Skip to main content
JARO: Journal of the Association for Research in Otolaryngology logoLink to JARO: Journal of the Association for Research in Otolaryngology
. 2024 Oct 21;25(6):531–543. doi: 10.1007/s10162-024-00967-w

Vital Dye Uptake of YO-PRO-1 and DASPEI Depends Upon Mechanoelectrical Transduction Function in Zebrafish Hair Cells

Ashley Scott Patterson 1,2, Joseph Dugdale 3, Alaa Koleilat 4,5, Anna Krauss 6,7, Gabriel A Hernandez-Herrera 8,9, Jasmine G Wallace 10,11, Cassidy Petree 12, Gaurav K Varshney 12, Lisa A Schimmenti 13,
PMCID: PMC11683040  PMID: 39433714

Abstract

Purpose

Vital dyes allow the visualization of cells in vivo without causing tissue damage, making them a useful tool for studying lateral line and inner ear hair cells in living zebrafish and other vertebrates. FM1-43, YO-PRO-1, and DASPEI are three vital dyes commonly used for hair cell visualization. While it has been established that FM1-43 enters hair cells of zebrafish and other organisms through the mechanoelectrical transduction (MET) channel, the mechanism of entry into hair cells for YO-PRO-1 and DASPEI has not been established despite widespread use. We hypothesize that YO-PRO-1 and DASPEI entry into zebrafish hair cells is MET channel uptake dependent similar to FM1-43.

Methods

To test this hypothesis, we used both genetic and pharmacologic means to block MET channel function. Genetic based MET channel assays were conducted with two different mechanotransduction defective zebrafish lines, specifically the myo7aa−/− loss of function mutant tc320b (p.Y846X) and cdh23−/− loss of function mutant (c.570-571del). Pharmacologic assays were performed with Gadolinium(III) Chloride (Gad(III)), a compound that can temporarily block mechanotransduction activity.

Results

Five-day post fertilization (5dpf) myo7aa−/− and cdh23−/− larvae incubated with FM1-43, YO-PRO-1, and DASPEI all showed nearly absent uptake of each vital dye. Treatment of wildtype zebrafish larvae with Gad(III) significantly reduces uptake of FM1-43, YO-PRO-1, and DASPEI vital dyes.

Conclusion

These results indicate that YO-PRO-1 and DASPEI entry into zebrafish hair cells is MET channel dependent similar to FM1-43. This knowledge expands the repertoire of vital dyes that can be used to assess mechanotransduction and MET channel function in zebrafish and other vertebrate models of hair cell function.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10162-024-00967-w.

Keywords: Zebrafish (Danio rerio), Vital dyes, Mechanoelectrical transduction, myo7aa, cdh23, Gadolinium(iii) chloride

Introduction

The physiology of hearing is conserved in zebrafish, making them an ideal model to test hypotheses relevant to human deafness [1]. Zebrafish larvae sense vibrational stimuli via sensory hair cells starting at 5 days post fertilization [2] (Fig. 1). Displacement of hair cell stereocilia triggers mechanoelectrical transduction (MET) channel opening at the apical tip of each hair cell stereocilium. The exact components of this MET channel have not been unequivocally determined, but it is proposed that this mechanosensitive channel is comprised of a complex of membrane proteins and is gated by connecting tip-links [35]. MET channel opening permits positive ion entry, specifically potassium and calcium, into hair cells [6, 7] leading to a depolarization state and neurotransmitter release, resulting in stimulation of the auditory nerve [8, 9].

Fig. 1.

Fig. 1

(A) A graphical depiction of a healthy hair cell stereocilium in an inactive state. Without mechanical displacement of the stereocilium the Mechanoelectrical transduction (MET) channel does not allow the influx of cations. (B) When mechanical stimulation successfully displaces the stereocilium, the tip link structure connecting each stereocilium opens the MET channel, allowing for the subsequent influx of cations, leading to depolarization and release of neurotransmitters at the lateral end of the hair cell into the synaptic cleft, stimulating afferent neurons. (C) If the tip link structure is defective, as indicated by gray-shaded tip link components, proper MET channel gating does not occur in response to a mechanical stimulus, preventing the influx of cations. (D) A graphical depiction of the characteristic arrangement of neuromasts along the head and body of the zebrafish. The MI1 neuromast is labeled for clarity, as all analysis was conducted comparing this neuromast. Created with BioRender.com

Like all teleosts, sensory hair cells are found in the inner ear of the zebrafish [10] and as part of a characteristic external sensory system along the body, known as the lateral line [1113] (Fig. 1D). The lateral line plays a critical role in sensing low frequency vibrational stimuli [14, 15] and is comprised of neuromasts, the functional sensory unit containing bundles of hair cells [14]. Sensory hair cells in the lateral line share evolutionary origins and molecular pathways with those of the inner ear of all vertebrates, offering an attractive platform to investigate hearing loss mechanisms [16].

Vital dyes allow visualization of live cells of interest and certain cellular structures in whole zebrafish and other vertebrates without causing damage to tissues [17, 18]. Because of the superficial location of the zebrafish lateral line, incubation with dyes enables efficient visualization of this organ’s physiology. FM1-43, YO-PRO-1, and DASPEI are three vital dyes commonly used to visualize lateral line hair cells [19, 20] (Fig. 2).

Fig. 2.

Fig. 2

Chemical structures of three vital dyes, FM1-43 (Mol. Wt = 611.55 g/mol), YO-PRO-1 (Mol. Wt = 629.32 g/mol), and DASPEI (Mol. Wt = 380.27 g/mol), commonly used in specific labeling and visualization of zebrafish lateral line hair cells in vivo. Chemical structure information as provided by the manufacturer (ThermoFisher Scientific). Image created with biorender.com

N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (FM1-43) is part of the FM family of lipophilic dyes used to study plasma membranes and endocytosis [21]. FM1-43 becomes fluorescent after entering the hydrophobic outer leaflet of plasma membranes [22], and after a brief incubation, FM1-43, enters lateral line hair cells through the MET channel [18, 23]. FM1-43 entry through the MET channel makes it a useful agent for lateral line visualization and assessment of mechanotransduction function, as well as effective for investigation of potential hair cell damage [24, 25], making it a critical tool for hearing research in zebrafish as well as other vertebrate models.

