Abstract
The present experimental study aimed to assess the in vitro wound healing and anti-inflammatory effects of green synthesized copper nanoparticles (CuNPs) by the methanol extract of Ferula macrecolea (Boiss), as a plant with various pharmacological effects, such as anti-inflammatory and antimicrobial effects, in traditional and modern medicine. The precipitation approach was used for the green synthesis of CuNPs by mixing the methanol and copper sulfate solution. Cell viability and fibroblast proliferation assay were performed by MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) assay. The migration abilities of fibroblast cells were evaluated using the in vitro scratch assay for wound healing. The effects of CuNPs on gene expression of inducible nitric oxide synthesis (iNOS) were also examined by real-time polymerase chain reaction (PCR). In vitro antibacterial susceptibility test of CuNPs was carried out according to the standards protocol of the National Committee for Clinical Laboratory Standards. The scanning electron microscope analysis revealed that the green synthesized CNP exhibited a globular shape with a size ranging from 15 to 90 nm, while the majority were at 40-60 nm. The results of the MTT assay demonstrated that the calculated 50% cytotoxic concentration (CC50) value of green synthesized CuNPs was 236.3 μg/mL. The optimum concentrations of the CuNPs were selected based on the CC50, which dose-dependently increased the proliferation of fibroblast cells. The CuNPs dose-dependently increased the rate of wound closure after 16 and 24 h. The results of the real-time PCR illustrated that CuNPs caused upregulation in the expression level of the iNOS gene in RAW 264.7 cells. CuNPs showed promising antimicrobial effects against Staphylococcus aureus, Staphylococcus epidermidis, and Pseudomonas aeruginosa. The present study highlighted the high potency of green CuNPs synthesized by F. macrecolea for wound healing through their antimicrobial properties, proliferation of fibroblast cells, and provoking iNOS.
Keywords: Antibacterial, In vitro, Nanotechnology, Treatment, Wound
1. Introduction
Currently, it has been proven that wounds associated with some conditions, such as diabetes, gastric disorders, and duodenal ulcers, exert severe effects on the quality of life of people ( 1 ). Wounds commonly occur due to a cut on the skin after physical injury, burns, infections, or chronic disorders that interrupt the normal anatomy and function of the skin. During wound conditions, the connective tissue under the skin and epithelial tissue integrity are degraded and reduced ( 1 ). Wound healing is a complex process, encompassing the inflammation stage, cellular proliferation, and renovation, where cell-to-cell and cell-matrix communications happen ( 2 ). For healing development, some enzymes, such as collagenase and elastase, play crucial roles in reducing extracellular matrix factors (e.g., elastin, fibrin, and collagen) ( 3 ). Nevertheless, their action must be moderated by inhibiting and increasing the level of these enzymes, which can result in decreased wound healing ( 3 ). The search for new or alternative therapy obtained by nanotechnology, such as green synthesized nanoparticles, for healing acute and chronic wounds has received more attention ( 4 ). Research has demonstrated that nanoparticles (NPs) have been extensively used in wound healing due to their better adsorption capacity, antimicrobial properties, and drug loading ( 5 ). Although wound healing properties of some metal NPs, such as silver (AgNPs), Iron (FenNPs), gold (AuNPs), Zinc (ZnNPs), and copper (CuNPs), have been proven in several studies, there are discrepancies in the results due to some factors, such as the type of metal used, the synthesis method of nanoparticles, and the method of research ( 6 ). Among metal NPs, CuNPs are a suitable option in dressings for wound healing since they provoke angiogenesis and skin regeneration, facilitating the healing procedure ( 7 ). In light of the aforementioned issues, the present experimental study aimed to evaluate the in vitro wound healing effects of CuNPs green synthesized by the methanol extract of Ferula macrecolea (Boiss), which is a plant with various pharmacological effects, such as anti-inflammatory and antimicrobial effects, in traditional and modern medicine ( 8 - 10 ).
