Dataset on ITS and some chloroplast DNA regions of Boehmeria holosericea Blume in Vietnam

Abstract

Species of the Boehmeria genus have the potential to be natural medicines and have industrial fibre production uses. Many species of this genus are morphologically similar and are difficult to distinguish, especially when their morphology is distorted. This dataset includes sequence information of several DNA regions isolated from the genome of Boehmeria holosericea, namely ITS (from the nuclear genome), matK, trnL-trnF, trnH-psbA, and rpoC1 (from the chloroplast genome) and phylogenetic analysis results based on the isolated sequences. On the phylogenetic tree based on the matK gene sequence, B. holosericea is grouped with B. umbrosa, B. clidemioides, B. spicata, and B. macrophylla with a bootstrap coefficient of 100%. In the phylogenetic tree based on the trnH-psbA spacer region sequences, B. holosericea was grouped with B. clidemioides (a bootstrap coefficient of 96%). In the phylogenetic tree based on the rpoC1 gene sequences, B. holosericea was grouped with B. spicata (a bootstrap coefficient of 100%). In the phylogenetic tree based on the ITS region sequences, B. holosericea was grouped with B. macrophylla (a bootstrap coefficient of 73%), and based on the trnL-trnF spacer region, B. holosericea was grouped with B. pilociuscula (a bootstrap coefficient of 16%). Two genes, matK and rpoC1 and the trnH-psbA region from the chloroplast genome, are potential DNA barcode candidates that could aid in the species identification of B. holosericea. This dataset the first report on the ITS, matK, trnL-trnF, trnH-psbA, and rpoC1 sequences and the phylogeny of B. holosericea.

Specifications Table

Subject	Biological Sciences
Specific subject area	Biotechnology, Genetics diversity, Molecular Phylogenetics, Evolution
Type of data	Raw, sequence data, tables, figures, text files
Data collection	Nucleotide sequence data of DNA regions were sequenced using an ABI 3130xL 16 capillary sequencer.
Data source location	Faculty of Biology, Thai Nguyen University of Education, Thai Nguyen city, Vietnam
Data accessibility	Repository name: Mendeley Data Data identification number: 10.17632/vpgrxp346v.2 Direct URL to data: https://data.mendeley.com/datasets/vpgrxp346v/2

1. Value of the Data

• •Boehmeria holosericea is a source of natural fibres for the textile industry and is a plant species of research interest to find new biologically active substances.
• •Many species of the Boehmeria genus have similar morphology and are difficult to distinguish, especially when the sample is deformed. So, a dataset of ITS region sequences and some chloroplast DNA regions can be used as molecular markers to support species identification.
• •The data set of ITS region sequences and some chloroplast DNA regions (matK, trnL-trnF, trnH-psbA, rpoC1) is the basis for phylogenetic analysis and molecular evolution of the Boehmeria genus.

2. Background

Boehmeria, comprising 51 species [1], is a genus with potential as a natural medicine and has industrial fibre production uses [2]. Boehmeria nivea, a perennial herbaceous plant, is cultivated as a fibre crop in many countries, including China, Japan, Thailand, the Philippines, India, and Korea. The leaves of Boehmeria nivea are rich in cellulose, polyphenols, vitamin C, and minerals and have anti-inflammatory, antioxidant, anti-colitis, and anti-diabetic effects [3,4]. Boehmeria holosericea was initially evaluated to contain many alkaloids and have cytotoxic activity against cancer cells [5]. Some species of the Boehmeria genus are very similar in morphology, particularly when the plant morphology is deformed or in powder form, making species identification difficult. Therefore, molecular data sets, including some potential DNA markers, are necessary to support species identification in the above cases.

DNA barcoding is a useful molecular tool that can rapidly and accurately aid species identification using standardized DNA markers [6,7]. Among the DNA barcodes used in species identification are the ITS region and some chloroplast DNA regions. The ITS and matK regions are listed as core plant barcodes in species identification [8,9]. The ITS marker is an ideal DNA barcode that has been shown to be robust in most seed plant species [10]. Currently, GenBank has data on ITS sequences isolated from some species of the Boehmeria genus. However, no publication has been found on ITS region data and some chloroplast DNA sequences of the species B. holosericea.