Both quinolinium,4-[(3-methyl-2(3H)-benzoxazolylidene)methyl]-1-[3-(triemthylammonio)propyl]-diiodide (YO-PRO-1) and 2-(4-(dimethylamino)styryl)-N-ethylpyridinium Iodide (DASPEI) are also vital dyes commonly used to visualize hair cells and study potential hair cell damage [20, 2628]. In addition to their role in hair cell visualization and assessment, both these vital dyes have been used for other purposes. For example, YO-PRO-1 has been used as an apoptotic cell marker that enters permeant dying cells and becomes fluorescent when it binds to nucleic acids [29], and DASPEI is a styryl dye that enters cells via membrane potentials and stains the mitochondria of living cells [30, 31].

Despite the wide use of YO-PRO-1 and DASPEI for zebrafish hair cell fluorescent visualization, their mechanism of entry into hair cells has not been clearly established. Michel et al. described the entry of YO-PRO-1 into HEK 293 cells via the P2X7 receptor [32]. Following activation by ATP or an ATP analog, P2X7 receptors open and make cells permeable to ions and large compounds, such as YO-PRO-1. It is proposed that YO-PRO-1 enters apoptotic cells through the P2X7 receptor [29, 33] but this may not be the mechanism by which YO-PRO-1 enters hair cells. The mechanism for entry of DASPEI has not been clearly established.

To establish whether YO-PRO-1 and DASPEI entry into hair cells is MET channel function dependent, we evaluated two MET channel defective zebrafish lines caused by mutations in myo7aa and cdh23 [3436]. The mariner tc320b mutant has an early stop codon mutation in myo7aa, p.Tyr846Stop (p.Y846X). Homozygous recessive mutant larvae do not respond to sound stimuli and exhibit a circular swimming behavior. This line has been determined to be mechanotransduction defective and FM1-43 uptake is impaired [34, 36], making this model a useful tool in studying MET channel function in the hair cells of the lateral line and inner ear of zebrafish. We also generated a cdh23 mutant (c.570-571del), which created a frameshift followed by a premature stop codon. To characterize this line, we performed acoustic-evoked behavioral response (AEBR) on the larvae from a heterozygous cross and found the AEBR is completely absent in cdh23−/− mutant larvae at 6dpf, supporting homozygous cdh23−/− mutants are deaf and fail to respond to acoustic stimulus (Online Resource 2 and 7). These results are consistent with other zebrafish cdh23 mutant lines, which have been demonstrated to be deaf, mechanotransduction defective, and exhibit circular swimming behaviors [35].

Due to their comparable molecular size and chemical structures, as well as their positively charged nature, we hypothesize that YO-PRO-1 and DASPEI entry into zebrafish hair cells is MET channel dependent, similar to FM1-43. In order to test the role of a functioning MET channel in vital dye uptake, we assayed vital dye entry into neuromast hair cells in two genetic mechanotransduction defective models, myo7aa−/− and cdh23−/−. In addition, we utilized two potent P2X7 channel antagonists, Brilliant Blue G [3739] and A740003 [40, 41], to investigate any potential role of the P2X7 channel in vital dye uptake. Finally, we pharmacologically blocked mechanotransduction in wildtype embryos using Gadolinium (III) Chloride (Gad(III)), a known mechanosensitive channel block which has been shown to be non-toxic to zebrafish embryos [42, 43].

Materials and Method

Animal Model

Animals used in this study were all zebrafish (Danio rerio). The following mutant lines were used for experiments in this study: mariner tc320b allele (c.2699 T > A;p.Tyr846Stop) in exon 21 of myo7aa−/− [36] and (c.570-571del) in exon 8 of cdh23−/−.

Zebrafish Maintenance and Husbandry

Animals were raised in a 10-h dark 14-h light cycle. Adult zebrafish were reared at 27–29 °C in accredited facilities at Mayo Clinic and Oklahoma Medical Research Foundation. Larvae were maintained in petri dishes in embryo media, with daily water changes. Embryo media was a modified (half strength) solution consisting of 15 mM NaCl, 0.5 mM KCl, 1,0 mM MgSO4, 0.15 mM KH2PO4, 0.05 mM Na2HPO4, 1.0 mM CaCl2, and 0.7 mM NaHCO3 [44]. Larvae were maintained at room temperature for any experiments conducted, and otherwise housed in incubators at 28.5 °C. All treatment and imaging of zebrafish in this study was conducted at 5-days post fertilization (5dpf). Sex of the zebrafish was not considered in this investigation as the sex cannot be determined in zebrafish larvae.

For the myo7aa−/− strain, heterozygous adult fish were used to generate larvae. Mutant larvae were identified at 4dpf via specific phenotypic behaviors, including lack of startle response to sound, defective balance, and circular swimming patterns. Control larvae were generated from crosses of wildtype siblings of the mariner myo7aa line. All experimental procedures were performed as per protocol A00001519-16-R22 approved by the Mayo Clinic Institutional Animal Care and Use Committees (IACUC). All mariner tc320b zebrafish were genotyped via Sanger sequencing. The PCR primer sequences for the mariner tc320b allele are as follows:

  • tc320b_genotype_F: TCACGTCTGCAGGCGCTATAT.

  • tc320b_genotype_R: CTCCTTTGAGTCGTTTGTAGAGCC.

For the cdh23−/− strain, heterozygous adult fish were used to generate larvae. Control larvae were wildtype siblings genotyped at conclusion of an experiment. cdh23 mutants were generated and raised in an AALAC accredited facility at the Oklahoma Medical Research Foundation (OMRF) under standard conditions, and all experiments were performed as per protocol 24–11 approved by the Institutional Animal Care Committee of OMRF (IACUC).