2. Materials and Methods
2.1. Green synthesis of CuNPs
Aerial parts of F. macrecolea were purchased from a plant shop in Tehran, Iran, in April 2022. To extract, 300 g of air-dried and powdered materials were subjected to 70% methanol for three days using a percolation procedure ( 11 ). Thereafter, the precipitation approach was used for the green synthesis of CuNPs by mixing the methanol and copper sulfate solution (1 mM) and incubation at 24°C for 12 h ( 11 )
2.2. Determining the physical and chemical characteristics
Physical characterizations of CuNPs, including size and shape, were evaluated by scanning electron microscope (SEM) (Mira3, Made in Czech). The surface plasmon resonance of CuNPs was measured employing a UV-vis spectrophotometer (Shimadzu UV2550, Japan). The green synthesis of nanoparticles by F. macrecolea extract was also confirmed by an X-ray diffraction (XRD, 2000 APD, Italy) analysis.
2.3. Cell culture
The normal human skin fibroblast (Hs27) and macrophage (RAW 264.7) cell lines were obtained from the American Type Culture Collection (ATCC). They were cultivated in Dulbecco's Modified Eagle Medium (Merk, Germany) enhanced with 10% fetal bovine serum (Sigma-Aldrich, Germany) and 1% pen-strep (Sigma-Aldrich, Germany) at 37°C in an incubator with 5% CO2. The cells were then adjusted to 1×105/mL using a hemocytometer.
2.4. Cell viability assay
The assay was performed by exposing the 0.1 mL of fibroblast cells (1×105/mL) with CuNPs at 10-300 µg/mL concentrations in a 96-well plate and kept at 24°C for 48 h. Following that, 20 μL of MTT solution (Sigma-Aldrich, Germany) was added to wells and kept again in 5% CO2 at 37°C for 240 min. After adding sulfuric acid as the stop solution, the absorbance of wells was recorded at 570 nm utilizing an enzyme-linked immunosorbent assay (ELISA) plate reader ( 12 , 13 ). The 50% cytotoxic concentrations (CC50) were calculated using the Probit test in SPSS software (version 26.0).
2.5. Fibroblast proliferation assay
Firstly, 0.1 mL of fibroblast cells (1×105/mL) was seeded into each 96-well plate and incubated for 24 h. After removing the supernatant, CuNPs and asiaticoside (positive control) were added to the wells and further incubated for 24 h. Subsequently, MTT solution (5 mg/mL) was added to wells and kept again in 5% CO2 at 37°C for 4 h. After adding sulfuric acid as the stop solution, the absorbance of wells was recorded at 570 nm utilizing an ELISA plate reader (BIOTEK ELX-800TS, USA) ( 19 ). The viability was calculated as the percentage of proliferation ( 12 , 13 ).
2.6. Cell scratch wound healing assay
According to the previous study, the migration abilities of fibroblast cells were evaluated using a cell scratch in vitro wound healing assay ( 14 ). At first, the cells (2×104 cells/mL) were cultured into a 48-well plate pending the formation of confluent cell monolayers. After producing a linear wound on the cell monolayer using a sterile pipette tip, the artifact cellular debris was discarded by washing the wells with phosphate-buffered saline. Thereafter, CuNPs at ½ CC50 and CC50 concentrations were added and incubated for 24 h. The cells were then visualized using an inverted microscope at 0 and 24 h. The ratio increases in wound closure were measured compared to the value achieved before treatment and reported as cell migration.
2.7. Effects of CuNPs on iNOS expression gene
RAW 264.7 cells (4×105/mL) were kept in a 24-well plate and incubated for 48°C. Following that, the CuNPs at ⅓ CC50, ½ CC50, and CC50 concentrations were again incubated for 24 h. Total RNA was isolated via the commercial kit procedures (Qiagen, Germany). The obtained RNAs were transcribed utilizing the Fermentas kit, USA. Following that, the products were evaluated using SYBR green real-time polymerase chain reaction (PCR) based on the primers of iNOS F: GCC TCG CTC TGG AAA GA, iNOS R: TCC ATG CAG ACA ACC TT, β-actin F: GTGACGTTGACATCCGTAAAGA, and β-actin R: GCCGGACTCATCGTACTCC ( 15 ). To this end, basic denaturation was defined at 95°C for 10 min, 40 extension cycles, and a separate cycle at 72°C for 5 min. To end, 2-ΔΔCt was estimated utilizing Bio-Rad iQ5 Optical System Software, USA.