3. Data Description

The B. holosericea samples (Voucher BOE202405SL) were collected in May 2024 at Ang Ung village, Chieng Ban commune, Mai Son district, Son La province, Vietnam, in the coordinates of 21°13′49.8″ N 103°57′38.3″ E (Fig. 1). The ITS region of the nuclear genome, the matK gene, the rpoC1 gene, and two regions trnL-trnF, trnH-psbA were selected for amplification from DNA extracted from B. holosericea leaves by PCR with primer pairs with nucleotide sequences as shown in Table 1. The DNA bands of the ITS region, matK, trnL-trnF, trnH-psbA, and rpoC1 on gel electrophoresis had estimated sizes of approximately 0.65 kb, 1.2 kb, 0.85 kb, 0.45 kb, and 0.5 kb, respectively (Fig. 2).

Fig. 1.

The B. holosericea samples (Voucher BOE202405SL). A: Upper surface of leaves; B: Lower surface of leaves.

Table 1.

Nucleotide sequences of PCR primers amplifying the ITS, matK, trnL-trnF, : trnH-psbA, rpoC1 regions [6,7].

Primers	Sequence (5′—3′)	Length (bp)
ITS_F	TCCGTAGGTGAACCTGCGG	19
ITS_R	TCCTCCGCTTATTGATATGC	20
matK_F	CGATCTATTCATTCAATATTTC	22
matK_R	TCTAGCACACGAAAGTCGAAGT	22
trnL-trnF_F	CGAAATCGGTAGACGCTACG	20
trnL-trnF_R	ATTTGAACTGGTGACACGAG	20
trnH-psbA-F	GTTATGCATGAACGTAATGCTC	22
trnH-psbA-R	CGCGCATGGTGGATTCACAATCC	23
rpoC1_F	GGCAAAGAGGGAAGATTTCG	20
rpoC1_R	CCATAAGCATATCTTGAGTTGG	22

Fig. 2.

Electrophoresis gel is showing amplification by PCR in the ITS region, and some chloroplast DNA sequences are from B. holosericea. Lane M: DNA ladder; lane 1: ITS region; lane 2: matK gene; lane 3: trnL-trnF; lane 4: trnH-psbA; lane 5: rpoC1 gene.

The PCR products were purified and nucleotide sequenced, obtaining the sequences of the ITS region, matK, trnL-trnF, trnH-psbA, and rpoC1 with sizes of 659 bp, 1219 bp, 840 bp, 427 bp, 523 bp, respectively. The nucleotide sequences of ITS, matK, trnL-trnF, trnH-psbA, and rpoC1 have been published in Mendeley Data [11] and are presented in Table 2. These sequences were selected for molecular evolutionary analysis and phylogenetic tree construction. In the phylogenetic tree based on the matK gene sequence, B. holosericea is distributed in the same group as B. umbrosa, B. clidemioides, B. spicata, and B. macrophylla with a bootstrap coefficient of 100% (Fig. 3). In the phylogenetic tree based on the trnH-psbA spacer region sequence, B. holosericea was distributed in the same group as B. clidemioides with a bootstrap coefficient of 96% (Fig.4). In the phylogenetic tree based on the rpoC1 gene sequence, B. holosericea was distributed in the same group as B. spicata with a bootstrap coefficient of 100% (Fig. 5). However, in the phylogenetic tree based on the ITS region (Fig. 6) and the trnL-trnF region sequences (Fig.7), B. holosericea was grouped with B. macrophylla with a bootstrap coefficient of 73% (for ITS) and B. pilociuscula with a bootstrap coefficient of 16% (for trnL-trnF).

Table 2.

Characterization of ITS, matK, trnL-trnF, trnH-psbA, and rpoC1 sequences isolated from the Boehmeria holosericea genome.