Zebrafish cdh23 Knockout Generated by CRISPR/Cas9 Genome Editing

CRISPR/Cas9 target site selection was performed using UCSC genome browser CRISPR track. Cas9 mRNA and single guide RNAs (sgRNAs) were synthesized as described previously [45, 46]. A mixture containing Cas9-encoding mRNA (300 ng/μl) and sgRNA (50 ng/μl) was injected into one-cell-stage wild-type TAB-5 genetic background embryos. Insertion/deletion mutations were detected by fluorescent-based PCR fragment analysis [47] (Online Resource 1). To obtain stable lines, F0 injected embryos were raised to adulthood and outcrossed to wildtype zebrafish. The genomic DNA was extracted from the caudal fin of F1 progeny, PCR amplified, and sequenced to identify heterozygous fish. Heterozygous F1 fish were crossed to generate F2 progeny. F2 larvae were genotyped prior to or at the conclusion of an experiment. The sgRNA target sequences and PCR primers for cdh23 sequences are as follows:

  • cdh23_sgRNA: GGTCACAGTGACGATTCCTC

  • cdh23_geno_F: tgtaaaacgacggccagtACTCCAGTTGGGACGTCAGT.

  • cdh23_geno_R: gtgtcttCAGACATAACAAGCGGACACA.

cdh23 Acoustic-evoked Behavioral Response (AEBR) Analysis

To conduct the AEBR test, 6dpf larvae were placed in a 96-well plate containing 175 µL of embryo water. The plate was then positioned in a Zebrabox (ViewPoint Life Sciences) where the larvae were allowed to acclimate in darkness for 15–30 min, reducing spontaneous movements. The larvae were exposed to a 100 ms, 1 kHz pure tone at maximum power every 20 s for 4 min (total of 12 stimuli), all in the dark. Infrared light was used by the Zebrabox to track the larvae, recording their activity by detecting pixel changes over time. The thresholds were set as follows: 50 pixels for burst detection, 10 pixels for freezing, and 20 pixels for sensitivity. Any movement exceeding 50 pixels within 2 s after the stimulus was considered an evoked response. Responses were disregarded if the larvae exhibited spontaneous movement within the 2 s preceding the stimulus. If a larva showed spontaneous movement before 6 or more of the stimuli, all of its responses were excluded. The response rate was determined by calculating the percentage of stimuli that triggered an evoked response for each larva. Genotyping was performed after the AEBR test as described previously [48].

FM1-43 Uptake

N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (FM1-43) dye used in this study was obtained from ThermoFisher Scientific (catalog number T35356). FM1-43 was reconstituted in DMSO and diluted to a concentration of 3 µM in embryo media [20]. 5dpf larvae were incubated in FM1-43 for 30 s at room temperature in open well PYREX 9 depression glass spot plates (Corning, catalog number 7220–85) and then washed three times with embryo media. Larvae were transferred to 2 ml screw cap microtubes (Sarstedt, catalog number 72.693.105) and maintained in embryo media until being imaged using a ZEISS Lightsheet 7 florescence microscope with excitation at 561 nm.

YO-PRO-1 Uptake

Quinolinium,4-[(3-methyl-2(3H)-benzoxazolylidene)methyl]-1-[3-(triemthylammonio)propyl]- diiodide (YO-PRO-1) dye used in this study was obtained from ThermoFisher Scientific (catalog number Y3603). YO-PRO-1 was reconstituted in DMSO and diluted to a concentration of 2 µM in embryo media [20]. 5dpf larvae were incubated in YO-PRO-1 for 1 h at room temperature in open well PYREX 9 depression glass spot plates and then washed three times with embryo media. Larvae were transferred to 2 ml screw cap microtubes and maintained in embryo media until being imaged using a ZEISS Lightsheet 7 florescence microscope with excitation at 488 nm.

DASPEI Uptake

2-(4-(dimethylamino)styryl)-N-Ethylpyridinium Iodide (DASPEI) used in this study was obtained from ThermoFisher Scientific (catalog number D426). DASPEI was reconstituted in DMSO and diluted to a concentration of 130 µM in embryo media [49, 50]. 5dpf larvae were incubated in DASPEI for 15 min at room temperature in open well PYREX 9 depression glass spot plates and then washed three times with embryo media. Larvae were transferred to 2 ml screw cap microtubes and maintained in embryo media until being imaged using a ZEISS Lightsheet 7 florescence microscope with excitation at 561 nm.

P2x7 Receptor Block

Brilliant Blue G used in this study was obtained from SantaCruz (catalog number sc-203733) and A740003 used in this study was obtained from Tocris (catalog number 3701). Wildtype larvae were incubated in an antagonist in a dose or time-dependent manner in 6-well plates (Falcon, catalog number 351146) at 28.5 °C, followed by incubation in YO-PRO-1 at 5dpf (see staining method in Sect. "YO-PRO-1 uptake"). Zebrafish larvae were incubated in Brilliant Blue G. For the time-response experiment, embryos were incubated in 1 µM Brilliant Blue for 1 h, 4 h, and overnight followed by incubation in YO-PRO-1. For the dose–response experiment, embryos were incubated in 0.5 µM, 1 µM, 2 µM, 5 µM, and 10 µM overnight followed by incubation in YO-PRO-1 [39]. Zebrafish larvae were incubated in A740003. For the time-course experiment, embryos were incubated in 300 nM for 1 h, 4 h, and overnight followed by incubation in YO-PRO-1. For the dose–response experiment, embryos were incubated in 100 nM, 300 nM, 500 nM, 750 nM, and 1000 nM overnight followed by incubation in YO-PRO-1 [40, 41]. Fish were then imaged using a ZEISS Lightsheet 7 florescence microscope with excitation at 488 nm.

Gadolinium(III) Chloride Mechanotransduction Channel Block

Gad(III) used in this study was obtained from Sigma Aldrich (catalog number 439770). Gad(III) was reconstituted in Nanopure water and diluted to a concentration of 2 mM. This dosage was chosen for ability to block FM1-43 uptake with no visible impact on viability. 5dpf larvae were incubated in Gad(III) for 30 s at room temperature in PYREX 9 depression glass spot plates and then washed one time with embryo media prior to incubation with any vital dyes in block experiments. Fish were then imaged using a ZEISS Lightsheet 7 florescence microscope with the appropriate excitation frequency dependent on the vital dye as above.

Lightsheet Imaging

5dpf larvae were mounted in 1% low melt agarose (Thermo Fisher, catalog number BP1360-100) in 1% tricaine (MS-222) (Syndel, catalog number NC0872873) prior to imaging and individual larvae were isolated in a 20 µl (1.5 mm diameter) glass capillary (Brand, catalog number 701904). Images of zebrafish larvae were taken on a ZEISS Lightsheet 7 using a 5X/1.0 NA water-dipping objective lens (ZEISS) and 0.4 magnitude zoom. FM1-43 and DASPEI were imaged with an excitation 561 nm. YO-PRO-1 was imaged with an excitation 488 nm. 0.1 µm z-stacks were taken and compiled into a maximum intensity projection using ZEISS software. Fluorescent images were overlayed over brightfield images. All imaging was conducted at room temperature.