2.8. Antimicrobial effects of CuNPs
Staphylococcus aureus (ATCC 25323), Staphylococcus epidermidis, and Pseudomonas aeruginosa were provided by the ATCC. The frozen bacteria were defrosted and cultured at 37°C for 24 h on nutrient agar plates (Sigma-Aldrich, Germany) and then adjusted in sterile saline to gain a bacterial suspension of 0.5 McFarland unit. In vitro antibacterial susceptibility test of CuNPs was carried out according to the standards protocol of the National Committee for Clinical Laboratory Standards against common skin bacteria by determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) by the microdilution method ( 16 ).
2.9. Statistical analysis
All experiments were performed in triplicate and were indicated as mean ± standard error of the mean. Data were then analyzed in SPSS software (version 26.0) via a one-way ANOVA test. A p-value less than 0.05 was considered statistically significant.
3. Results
3.1. Determining the physical and chemical characteristics
Figure 1 illustrates the physical and chemical characteristics of green synthesized CuNPs. The maximum absorption of CNP acquired from the UV-Vis was observed at 423 nm, which displayed the presence of CNP. As for physical properties, the SEM analysis revealed that the green synthesized CNP exhibited a globular shape with a size ranging from 15-90 nm, while the majority were at 40-60 nm. Considering the X-ray diffraction analysis, we observed the presence of a diffraction peak at 47.4º, 50.7º, and 71.3º corresponding to 111, 200, and 220, respectively, which is similar to the standard sample of CuNPs and confirms their crystal structure.
Figure 1.

The findings of the analysis of UV-Vis (a) and scanning electron microscope (b) and X-ray diffraction (c) for the green synthesized copper nanoparticles.
3.2. Cell viability and proliferation assay
The results of the MTT assay demonstrated that the calculated CC50 value of green synthesized CuNPs was 236.3 μg/mL. The optimum concentrations of CuNPs were selected based on CC50 value, whereas they dose-dependently increased the proliferation of fibroblast cells (Table 1).
Table 1.
Effects of copper nanoparticles on cell viability and proliferation in skin fibroblast cells.
| Cell cytotoxicity | Fibroblast proliferation assay | |||
|---|---|---|---|---|
| Concentration (µg/mL) | Viability (%) | IC50(µg/mL) | Concentration (µg/mL) | Proliferation (%) |
| Non-treated | 97.6± 0.51 | - | 5 | 2.33± 0.71 |
| 50 | 89.4± 3.2 | 236.3 | 10 | 8.6± 1.58 |
| 100 | 76.4± 3.5 | - | 15 | 12.6± 3.5 |
| 200 | 56.6± 5.12 | - | 20 | 29.3± 2.21 |
| 300 | 36.5± 4.46 | - | - | - |
3.3. Wound healing assay
As depicted in figure 2, the scratch test revealed that CuNPs dose-dependently increased the rate of wound closure. After 16 h exposure, the CuNPs dose-dependently increased the rate of wound closure; nonetheless, a significant increase was observed at concentrations of 15 and 20 µg/mL, compared to the control group. After 24 h exposure, the CuNPs dose-dependently increased the rate of wound closure; however, a significant increase was detected at concentrations of 10, 15, and 20 µg/mL, compared to the control group.
Figure 2.
Effect of copper nanoparticles on the migration rate of scratched human skin fibroblast (Hs27). (Mean±sd) * significant difference compared to control.
3.4. Effects of CuNPs on iNOS expression gene
Figure 3 shows the effects of green synthesized CuNPs on the expression gene level of iNOS. The results of the real-time PCR indicated that CuNPs cause upregulation in the expression level of the iNOS gene in RAW 264.7 cells as a dose-dependent response. In this regard, at CC50 concentration, the maximum upregulation of iNOS gene expression was observed (P<0.05).
Figure 3.

Effects of copper nanoparticles on iNOS expression genes in the RAW 264.7 cells by Real-time PCR. CC50: The 50% cytotoxic concentrations; * p < 0.001 compare to untreated cells.
