hUCB‐MSCs and hUC‐MSCs in the context of cartilage repair.

hUCB‐MSCs and hUC‐MSCs have serval advantages such as convenient collection, low immunogenicity, and absence of tumor cell contamination. 39 , 40 Moreover, previous studies on stem cells have demonstrated that hUC‐MSCs exhibit a higher ease of extraction compared to hUCB‐MSCs, along with superior primary culture success rate, proliferation ability, and cell stability. 41 , 42 However, reaching a definitive conclusion regarding the optimal choice between the two aforementioned types of MSCs as seed cells for cartilage tissue engineering remains an unresolved matter. Therefore, we conducted a comparative analysis of the chondrogenic differentiation potential between hUCB‐MSCs and hUC‐MSCs induced with the conditioned medium of chondrocytes, while also developing a cost‐effective induction system. In this study, the expression trends of chondrocyte‐specific genes exhibited discrepancies between qRT‐PCR and WB analyses. The messenger RNA (mRNA) levels detected using qRT‐PCR cannot accurately reflect the final expression levels of chondrocyte‐specific genes due to post‐transcriptional processes, including translation and protein folding allosteric events, which ultimately contribute to the formation of intact protein molecules. Therefore, the WB analysis serves as the ultimate benchmark for assessing the expression levels of chondrocyte‐specific genes. The results of this study revealed that the induced hUC‐MSCs exhibited significantly higher expression levels of COL2 and SOX9 compared to the induced hUCB‐MSCs, while demonstrating a lower level of COL1. Furthermore, our investigation unveiled that the hUC‐MSCs exhibited a superior proliferative capacity in comparison to the hUCB‐MSCs. Considering the relative ease and efficiency of hUC‐MSC production compared to hUCB‐MSCs, it can be inferred that utilizing hUC‐MSCs as seed cells for engineered cartilage generation represents a more advantageous choice.

The mechanism underlying chondrogenesis induction by the conditioned medium of chondrocytes remains elusive. The protocols for promoting stem cells to chondrocyte differentiation include a variety of inducing factors, such as TGF‐β, insulin‐like growth factor (IGF), bone morphogenetic protein (BMP), fibroblast growth factor (FGF), Wingless‐INT (WNT), Indian hedgehog (IHH), all‐trans retinoic acid (RA), ascorbic acid phosphate (AAPC), proline, pyruvate, dexamethasone, insulin‐transferrin selenium premix, etc. 43 However, there is a consensus among researchers in the field of stem cells and cartilage tissue engineering that TGF‐β1 plays a crucial role in facilitating the expression of chondrocyte‐specific genes. Moreover, it has been demonstrated that TGF‐β1 alone is sufficient to enhance cartilage‐matrix formation and promote stem cell differentiation into chondrocytes. 44 , 45 Given the pivotal role of TGF‐β1 in chondrogenesis, we conducted an analysis to ascertain the concentration of TGF‐β1 in the conditioned medium across all experimental groups. The ELISA results demonstrated a significant elevation in the concentration of TGF‐β1 within the induced groups compared to that observed in the blank control groups, indicating that the influence of chondrocyte conditioned medium on stem cell differentiation into chondrocytes may rely on the presence of TGF‐β1. However, the ELISA results demonstrated a comparatively diminished concentration of TGF‐β1 in the chondrocyte conditioned medium compared to that observed in the conventional induction scheme for chondrogenesis differentiation. One plausible explanation is that the conditioned medium of chondrocytes contains multiple additional paracrine factors, which potentially contribute to the intricate process of chondrogenesis and thus warrants further in‐depth investigation. Our findings underscore the superiority of employing chondrocyte conditioned medium for chondrogenic induction, as opposed to conventional induction medium that is limited in its constituents and imposes significant economic burdens for utilization.

5. CONCLUSION

The chondrocyte conditioned medium demonstrates the capacity to induce chondrogenic differentiation in both hUCB‐MSCs and hUC‐MSCs. The chondrogenic potential and proliferation capacity of hUC‐MSCs surpass those of hUCB‐MSCs. The chondrogenic differentiation induced by the conditioned medium of chondrocytes may rely on the presence of TGF‐β1. In conclusion, the combination of hUC‐MSCs and chondrocyte conditioned medium demonstrates significant potential as a promising strategy for advancing cartilage tissue engineering.