Image Analysis

Each larvae image was analyzed for fluorescence intensity using image J software. All analysis was conducted by the same individual, and images were blinded by a secondary individual prior to analysis. For consistency, the same neuromast, MI1, was selected in each fish and manually segmented within image J. The area, mean gray value, and integrated density were measured for the MI1 neuromast, as previously described [51]. To obtain the corrected total fluorescence (CTF), background fluorescence intensity was measured near the MI1 neuromast, averaged, and then subtracted from the measured fluorescence intensity as follows:

CTF=Int.density-(areaofMI1averagefluorescenceofbackground)

The CTF for each fish was determined and data analysis was conducted to compare fluorescence intensity of the MI1 neuromast for each fish.

Data Analysis

All data analysis and visualization were conducted with GraphPad Prism version 10. An unpaired two-tailed t-test assuming unequal variance was conducted to determine statistical significance of fluorescence intensity from all vital dyes incubated with myo7aa−/− versus wildtype controls (Fig. 3), cdh23−/− versus wildtype controls (Fig. 4), and wildtypes treated with Gad(III) versus untreated controls (Fig. 6). An ordinary one-way ANOVA test was conducted to determine statistical significance of fluorescence intensity from YO-PRO-1 incubation in wildtypes treated with P2X7 receptor antagonists, in a dose and time-dependent manner (Fig. 5).

Fig. 3.

Fig. 3

(A) Comparison data of FM1-43, (B) YO-PRO-1, and (C) DASPEI uptake between mariner myo7aa mutants (n = 24, 19, and 10 respectively) and wildtype controls (n = 23, 21, and 19 respectively), represented by fluorescence intensity of the MI1 neuromast following incubation. There is a significantly reduced fluorescence intensity in mutants compared to wildtype controls in all three comparisons (p < 0.0001, 95% confidence). Bars indicate Mean value and SD is represented by error bars. (D) Representative images of FM1-43 staining of zebrafish lateral line neuromast hair cells in mariner myo7aa wildtype controls with (D′) brightfield overlay and (E) mariner myo7aa mutants with (E′) brightfield overlay. (F) Representative images of YO-PRO-1 staining of zebrafish lateral line neuromast hair cells in mariner myo7aa wildtype controls with (F′) brightfield overlay and (G) mariner myo7aa mutants with (G′) brightfield overlay. (H) Representative images of DASPEI staining of zebrafish lateral line neuromast hair cells in mariner myo7aa wildtype controls with (H′) brightfield overlay and (I) mariner myo7aa mutants with (I′) brightfield overlay

Fig. 4.

Fig. 4

(A) Comparison data of FM1-43, (B) YO-PRO-1, and (C) DASPEI uptake in cdh23−/− (n = 13, 5, and 5 respectively) and wildtype controls (n = 13, 5, and 5 respectively), represented by fluorescence intensity of the MI1 neuromast following incubation. There is a significantly reduced fluorescence intensity in mutants compared to wildtype controls for FM1-43 (p < 0.0001) as well as for YO-PRO-1 and DASPEI (p < 0.01, 95% confidence). Bars indicate Mean value and SD is represented by error bars. (D) Representative images of FM1-43 staining of zebrafish lateral line neuromast hair cells in cdh23 wildtype controls with (D′) brightfield overlay and (E) cdh23−/− with (E′) brightfield overlay. (F) Representative images of YO-PRO-1 staining of zebrafish lateral line neuromast hair cells in cdh23 wildtype controls with (F′) brightfield overlay and (G) cdh23−/− with (G′) brightfield overlay. (H) Representative images of DASPEI staining of zebrafish lateral line neuromast hair cells in cdh23 wildtype controls with (H′) brightfield overlay and (I) cdh23−/− with (I′) brightfield overlay

Fig. 6.

Fig. 6

(A) Comparison data of FM1-43, (B) YO-PRO-1, and (C) DASPEI uptake in wildtypes untreated (n = 25, 37, and 28 respectively) and Gadolinium(III) Chloride treated wildtypes (n = 30, 40, and 28 respectively), represented by fluorescence intensity of the MI1 neuromast following incubation. There is a significantly reduced fluorescence intensity in wildtypes blocked with Gad(III) when compared to untreated wildtype controls for all three vital dye incubations (p < 0.0001, 95% confidence). Bars indicate Mean value and SD is represented by error bars. (D) Representative images of FM1-43 staining of zebrafish lateral line neuromast hair cells in wildtype controls with (D′) brightfield overlay and (E) Gad(III) treated with (E′) brightfield overlay. (F) Representative images of YO-PRO-1 staining of zebrafish lateral line neuromast hair cells in wildtype controls with (F′) brightfield overlay and (G) Gad(III) treated with (G′) brightfield overlay. (H) Representative images of DASPEI staining of zebrafish lateral line neuromast hair cells in wildtype controls with (H′) brightfield overlay and (I) Gad(III) treated with (I′) brightfield overlay

Fig. 5.

Fig. 5

(A) Comparison data of YO-PRO-1 uptake in wildtype zebrafish treated with Brilliant Blue G at 1 µM in a time-dependent manner (n = 5, 6, 6, and 6 respectively), (B) Brilliant Blue G overnight in a dose-dependent manner (n = 4, 6, 6, 6, 6, and 6 respectively), (C) A740003 at 100 nM in a time-dependent manner(n = 5, 6, 6, and 6 respectively), and (D) A740003 overnight in a dose-dependent manner (n = 5, 6, 6, 6, 6, and 6 respectively) compared to untreated controls, represented by fluorescence intensity of the MI1 neuromast following incubation. There is no significant reduction in fluorescence intensity at any time or dose point compared to untreated controls for either Brilliant Blue G or A740003 (p = 0.9381 F = 0.1348, p = 0.7707 F = 0.5039, p = 0.5024 F = 0.8131, and p = 0.1425 F = 1.808 respectively, 95% confidence). Bars indicate Mean value and SD is represented by error bars. Representative images for each dose and time point provided in Online Resource 3–6