3.5. Antimicrobial effects of CuNPs
As displayed in table 2, CuNPs demonstrated promising antimicrobial effects against S. aureus, S. epidermidis, and P. aeruginosa. CuNPs illustrated that MIC and MBC values ranged from 11.3 to 17.3 µg/mL. The lowest MIC and MBC were reported for P. aeruginosa with MIC and MIC values of 2.66 and 3.33 µg/mL, respectively, indicating that P. aeruginosa was the most sensitive strain to CuNPs.
Table 2.
Antibacterial effects of green synthesized copper nanoparticles against the bacteria involved in wound healing through the determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC).
| Drug | Staphylococcus aureus | Staphylococcus epidermidis | Pseudomonas aeruginosa | |||
|---|---|---|---|---|---|---|
| MIC (µg/ml) | MBC (µg/ml) | MIC (µg/ml) | MBC (µg/ml) | MIC (µg/ml) | MBC (µg/ml) | |
| CuNPs | 12.6±1.15 | 15.3±2.3 | 11.3 ± 1.15 | 13.1 ± 3.15 | 14.1 ± 3.15 | 17.1 ± 3.15 |
| Gentamicin | 2.66±1.15 | 3.33±1.15 | 2.66±1.15 | 3.33±1.15 | 4.0±1.17 | 4.0±1.17 |
4. Discussion
At present, there is a growing interest in exploring novel or alternative therapies obtained by nanotechnology, such as green synthesized nanoparticles, for the treatment of both acute and chronic wounds ( 6 ). Among metal NPs, CuNPs are suitable agents for wound healing since they provoke angiogenesis and skin regeneration, facilitating the healing procedure ( 7 ). Here, we evaluated the in vitro wound healing and anti-inflammatory effects of CuNPs green synthesized by the methanol extract F. macrecolea (Boiss). The SEM analysis revealed that green synthesized CNP exhibited a globular shape with a size ranging from 15-90 nm, while the majority were at 40-60 nm. The results of this study pointed out that green synthesized CNP exhibited a globular shape with a size ranging from 15-90 nm, while the majority were at 40-60 nm. It has been demonstrated that the stability and biological properties of nanoparticles depend on their size, whereas the therapeutic activity of nanoparticles is substantially increased by reducing their size to below 100 nm. Due to a greater surface-to-volume ratio, these particles are more stable and aggregate less frequently. We synthesized the CNPs smaller than 100 nm and suitable for antiparasitic application ( 17 ). The MTT assay demonstrated that the calculated CC50 value of green synthesized CuNPs was 236.3 μg/mL. The optimum concentrations of the CuNPs, selected based on the CC50 value, exhibited a dose-dependent enhancement in the proliferation of fibroblast cells. Previously, Alizadeh et al. (2019) reported that chemical synthetic CNP at the concentrations of 1-10 μM had no cytotoxicity on the cultured fibroblast, endothelial, and keratinocyte cells, whereas, at 1 μM concentration, it increased endothelial cell migration and proliferation ( 18 ). It was found that CuNPs dose-dependently increased the rate of wound closure after 16 and 24 h exposure. Hu et al. (2018) reported that copper-doped borate bioactive glass/poly (lactic-co-glycolic acid) dressing loaded with vitamin E stimulates endothelial cell migration, proliferation, and fibroblast cell proliferation ( 19 ). Another study conducted by Alizadeh (2019) demonstrated that a 1 mM concentration of 80 nm CuNPs accelerated wound healing over a shorter time via the formation of granulation tissue and higher new blood vessels ( 18 ). Nitric oxide (NO) plays a critical role in the regulation of various wound-healing processes, including inflammatory response, cell proliferation, collagen formation, and angiogenesis ( 20 ). The critical role of NO in wound healing has garnered significant research attention towards NO-based wound healing therapy ( 21 ). The results of the real-time PCR pinpointed that CuNPs caused an upregulation in the expression level of the iNOS gene in RAW 264.7 cells, signifying that CuNPs are probably able to provoke the wound healing process by increasing the iNOS gene and subsequently enhancing the NO production. The results of this study demonstrated the promising antimicrobial effects of CuNPs against S. aureus, S. epidermidis, and P. aeruginosa, with MIC and MBC values ranging from 11.3 to 17.3 µg/mL. The lowest MIC and MBC were reported for P. aeruginosa with MIC and MIC values of 2.66 and 3.33 µg/mL, respectively, indicating that P. aeruginosa was the most sensitive strain to CuNPs. Nowadays, the antimicrobial effects of CuNPs against various Gram-negative (Escherichia coli, Acinetobacter baumannii, Helicobacter pylori, Salmonella spp., and Shigella spp.), Gram-positive (Streptococcus spp., Staphylococcus spp., and Bacillus spp.), and antibiotic resistance (Pseudomonas aeruginosa-carbapenem resistant, Haemophilus influenzae-ampicillin-resistant) strains have been reported ( 22 ). Studies have pointed out that copper nanoparticles exhibited antimicrobial activities by triggering reactive oxygen species, disrupting cell walls, enhancing plasma membrane permeability, and inhibiting protein and DNA synthesis ( 22 , 23 ). Among the notable limitations of this study are the lack of animal studies and the failure to investigate the exact mechanisms of wound healing. The present study highlighted the high potency of green CuNPs synthesized by F. macrecolea for wound healing through their antimicrobial properties, proliferation of fibroblast cells, and provoking NO synthesis.