AUTHOR CONTRIBUTIONS

Xingfu Li: Conceptualization; data curation; formal analysis; investigation; methodology; resources; software; writing – original draft. Zhenhan Deng: Conceptualization; funding acquisition; project administration; resources; software; supervision; validation; visualization; writing – review and editing. Wei Lu: Funding acquisition; supervision; validation; visualization.

FUNDING INFORMATION

This work was supported by the National Natural Science Foundation of China (82072515), Basic Public Welfare Research projects of Wenzhou Science and Technology Bureau (Y20240087), Start‐up Funding for Talented Scientific Research of the First Affiliated Hospital of Wenzhou Medical University (2023QD026), and Shenzhen Science and Technology Projects (JCYJ2022053 0150615035).

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no competing interests.

ETHICAL STATEMENT

The cell experiment conducted in this study was approved by the Ethics Committee of Shenzhen Second People's Hospital (number: 2024‐101‐01YJ).

ACKNOWLEDGMENTS

The authors would like to express their gratitude to all the investigators from the Graduate School of Peking University who participated in this project.

Li X, Deng Z, Lu W. Chondrogenic commitment of human umbilical cord blood and umbilical cord‐derived mesenchymal stem cells induced by the supernatant of chondrocytes: A comparison study. Anim Models Exp Med. 2024;7:793‐801. doi: 10.1002/ame2.12515

Contributor Information

Zhenhan Deng, Email: dengzhenhan@wmu.edu.cn.

Wei Lu, Email: weilu9309@gmail.com.