Results

Vital Dye Fluorescence Intensity Levels are Reduced in myo7aa−/− Zebrafish Compared to Controls

To explore whether the entry of vital dyes YO-PRO-1 and DASPEI into zebrafish lateral line hair cells is MET channel dependent, myo7aa−/− larvae, a known mechanotransduction defective line [18, 23], were incubated with each vital dye at 5dpf. Fluorescence intensity resulting from dye uptake was quantitated by imaging the MI1 neuromast and measuring fluorescence in homozygous mutant embryos and controls. myo7aa−/− zebrafish larvae showed a significant reduction in FM1-43 fluorescence intensity and a visible lack of labeling of lateral line hair cells when compared to wildtype controls [34, 36] (Fig. 3A). Both YO-PRO-1 and DASPEI treatment yielded a significant reduction in fluorescence intensity in myo7aa−/− zebrafish compared to wildtype controls (Fig. 3B,C).

Vital dye Fluorescence Intensity levels are Reduced in cdh23−/− Zebrafish Compared to Controls

We generated a cdh23 mutant line using CRISPR/Cas9 genome editing and identified a 2 bp deletion in exon 8 creating a premature stop codon that truncates the protein. We generated homozygous larvae by breeding heterozygous adults. cdh23−/− and wildtype control 5dpf zebrafish larvae were incubated with FM1-43, YO-PRO-1, and DASPEI separately. There was a visual reduction of neuromast hair cell fluorescent labeling following incubation with all vital dyes, and a corresponding significant reduction in fluorescence intensity in the cdh23−/− zebrafish in comparison to wildtype controls (Fig. 4).

Vital Dye Uptake Is Not Reduced in P2x7 Antagonist Treated Wildtype Zebrafish Larvae

In order to explore the potential role of another proposed mechanism of entry for the vital dye YO-PRO-1, via the P2X7 receptor channel [32], we inhibited P2X7 receptor activity in wildtype control zebrafish using two potent and selective antagonists, Brilliant Blue G and A740003 [3741]. We treated 5dpf wildtype larvae with Brilliant Blue G at 1 µM for 1 h, 4 h, and overnight. This time response treatment had no significant effect on fluorescence intensity levels (Fig. 5A). We also treated 5dpf larvae with Brilliant Blue G overnight at 0.5 µM, 1 µM, 2 µM, 5 µM, and 10 µM. This dose response treatment had no significant effect on fluorescence intensity levels (Fig. 5B). Similarly, treatment with 300 nM A740003 for 1 h, 4 h and overnight (Fig. 5C), as well as treatment at 100 nM, 300 nM, 500 nM, 750 nM, and 1000 nM overnight (Fig. 5D) had no significant effect on fluorescence intensity levels.

Pharmacologic Blockade of the MET Channel with Gad(III) Blocks Uptake of All Three Vital Dyes

To further explore the role of the MET channel in uptake of these vital dyes we pharmacologically blocked MET channel function in wildtype larvae. Gad(III) is known to block mechanosensitive cation channels and has been shown to block mechanotransduction channels in gastrointestinal epithelium [42, 52]. Gad(III) is not acutely toxic to developing zebrafish larvae at high concentrations [43]. Gad(III) has been shown to block the MET channels of chick hair cells [53] but has not been previously used as a pharmacologic treatment in zebrafish to block mechanosensitive channels. When wildtype control zebrafish larvae were treated with 2 mM Gad(III) and then incubated with FM1-43, YO-PRO-1, or DASPEI, there was a visual reduction of labeling in lateral line neuromast hair cells, and a significant reduction of fluorescence intensity levels in these wildtype larvae treated first with Gad(III) compared to untreated controls (Fig. 6).

Discussion

In this study, we presented the hypothesis that the mechanism for entry of the vital dyes YO-PRO-1 and DASPEI into zebrafish hair cells is dependent on MET channel function, similar to FM1-43. In order to test this hypothesis, we assessed vital dye uptake with two genetic mechanotransduction defective zebrafish mutant lines, myo7aa−/− and cdh23−/−, and also employed a pharmacologic blockade of MET channel function. The mechanotransduction defective zebrafish lines, myo7aa−/− and cdh23−/−, both exhibited a significant reduction in fluorescence intensity in the lateral line MI1 neuromast with all three vital dyes when compared to wildtype controls. By visual inspection, vital dye uptake was reduced in all neuromasts of the lateral line in these MET channel defective lines. Pharmacologic blockade with Brilliant Blue G and A740003 of P2X7 receptors present in the wildtype zebrafish larvae showed no significant decrease in YO-PRO-1 fluorescence intensity. Pharmacologic blockade of MET channel function in wildtype zebrafish larvae via Gad(III) yielded a significant reduction in vital dye fluorescence intensity in comparison to untreated wildtype controls. Taken together, these results support our hypothesis that, like FM1-43, the mechanism of entry for YO-PRO-1 and DASPEI into zebrafish hair cells is dependent on MET channel function.

All three of these vital dyes are used for distinct purposes in many fields of research. For example, FM1-43 is used to study plasma membranes and endocytosis [21], YO-PRO-1 is used to visualize apoptotic cells [29], and DASPEI is used as a mitochondrial marker [30, 31]. However, all these vital dyes are also commonly used as zebrafish lateral line hair cell markers [19, 20]. Despite their common utilization, FM1-43 is the only vital dye with its mechanism of entry into the lateral line hair cells properly elucidated [18, 23]. In this study, we now confirm that YO-PRO-1 and DASPEI are also dependent on MET channel function for entry into hair cells.

Mechanotransduction defective zebrafish strains have been critical to the zebrafish sensory research field, allowing for in vivo investigation of the impact of a defective MET channel on hearing. The mechanotransduction defective myo7aa−/− zebrafish line has also been previously used to identify the MET channel’s critical function in the mechanism of FM1-43 uptake in zebrafish hair cells [34, 36]. We aimed to build upon this by testing the uptake of YO-PRO-1 and DASPEI in mariner mutants, as well as exploring uptake in another mechanotransduction defective mutant zebrafish line, cdh23−/−. Both mariner myo7aa and cdh23 mechanotransduction defective mutant strains exhibited significant reduction in fluorescence levels with all three vital dyes compared to wildtype controls, indicating a reduction in vital dye uptake. This supports the hypothesis that MET channel function is critical for uptake of all three vital dyes.