Acknowledgment
The authors' most profound appreciation goes to the staff of the Faculty of Pharmacy for helping with our research project.
Authors' Contribution
MK designed the experiments; SH performed experiments and collected data; MK supervised, directed, and managed the study; SH prepared the methodology. All authors read the published version of the manuscript.
Ethics
This study was approved by the Ethical Committee of the Faculty of Pharmacy, Eastern Mediterranean University (2021-15702032).
Conflict of Interest
The authors declare no conflict of interest in this study.
Data Availability
The data that support the findings of this study are available on request from the corresponding author.
Funding resources
None of the authors received any funding.
References
- 1.Falanga V, Isseroff RR, Soulika AM, Romanelli M, Margolis D, Kapp S, Granick M, Harding K. Chronic wounds. Nature Reviews Disease Primers. 2022;8(1):50. doi: 10.1038/s41572-022-00377-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gonzalez AC, Costa TF, Andrade ZD, Medrado AR. Wound healing-A literature review. Anais brasileiros de dermatologia. 2016;91:614–20. doi: 10.1590/abd1806-4841.20164741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Pastar I, Stojadinovic O, Yin NC, Ramirez H, Nusbaum AG, Sawaya A, Patel SB, Khalid L, Isseroff RR, Tomic-Canic M. Epithelialization in wound healing: a comprehensive review. Advances in wound care. 2014;3(7):445–64. doi: 10.1089/wound.2013.0473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Han G, Ceilley R. Chronic wound healing: a review of current management and treatments. Advances in therapy. 2017;34:599–610. doi: 10.1007/s12325-017-0478-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rajendran NK, Kumar SS, Houreld NN, Abrahamse H. A review on nanoparticle based treatment for wound healing. Journal of Drug Delivery Science and Technology. 2018;44:421–30. [Google Scholar]
- 6.Ezhilarasu H, Vishalli D, Dheen ST, Bay BH, Srinivasan DK. Nanoparticle-based therapeutic approach for diabetic wound healing. Nanomaterials. 2020;10(6):1234. doi: 10.3390/nano10061234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Salvo J, Sandoval C. Role of copper nanoparticles in wound healing for chronic wounds: literature review. Burns & Trauma. 2022;10:47. doi: 10.1093/burnst/tkab047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Alyousif MS, Al-Abodi HR, Almohammed H, Alanazi AD, Mahmoudvand H, Shalamzari MH, Salimikia I. Chemical composition, apoptotic activity, and antiparasitic effects of Ferula macrecolea essential oil against Echinococcus granulosus protoscoleces. Molecules. 2021;26(4):888. doi: 10.3390/molecules26040888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mahmoudvand H, Yadegari JG, Khalaf AK, Hashemi MJ, Dastyarhaghighi S, Salimikia I. Chemical composition, antileishmanial, and cytotoxic effects Ferula macrecolea essential oil against Leishmania tropica. Parasite Epidemiology and Control. 2022;19:e00270. doi: 10.1016/j.parepi.2022.e00270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sadeghi N, Sadeghi H, Mohan DN, Sepahvand A, Alizadeh A, Garavand S. Chemical composition, anti-fungal and cytotoxic effects of Ferula macrecolea essential oil against Candida albicans resistant and sensitive strains. Journal of Herbmed Pharmacology. 2023;12(2):228–32. [Google Scholar]