REFERENCES

  • 1. Liu Y, Dzidotor G, Le TT, et al. Exercise‐induced piezoelectric stimulation for cartilage regeneration in rabbits. Sci Transl Med. 2022;14(627):eabi7282. [DOI] [PubMed] [Google Scholar]
  • 2. Rua LA, Mumme M, Manferdini C, et al. Engineered nasal cartilage for the repair of osteoarthritic knee cartilage defects. Sci Transl Med. 2021;13(609):eaaz4499. [DOI] [PubMed] [Google Scholar]
  • 3. Ding S‐L, Zhao X‐Y, Xiong W, et al. Cartilage lacuna‐inspired microcarriers drive hyaline neocartilage regeneration. Adv Mater. 2023;35(30):e2212114. [DOI] [PubMed] [Google Scholar]
  • 4. Yan X, Yang B, Chen Y, et al. Anti‐friction MSCs delivery system improves the therapy for severe osteoarthritis. Adv Mater. 2021;33(52):e2104758. [DOI] [PubMed] [Google Scholar]
  • 5. Li M, Yin H, Yan Z, et al. The immune microenvironment in cartilage injury and repair. Acta Biomater. 2021;140:23‐42. [DOI] [PubMed] [Google Scholar]
  • 6. Kim YG, Choi J, Kim K. Mesenchymal stem cell‐derived exosomes for effective cartilage tissue repair and treatment of osteoarthritis. Biotechnol J. 2020;15(12):e2000082. [DOI] [PubMed] [Google Scholar]
  • 7. Iaquinta MR, Lanzillotti C, Mazziotta C, et al. The role of microRNAs in the osteogenic and chondrogenic differentiation of mesenchymal stem cells and bone pathologies. Theranostics. 2021;11(13):6573‐6591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Brose TZ, Kubosch EJ, Schmal H, Stoddart MJ, Armiento AR. Crosstalk between mesenchymal stromal cells and chondrocytes: the hidden therapeutic potential for cartilage regeneration. Stem Cell Rev Rep. 2021;17(5):1647‐1665. [DOI] [PubMed] [Google Scholar]
  • 9. Chu D‐T, Phuong TNT, Le Bao Tien N, et al. An update on the Progress of isolation, culture, storage, and clinical application of human bone marrow mesenchymal stem/stromal cells. Int J Mol Sci. 2020;21(3):708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Krawczenko A, Klimczak A. Adipose tissue‐derived mesenchymal stem/stromal cells and their contribution to angiogenic processes in tissue regeneration. Int J Mol Sci. 2022;23(5):2425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Furuoka H, Endo K, Sekiya I. Mesenchymal stem cells in synovial fluid increase in number in response to synovitis and display more tissue‐reparative phenotypes in osteoarthritis. Stem Cell Res Ther. 2023;14(1):244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Han YH, Mao YY, Lee KH, et al. Peroxiredoxin II regulates exosome secretion from dermal mesenchymal stem cells through the ISGylation signaling pathway. Cell Commun Signal. 2023;21(1):296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Huang J, Huang Z, Liang Y, et al. 3D printed gelatin/hydroxyapatite scaffolds for stem cell chondrogenic differentiation and articular cartilage repair. Biomater Sci. 2021;9(7):2620‐2630. [DOI] [PubMed] [Google Scholar]
  • 14. Yong‐Beom P, Chul‐Won H, Jin‐A K, et al. Comparison of undifferentiated versus chondrogenic Predifferentiated mesenchymal stem cells derived from human umbilical cord blood for cartilage repair in a rat model. Am J Sports Med. 2019;47(2):451‐461. [DOI] [PubMed] [Google Scholar]
  • 15. Tang S, Chen P, Zhang H, et al. Comparison of curative effect of human umbilical cord‐derived mesenchymal stem cells and their small extracellular vesicles in treating osteoarthritis. Int J Nanomed. 2021;16:8185‐8202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Nguyen LT, Tran NT, Than UTT, et al. Optimization of culture conditions for the expansion of umbilical cord‐derived mesenchymal stem or stromal cell‐like cells using Xeno‐free culture conditions. Tissue Eng Part C Methods. 2011;17(4):485‐493. [DOI] [PubMed] [Google Scholar]
  • 17. Jung S‐H, You J‐E, Choi S‐W, et al. Polycystin‐1 enhances Stemmness potential of umbilical cord blood‐derived mesenchymal stem cells. Int J Mol Sci. 2021;22(9):4868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Chen P, Tang S, Li M, et al. Single‐cell and spatial transcriptomics decodes Wharton's jelly‐derived mesenchymal stem cells heterogeneity and a subpopulation with wound repair signatures. Adv Sci. 2023;10(4):e2204786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Yang HY, Song EK, Kang SJ, Kwak WK, Kang JK, Seon JK. Allogenic umbilical cord blood‐derived mesenchymal stromal cell implantation was superior to bone marrow aspirate concentrate augmentation for cartilage regeneration despite similar clinical outcomes. Knee Surg Sports Traumatol Arthrosc. 2022;30(1):208‐218. [DOI] [PubMed] [Google Scholar]
  • 20. Bertoni L, Jacquet‐Guibon S, Branly T, et al. Evaluation of allogeneic bone‐marrow‐derived and umbilical cord blood‐derived mesenchymal stem cells to prevent the development of osteoarthritis in an equine model. Int J Mol Sci. 2021;22(5):2499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Xi Y, Yue G, Gao S, Ju R, Wang Y. Human umbilical cord blood mononuclear cells transplantation for perinatal brain injury. Stem Cell Res Ther. 2022;13(1):458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hernandez JJ, Beaty DE, Fruhwirth LL, Lopes Chaves AP, Riordan NH. Dodging COVID‐19 infection: low expression and localization of ACE2 and TMPRSS2 in multiple donor‐derived lines of human umbilical cord‐derived mesenchymal stem cells. J Transl Med. 2021;19(1):149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Kim HJ, Cho KR, Jang H, et al. Intracerebroventricular injection of human umbilical cord blood mesenchymal stem cells in patients with Alzheimer's disease dementia: a phase I clinical trial. Alzheimers Res Ther. 2021;13(1):154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Stegen S, Rinaldi G, Loopmans S, et al. Glutamine metabolism controls chondrocyte identity and function. Dev Cell. 2020;53(5):530‐544.e8. [DOI] [PubMed] [Google Scholar]