As has been noted, there is a previously established mechanism of entry for YO-PRO-1 into apoptotic cells. The P2X7 receptor has been shown to allow for YO-PRO-1 entry into apoptotic cells permeabilized by activation of this receptor [32]. Our attempts to block any potential P2X7 receptor activity via antagonistic pharmacologic treatment in a dose and time-dependent manner showed no significant reduction in fluorescence levels. These results show no reduction in YO-PRO-1 uptake with blockade of P2X7 receptor activity, indicating that P2X7 receptor activity plays no role in YO-PRO-1 uptake in healthy zebrafish lateral line hair cells.

To further support the critical role of MET channel function in vital dye uptake in zebrafish hair cells, we pharmacologically blocked MET channel function. Gad(III) is a known mechanosensitive channel block [42, 52, 53] but has not been used to block MET channel function in zebrafish previously. Treatment with Gad(III) showed significant reductions in fluorescence levels with FM1-43, YO-PRO-1, and DASPEI when compared to untreated controls. Our results indicate that not only is Gad(III) a potent and useful MET channel block for zebrafish sensory research, but also that uptake of all three vital dyes were reduced significantly following successful MET channel block, further supporting our hypothesis that MET channel function is critical to YO-PRO-1 and DASPEI uptake.

Conclusions

This study was conducted to determine the mechanism by which the commonly used vital dyes YO-PRO-1 and DASPEI enter zebrafish hair cells. To accomplish this, we compared the uptake patterns of these two vital dyes with an additional vital dye, FM1-43, which is well established to enter zebrafish hair cells via the MET channel. Utilizing lightsheet microscopy to visualize both genetic and pharmacologic mechanotransduction defective models, we quantified vital dye uptake as related to MET channel function. We demonstrate that the proper function of the MET channel is necessary for not only FM1-43 uptake, but for YO-PRO-1 and DASPEI uptake as well. We identify Gad(III) as a novel and effective zebrafish MET channel blocking agent. This study provides evidence to support and expand our repertoire of tools available for evaluating MET channel function in the field of zebrafish hearing research, helping to aid future exploration of mechanotransduction defective zebrafish models of deafness.

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

We would like to thank Dr. Teresa Nicolson for providing us with the tc320b myo7aa mariner zebrafish strain. We also would like to thank zebrafish core facilities staff at Mayo Clinic and the Oklahoma Medical Research Foundation.

Authors Contribution

Conceptualization (ASP, JD, AlK, AnK, LAS); Data Curation (ASP, JD, AlK, GAHH, JGW); Formal Analysis (JD, LAS); Investigation (ASP, JD, AlK, CP); Methodology (ASP, JD, AlK, CP, GKV, LAS); Project administration, Supervision, Funding acquisition (GKV, LAS); Resources (ASP, JD, LAS, GKV); Software (JD, GAHH); Validation (JD, LAS); Visualization (JD); Writing – original draft (ASP, JD); writing – review & editing (ASP, JD, AlK, AnK, GAHH, JGW, CP, GKV, LAS).

Funding

This work was supported by the Mayo Foundation for Medical Education and Research, the Mayo Clinic Robert and Arlene Kogod Aging Center, the Mayo Clinic Department of Otorhinolaryngology, Head and Neck Surgery, and a grant from the National Institute on Deafness and Other Communication Disorders, NIH (R21DC020317 to G.K.V.). A.S. and An.K. were supported by the funding from the National Institute of General Medicine Sciences, NIH (GM55252, contact PI Luis Lujan and co-PI L.J. Maher).

Data Availability

Data will be made available upon request.

Declarations

Conflict of interest

The authors have no competing interests to declare that are relevant to the content of this article.