- 11.Ebrahimi K, Shiravand S, Mahmoudvand H. Biosynthesis of copper nanoparticles using aqueous extract of Capparis spinosa fruit and investigation of its antibacterial activity. Marmara Pharmaceutical Journal. 2017;21(4):866–71. [Google Scholar]
- 12.Albalawi AE, Abdel-Shafy S, Khudair Khalaf A, Alanazi AD, Baharvand P, Ebrahimi K, Mahmoudvand H. Therapeutic potential of green synthesized copper nanoparticles alone or combined with meglumine antimoniate (glucantime®) in cutaneous leishmaniasis. Nanomaterials. 2021;11(4):891. doi: 10.3390/nano11040891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of immunological methods. 1983;65(1-2):55–63. doi: 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
- 14.Fronza M, Heinzmann B, Hamburger M, Laufer S, Merfort I. Determination of the wound healing effect of Calendula extracts using the scratch assay with 3T3 fibroblasts. Journal of ethnopharmacology. 2009;126(3):463–7. doi: 10.1016/j.jep.2009.09.014. [DOI] [PubMed] [Google Scholar]
- 15.Gharavi MJ, Nobakht M, Khademvatan SH, Bandani E, Bakhshayesh M, Roozbehani M. The effect of garlic extract on expression of INFγ and inos genes in macrophages infected with Leishmania major. Iranian Journal of Parasitology. 2011;6(3):74. [PMC free article] [PubMed] [Google Scholar]
- 16.CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Second Informational Supplement. Wayne, PA: The Clinical and Laboratory Standards Institute; 2012. [Google Scholar]
- 17.Xu J, Song M, Fang Z, Zheng L, Huang X, Liu K. Applications and challenges of ultra-small particle size nanoparticles in tumor therapy. Journal of Controlled Release. 2023;353:699–712. doi: 10.1016/j.jconrel.2022.12.028. [DOI] [PubMed] [Google Scholar]
- 18.Alizadeh S, Seyedalipour B, Shafieyan S, Kheime A, Mohammadi P, Aghdami N. Copper nanoparticles promote rapid wound healing in acute full thickness defect via acceleration of skin cell migration, proliferation, and neovascularization. Biochemical and biophysical research communications. 2019;517(4):684–90. doi: 10.1016/j.bbrc.2019.07.110. [DOI] [PubMed] [Google Scholar]
- 19.Hu H, Tang Y, Pang L, Lin C, Huang W, Wang D, Jia W. Angiogenesis and full-thickness wound healing efficiency of a copper-doped borate bioactive glass/poly (lactic-co-glycolic acid) dressing loaded with vitamin E in vivo and in vitro. ACS applied materials & interfaces. 2018;10(27):22939–50. doi: 10.1021/acsami.8b04903. [DOI] [PubMed] [Google Scholar]
- 20.Wu M, Lu Z, Wu K, Nam C, Zhang L, Guo J. Recent advances in the development of nitric oxide-releasing biomaterials and their application potentials in chronic wound healing. Journal of Materials Chemistry B. 2021;9(35):7063–75. doi: 10.1039/d1tb00847a. [DOI] [PubMed] [Google Scholar]
- 21.Malone‐Povolny MJ, Maloney SE, Schoenfisch MH. Nitric oxide therapy for diabetic wound healing. Advanced healthcare materials. 2019;8(12):1801210. doi: 10.1002/adhm.201801210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Crisan MC, Teodora M, Lucian M. Copper nanoparticles: Synthesis and characterization, physiology, toxicity and antimicrobial applications. Applied Sciences. 2021;12(1):141. [Google Scholar]
- 23.Betancourt-Galindo R, Reyes-Rodriguez PY, Puente-Urbina BA, Avila-Orta CA, Rodríguez-Fernández OS, Cadenas-Pliego G, Lira-Saldivar RH, García-Cerda LA. Synthesis of copper nanoparticles by thermal decomposition and their antimicrobial properties. Journal of Nanomaterials. 2014 [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author.