  • 25. Kangari P, Talaei‐Khozani T, Razeghian‐Jahromi I, Razmkhah M. Mesenchymal stem cells: amazing remedies for bone and cartilage defects. Stem Cell Res Ther. 2020;11(1):492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Kulsirirat T, Honsawek S, Takeda‐Morishita M, et al. The effects of andrographolide on the enhancement of chondrogenesis and osteogenesis in human suprapatellar fat pad derived mesenchymal stem cells. Molecules. 2021;26(7):1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Jafri MA, Jafri MA, Kalamegam G, et al. Deciphering the Association of Cytokines, chemokines, and growth factors in chondrogenic differentiation of human bone marrow mesenchymal stem cells using an ex vivo osteochondral culture system. Front cell. Dev Biol. 2020;7:380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Mazor M, Lespessailles E, Best TM, Ali M, Toumi H. Gene expression and chondrogenic potential of cartilage cells: osteoarthritis grade differences. Int J Mol Sci. 2022;23(18):10610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhou X, Wangyang X, Wang Y, et al. LncRNA DNM3OS regulates GREM2 via miR‐127‐5p to suppress early chondrogenic differentiation of rat mesenchymal stem cells under hypoxic conditions. Cell Mol Biol Lett. 2021;26(1):22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Peng J, Mao Z, Liu Y, et al. 12‐epi‐napelline regulated TGF‐β/BMP signaling pathway mediated by BMSCs paracrine acceleration against osteoarthritis. Int Immunopharmacol. 2022;113(Part A):109307. [DOI] [PubMed] [Google Scholar]
  • 31. Wang L, Li S, Xiao H, et al. TGF‐β1 derived from macrophages contributes to load‐induced tendon‐bone healing in the murine rotator cuff repair model by promoting chondrogenesis. Bone Joint Res. 2023;12(3):219‐230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Yang Z, Cai Z, Yang C, Luo Z, Bao X. ALKBH5 regulates STAT3 activity to affect the proliferation and tumorigenicity of osteosarcoma via an m6A‐YTHDF2‐dependent manner. EBioMedicine. 2022;80:104019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Burger D, Feucht M, Muench LN, Forkel P, Imhoff AB, Mehl J. Good clinical outcomes after patellar cartilage repair with no evidence for inferior results in complex cases with the need for additional patellofemoral realignment procedures: a systematic review. Knee Surg Sports Traumatol Arthrosc. 2022;30(5):1752‐1768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Doyle EC, Wragg NM, Wilson SL. Intraarticular injection of bone marrow‐derived mesenchymal stem cells enhances regeneration in knee osteoarthritis. Knee Surg Sports Traumatol Arthrosc. 2020;28(12):3827‐3842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Bunnell BA. Adipose tissue‐derived mesenchymal stem cells. World J Stem Cells. 2021;10(12):3433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Xie M, Zhang Y, Xiong Z, et al. Generation of hyaline‐like cartilage tissue from human mesenchymal stromal cells within the self‐generated extracellular matrix. Acta Biomater. 2022;149:150‐166. [DOI] [PubMed] [Google Scholar]
  • 37. Zhang D, Ying S, Sun P, et al. A TGF‐loading hydrogel scaffold capable of promoting chondrogenic differentiation for repairing rabbit nasal septum cartilage defect. Front Bioeng Biotechnol. 2022;10:1057904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Liu X, Sun HY, Yan D, et al. In vivo ectopic chondrogenesis of BMSCs directed by mature chondrocytes. Biomaterials. 2010;31(36):9406‐9414. [DOI] [PubMed] [Google Scholar]
  • 39. Hua Q, Zhang Y, Li H, et al. Human umbilical cord blood‐derived MSCs trans‐differentiate into endometrial cells and regulate Th17/Treg balance through NF‐κB signaling in rabbit intrauterine adhesions endometrium. Stem Cell Res Ther. 2022;13(1):301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Wang X, Ouyang L, Chen W, Cao Y, Zhang L. Efficient expansion and delayed senescence of hUC‐MSCs by microcarrier‐bioreactor system. Stem Cell Res Ther. 2023;14(1):284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Li X, Duan L, Liang Y, Zhu W, Xiong J, Wang D. Human umbilical cord blood‐derived mesenchymal stem cells contribute to chondrogenesis in coculture with chondrocytes. Biomed Res Int. 2016;2016:1‐9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Li X, Liang Y, Xiao X, et al. Cell‐to‐cell culture inhibits dedifferentiation of chondrocytes and induces differentiation of human umbilical cord‐derived mesenchymal stem cells. Biomed Res Int. 2019;2019:5871698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. De Kinderen P, Meester J, Loeys B, et al. Differentiation of induced pluripotent stem cells into chondrocytes: Methods and applications for disease modeling and drug discovery. J Bone Miner Res. 2022;37(3):397‐410. [DOI] [PubMed] [Google Scholar]
  • 44. Evans CH, Ghivizzani SC, Robbins PD. Osteoarthritis gene therapy in 2022. Cur Opin. Rheumatol. 2023;35(1):37‐43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Kim P, Park J, Lee D‐J, et al. Mast4 determines the cell fate of MSCs for bone and cartilage development. Nat Commun. 2022;13(1):3960. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Animal Models and Experimental Medicine are provided here courtesy of Wiley

RESOURCES