DNA regions	Sequence length (bp)	Sequence
ITS	659	GTAGGGTAACCTGCGGAAGGATCATTGTCGTAACCTGCCTAGCAGAACAACCCGTGAACACGTGCTTCTATCAAACTCGGGGCGCGTTTTTGGGTCCCTTTGGGACCCCGAGACCCGCCTCGCGTCGGGGCCCCCCGACCATAAACCAAAACTCGGGCGCGGTATGCGCCAAGGAAACGTGAGAAGGTCGCTACTTTAACAGAGCGTCGCAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTCGCCCCCACTCCACTCCGGTGCTTTCCCGGCCGGCGGTGTGGGGCGGATAATGGCCTCCCGTACGCTTGCCGCGCGGTTGGCCCAAAAATGAGTCCCCGGCTTCGTTTGCCGCGACATTCGGTGGTCGTCGATTACTCGGTGTCCCGTCGTGCGTGCGGCCGGAGGGCTCGCTGGAAAGACCCTTGTGGCCCGTCGGTGGACCCCCACTGATGCGCCTTCTAAGCGACCCCAGGTCAGGCGGGGATACCCGCTGAGTTTAAGCATATCAATAAGTCGGAGGA
matK	1219	GAATTTTTCTTTACGAGTATTATAATTATAATTGTAATAGTCTTATTGTTCTTCTAAATAACTATATTACTATTTTTTCAAAAAGTAATACAAGATTTTTCTTGTTCCTGTATAATTCTCATCTTTGTGAATACGAATCCATCTTACTTTTTCTATGCAATAAATCTTCTCATTTACGATTAACAGTTTCCGGTGTCTTTTTTGAGCGAATATATTTCTATGGAAAAACAAAGCCTCCCGTAGAAGACGTCTTTGCTAATGATTTTTTGATTAGCCTATGGTTTCTCCAGGATCTCTTTATGCATTATGTTAGATATCAAGGAAAATCAATTCTTGCTTTAAAGGATATGCCCCTTTTGATAAATAAATGGAAATATTTTTTTGTACATTTATGGCAATATAATTTTTATGTGTGGTCTCAATCAGGAAGGGTGTATATAAACCAATTATGTAAGCGTTCCCTTGTCTTTTTGGGTTATCTTTCAAGTATGCGAATAAATCTTTCAGTTGTACGAACCCAAATGCTAGAAAATTCATTTATAACGGATAATGCTATCAAGAAGATTGATACATTAATTCCAATTAGTCCTATGATTGCATCATTGGCTAAAATGAAATTTTCTAACGTATTAGGATATCCCGTTAGTAAGTTGACCTGGGTCGATTTATCGGATTTTGGTATTATTGATCGATTTGTGCGTATATGCAGAAATCTTTTTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCAAGTAAAATATATACTTCGACTTTCTTGTCTTAAAACTTTGGCTCGGAAACACAAAAGTTCTGTCCGGACGTTTTTGAAAAGATTCGGTTCGGAATTATTGGCCGAATTCTTTACGGAAGAAGAAGGGGTTCTTTCTTTTATTTTTCCAAAAATTTATTTTAGTTTTCGAAGGTTATATAAAAAGCGAATTTGGTATTTGGATATTTGTTGCATAAATGATATGGTCAATCATGAATGATTGTTTATGCAACCCTGGAAATTGAAATTTCCTTTACTTTAAAGGATGACCAGATAACAAAAAAAATTCAATTTTTTTGTTTTTATGAAATGTTCATGCAATCAGGGTTGATCAACAGATTATTCAAAGTCCTGTCTAGGAACGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGCGATTTTT
trnL-trnF	840	TACCGAGTGATAACTTTCAAATTCAGAGAAACCCGGGAATTAAAAATGGGCAATCCTGAGCCAAATCCGTGTTTATGAAAACAAAGAAGGGTTCGGAAAGTGGTAAAAAAAAATAAAGGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACAAATGGAGTTGGCTACTTTGCGTTAGTAGTTAGTAAAGGAATCCTTCCATTGAAACTCCAGAAAGGATGAAGAATAAATGTATATAGGTACGGAAATACTATCTCCAAATAATTAATTACAACCCGAATTCGTATTTCTTTTAATTTTCATGAAAATTAAAAGAATTCTTGTGAATAAATTCTAAGTTGAAAAAAGATATCAAATCACTTCTTCCATCAAAATCTGATAGATTTTTTGAAGAAGTGATTAATCGTACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAATGCCCATTTGATTCCCGATTAATCGTACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAATGCCCATTTGATTCTAATTATTTATCCTATCTTCTCAGTTAATTAGCAGTTCAAAATTCGTCATGTTTCTCGGTCATTCTGAACGGAAATTTTTTCTTATCAAAAGATTTGTGATATATATGAAAAACGTACAAATGAACATGTTTGAGAAAGGAATCCTAATATTAAATATGAATAATTAATAATTCATTTAATTATTCATATTTTACTGAAGTAATCCCCCTTTCGTTTTTCTTTTTAATTGACATAGACCCAAGTCTTCTATTAAAATAAAATGAGGATGGTACGTCATCAATGGTCGGGATAGCT
trnH-psbA	427	GAACGTAATGCTCATAATTTCCCTCTAGACCTAGCTGCGGTAGAAGTTCCATCTACAAATGGATAATACTTTTATATTAGTGTATACAATTTCGTGAAAATAAAGGGGCACTACTAAACTTCTTTTAATAAAAAGTTTAGTAGTGCTCCTTAATTTTGTTTTTCTTAAATATTATTTAAATATTATTCTTTTTTTTTTTAAAAAGGATTAAAAAACAAAACTTTAATTTTCTAGATTCAAGTATTATATCAAGTAATATAGATATTAAATTTCTATAAATTTACTTTATATTTATAGTATTCTATATTTATAGTATTCTATATTTATAGTATACTATATTTATAAAATAATATAAATATAACTATAGTATTCATATTTATAGTATTCTAAGGGCGGATGTAGCCAAGTGGATTAAGGCAGTGGATTG
rpoC1	523	ATTCTTGAGTTGGCAAAGAAGGAAGATTTCGTGAGACTGTACTTGGCAAACGGGTTGATTATTCGGGACGTTCTGTGATTGTCGTAGGCCCTTCACTTTCATTACATCGATGTGGATTGCCTCGGGAAATTGCAATAGAACTTTTTCAGACACTTGTTATTCGTGGTTTAATTAGACAACATTTTGCTTCGAATATAGGAGTTGCTAAGAGTAAAATTCGGGAAAAAGATCCGGTTGTATGGGAAATACTTCAGGAAGTTATGCAAGGGCATCCCGTATTGCTGAATAGGGCCCCCACTTTGCATAGATTAGGCATACAAGGTTTCCAACCCATTTTAGTAGAAGGACATTCTATTTGTTTACACCCATTAGTTTGTAAGGGATTCAACGCAGACTTTGATGGGGATCAAATGGCTGTTCATGTACCTTTATCTTTAGAAGCTCAAGCAGAGGCTCGTTTACTTATGTTTTCTCATACGAATCTTTTGTCTCCGGCTATTGGGGAGCCCATTTCTGTACCAAC