Footnotes

Ashley Scott Patterson and Joseph Dugdale are co-first authors.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Whitfield TT, Riley BB, Chiang M-Y, Phillips B (2002) Development of the zebrafish inner ear. Dev Dyn 223(4):427–458. 10.1002/dvdy.10073 [DOI] [PubMed] [Google Scholar]
  • 2.Baxendale S, Whitfield TT (2016) Methods to study the development, anatomy, and function of the zebrafish inner ear across the life course. Methods Cell Biol 134:165–209. 10.1016/bs.mcb.2016.02.007 [DOI] [PubMed] [Google Scholar]
  • 3.Nicolson T (2017) The genetics of hair-cell function in zebrafish. J Neurogenet 31(3):102–112. 10.1080/01677063.2017.1342246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Basu A, Lagier S, Vologodskaia M, Fabella BA, Hudspeth AJ (2016) Direct mechanical stimulation of tip links in hair cells through DNA tethers. Elife 5 10.7554/eLife.16041 [DOI] [PMC free article] [PubMed]
  • 5.Corey DP, Hudspeth AJ (1983) Kinetics of the receptor current in bullfrog saccular hair cells. J Neurosci 3(5):962–976. 10.1523/jneurosci.03-05-00962.1983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Flock A, Cheung HC (1977) Actin filaments in sensory hairs of inner ear receptor cells. J Cell Biol 75(2 Pt 1):339–343. 10.1083/jcb.75.2.339 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Beurg M, Fettiplace R, Nam JH, Ricci AJ (2009) Localization of inner hair cell mechanotransducer channels using high-speed calcium imaging. Nat Neurosci 12(5):553–558. 10.1038/nn.2295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Marcotti W (2012) Functional assembly of mammalian cochlear hair cells. Exp Physiol 97(4):438–451. 10.1113/expphysiol.2011.059303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cunningham CL, Müller U (2019) Molecular structure of the hair cell mechanoelectrical transduction complex. Cold Spring Harb Perspect Med 9(5). 10.1101/cshperspect.a033167 [DOI] [PMC free article] [PubMed]
  • 10.Haddon C, Lewis J (1996) Early ear development in the embryo of the zebrafish. Danio rerio J Comp Neurol 365(1):113–128. 10.1002/(sici)1096-9861(19960129)365:1%3c113::Aid-cne9%3e3.0.Co;2-6 [DOI] [PubMed] [Google Scholar]
  • 11.Metcalfe WK, Kimmel CB, Schabtach E (1985) Anatomy of the posterior lateral line system in young larvae of the zebrafish. J Comp Neurol 233(3):377–389. 10.1002/cne.902330307 [DOI] [PubMed] [Google Scholar]
  • 12.Van Trump WJ, McHenry MJ (2008) The morphology and mechanical sensitivity of lateral line receptors in zebrafish larvae (Danio rerio). J Exp Biol 211(Pt 13):2105–2115. 10.1242/jeb.016204 [DOI] [PubMed] [Google Scholar]
  • 13.Manuel R, Iglesias Gonzalez AB, Habicher J, Koning HK, Boije H (2021) Characterization of Individual Projections Reveal That Neuromasts of the Zebrafish Lateral Line are Innervated by Multiple Inhibitory Efferent Cells. Front Neuroanat 15:666109. 10.3389/fnana.2021.666109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dijkgraaf S (1963) The functioning and significance of the lateral-line organs. Biol Rev Camb Philos Soc 38:51–105. 10.1111/j.1469-185x.1963.tb00654.x [DOI] [PubMed] [Google Scholar]
  • 15.Thomas ED, Cruz IA, Hailey DW, Raible DW (2015) There and back again: development and regeneration of the zebrafish lateral line system. Wiley Interdiscip Rev Dev Biol 4(1):1–16. 10.1002/wdev.160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Pickett SB, Raible DW (2019) Water Waves to Sound Waves: Using Zebrafish to Explore Hair Cell Biology. J Assoc Res Otolaryngol 20(1):1–19. 10.1007/s10162-018-00711-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pisano GC, Mason SM, Dhliwayo N, Intine RV, Sarras MP, Jr. (2014) An assay for lateral line regeneration in adult zebrafish. J Vis Exp (86). 10.3791/51343. [DOI] [PMC free article] [PubMed]
  • 18.Gale JE, Marcotti W, Kennedy HJ, Kros CJ, Richardson GP (2001) FM1-43 dye behaves as a permeant blocker of the hair-cell mechanotransducer channel. J Neurosci 21(18):7013–7025. 10.1523/jneurosci.21-18-07013.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Venuto A, Smith C, Cameron-Pack M, Erickson T (2022) Alone in a crowd: effect of a nonfunctional lateral line on expression of the social hormone parathyroid hormone 2. Biol Open 11(10):bio059432. 10.1242/bio.059432 [DOI] [PMC free article] [PubMed]
  • 20.Santos F, MacDonald G, Rubel EW, Raible DW (2006) Lateral line hair cell maturation is a determinant of aminoglycoside susceptibility in zebrafish (Danio rerio). Hear Res 213(1):25–33. 10.1016/j.heares.2005.12.009 [DOI] [PubMed] [Google Scholar]
  • 21.Amaral E, Guatimosim S, Guatimosim C (2011) Using the fluorescent styryl dye FM1-43 to visualize synaptic vesicles exocytosis and endocytosis in motor nerve terminals. Methods Mol Biol 689:137–148. 10.1007/978-1-60761-950-5_8 [DOI] [PubMed] [Google Scholar]
  • 22.Brumback AC, Lieber JL, Angleson JK, Betz WJ (2004) Using FM1-43 to study neuropeptide granule dynamics and exocytosis. Methods 33(4):287–294. 10.1016/j.ymeth.2004.01.002 [DOI] [PubMed] [Google Scholar]
  • 23.Nishikawa S, Sasaki F (1996) Internalization of styryl dye FM1-43 in the hair cells of lateral line organs in Xenopus larvae. J Histochem Cytochem 44(7):733–741. 10.1177/44.7.8675994 [DOI] [PubMed] [Google Scholar]
  • 24.Vélez-Ortega AC, Freeman MJ, Indzhykulian AA, Grossheim JM, Frolenkov GI (2017) Mechanotransduction current is essential for stability of the transducing stereocilia in mammalian auditory hair cells. eLife 6:e24661. 10.7554/eLife.24661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Majumder P, Moore PA, Richardson GP, Gale JE (2017) Protecting mammalian hair cells from aminoglycoside-toxicity: assessing phenoxybenzamine’s potential. Front Cell Neurosci 11. 10.3389/fncel.2017.00094 [DOI] [PMC free article] [PubMed]
  • 26.Brown AD, Mussen TD, Sisneros JA, Coffin AB (2011) Reevaluating the use of aminoglycoside antibiotics in behavioral studies of the lateral line. Hear Res 272(1–2):1–4. 10.1016/j.heares.2010.10.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hudson AM, Lockard GM, Namjoshi OA, Wilson JW, Kindt KS, Blough BE et al (2020) Berbamine Analogs Exhibit Differential Protective Effects From Aminoglycoside-Induced Hair Cell Death. Front Cell Neurosci 14:234. 10.3389/fncel.2020.00234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kruger M, Boney R, Ordoobadi AJ, Sommers TF, Trapani JG, Coffin AB (2016) Natural Bizbenzoquinoline Derivatives Protect Zebrafish Lateral Line Sensory Hair Cells from Aminoglycoside Toxicity. Front Cell Neurosci 10:83. 10.3389/fncel.2016.00083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Fujisawa S, Romin Y, Barlas A, Petrovic LM, Turkekul M, Fan N et al (2014) Evaluation of YO-PRO-1 as an early marker of apoptosis following radiofrequency ablation of colon cancer liver metastases. Cytotechnology 66(2):259–273. 10.1007/s10616-013-9565-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Jensen KH, Rekling JC (2010) Development of a no-wash assay for mitochondrial membrane potential using the styryl dye DASPEI. J Biomol Screen 15(9):1071–1081. 10.1177/1087057110376834 [DOI] [PubMed] [Google Scholar]
  • 31.Bereiter-Hahn J (1976) Dimethylaminostyrylmethylpyridiniumiodine (DASPMI) as a fluorescent probe for mitochondria in situ. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 423(1):1–14. 10.1016/0005-2728(76)90096-7 [DOI] [PubMed]
  • 32.Michel AD, Kaur R, Chessell IP, Humphrey PP (2000) Antagonist effects on human P2X(7) receptor-mediated cellular accumulation of YO-PRO-1. Br J Pharmacol. 130(3):513–20. 10.1038/sj.bjp.0703368. [DOI] [PMC free article] [PubMed]
  • 33.Rassendren F, Buell GN, Virginio C, Collo G, North RA, Surprenant A (1997) The Permeabilizing ATP Receptor, P2X7: cloning and expression of a human cDNA. J Biol Chem 272(9):5482–5486. 10.1074/jbc.272.9.5482 [DOI] [PubMed] [Google Scholar]
  • 34.Seiler C, Nicolson T (1999) Defective calmodulin-dependent rapid apical endocytosis in zebrafish sensory hair cell mutants. J Neurobiol 41(3):424–434 [PubMed] [Google Scholar]
  • 35.Kazmierczak P, Sakaguchi H, Tokita J, Wilson-Kubalek EM, Milligan RA, Müller U et al (2007) Cadherin 23 and protocadherin 15 interact to form tip-link filaments in sensory hair cells. Nature 449(7158):87–91. 10.1038/nature06091 [DOI] [PubMed] [Google Scholar]
  • 36.Ernest S, Rauch GJ, Haffter P, Geisler R, Petit C, Nicolson T (2000) Mariner is defective in myosin VIIA: a zebrafish model for human hereditary deafness. Hum Mol Genet 9(14):2189–2196. 10.1093/hmg/9.14.2189 [DOI] [PubMed] [Google Scholar]
  • 37.Jiang LH, Mackenzie AB, North RA, Surprenant A (2000) Brilliant blue G selectively blocks ATP-gated rat P2X(7) receptors. Mol Pharmacol 58(1):82–88 [PubMed] [Google Scholar]
  • 38.Monette MM, Evans DL, Krunkosky T, Camus A, Jaso-Friedmann L (2015) Nonspecific cytotoxic cell antimicrobial protein (NCAMP-1): a novel alarmin ligand identified in zebrafish. PLoS ONE 10(2):e0116576. 10.1371/journal.pone.0116576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ogryzko NV, Hoggett EE, Solaymani-Kohal S, Tazzyman S, Chico TJA, Renshaw SA et al (2014) Zebrafish tissue injury causes upregulation of interleukin-1 and caspase-dependent amplification of the inflammatory response. Dis Model Mech 7(2):259–264. 10.1242/dmm.013029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Cruz FF, Leite CE, Pereira TCB, Bogo MR, Bonan CD, Battastini AMO et al (2013) Assessment of mercury chloride-induced toxicity and the relevance of P2X7 receptor activation in zebrafish larvae. Comp Biochem Physiol C: Toxicol Pharmacol 158(3):159–164. 10.1016/j.cbpc.2013.07.003 [DOI] [PubMed] [Google Scholar]
  • 41.Medrano MP, Pisera-Fuster A, Bernabeu RO, Faillace MP (2020) P2X7 and A(2A) receptor endogenous activation protects against neuronal death caused by CoCl(2) -induced photoreceptor toxicity in the zebrafish retina. J Comp Neurol 528(12):2000–2020. 10.1002/cne.24869 [DOI] [PubMed] [Google Scholar]
  • 42.Ermakov YA, Kamaraju K, Sengupta K, Sukharev S (2010) Gadolinium ions block mechanosensitive channels by altering the packing and lateral pressure of anionic lipids. Biophys J 98(6):1018–1027. 10.1016/j.bpj.2009.11.044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Piarulli S, Riedel JA, Fossum FN, Kermen F, Hansen BH, Kvæstad B et al (2024) Effects of gadolinium (Gd) and a Gd-based contrast agent (GBCA) on early life stages of zebrafish (Danio rerio). Chemosphere 350:140950. 10.1016/j.chemosphere.2023.140950 [DOI] [PubMed] [Google Scholar]
  • 44.Nüsslein-Volhard C, Dahm R (2002) Zebrafish: a practical approach. The practical approach serices, vol 261. Oxford University Press,  Oxford and New York
  • 45.Varshney GK, Carrington B, Pei W, Bishop K, Chen Z, Fan C et al (2016) A high-throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish. Nat Protoc 11(12):2357–2375. 10.1038/nprot.2016.141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Varshney GK, Pei W, LaFave MC, Idol J, Xu L, Gallardo V et al (2015) High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res 25(7):1030–1042. 10.1101/gr.186379.114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Petree C, Varshney GK (2020) MultiFRAGing: Rapid and Simultaneous Genotyping of Multiple Alleles in a Single Reaction. Sci Rep 10(1):3172. 10.1038/s41598-020-59986-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Lin SJ, Vona B, Barbalho PG, Kaiyrzhanov R, Maroofian R, Petree C et al (2021) Biallelic variants in KARS1 are associated with neurodevelopmental disorders and hearing loss recapitulated by the knockout zebrafish. Genet Med 23(10):1933–1943. 10.1038/s41436-021-01239-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Harris JA, Cheng AG, Cunningham LL, MacDonald G, Raible DW, Rubel EW (2003) Neomycin-Induced Hair Cell Death and Rapid Regeneration in the Lateral Line of Zebrafish (Danio rerio). J Assoc Res Otolaryngol 4(2):219–234. 10.1007/s10162-002-3022-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Uribe PM, Villapando BK, Lawton KJ, Fang Z, Gritsenko D, Bhandiwad A, et al (2018) Larval zebrafish lateral line as a model for acoustic trauma. eNeuro 5(4). 10.1523/eneuro.0206-18.2018 [DOI] [PMC free article] [PubMed]
  • 51.Fitzpatrick M (2014) Measuring cell fluorescence using ImageJ. https://theolb.readthedocs.io/en/latest/imaging/measuring-cell-fluorescence-using-imagej.html. Accessed 4 Oct 2024
  • 52.Alcaino C, Knutson K, Gottlieb PA, Farrugia G, Beyder A (2017) Mechanosensitive ion channel Piezo2 is inhibited by D-GsMTx4. Channels (Austin) 11(3):245–253. 10.1080/19336950.2017.1279370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kimitsuki T, Nakagawa T, Hisashi K, Komune S, Komiyama S (1996) Gadolinium blocks mechano-electric transducer current in chick cochlear hair cells. Hear Res 101(1–2):75–80. 10.1016/s0378-5955(96)00134-7 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Data will be made available upon request.


Articles from JARO: Journal of the Association for Research in Otolaryngology are provided here courtesy of Springer

RESOURCES