Fig. 3.

Phylogenetic tree construction using the matK gene of B. holosericea and of other species belongs the Urticaceae family.

Fig. 4.

Phylogenetic tree construction using the trnH-psbA spacer region of B. holosericea and of other species belongs the Urticaceae family.

Fig. 5.

Phylogenetic tree construction using the rpoC1 gene of B. holosericea and of other species belongs the Urticaceae family.

Fig. 6.

Phylogenetic tree construction using the ITS region of Boehmeria holosericea and of other species belongs the Urticaceae family.

Fig. 7.

Phylogenetic tree construction using the trnL-trnF spacer region of Boehmeria holosericea and of other species belongs the Urticaceae family.

4. Experimental Design, Materials and Methods

4.1. Sample collection and data source creation for analysis

The B. holosericea sample (Voucher BOE202405SL) was identified by comparative morphological methods at the Botany Department in the Faculty of Biology, Thai Nguyen University of Education. The voucher specimens were placed in the Herbarium of the Department of Biology, Thai Nguyen University of Education, Vietnam. The DNA regions of other species belonging to the Urticaceae family were obtained by a Basic Local Alignment Search Tool (BLAST) search on the National Center For Biotechnology Information (NCBI) [12].

4.2. Phylogenetic analysis

Molecular evolution analysis was performed using the Maximum Likelihood method in MEGA v11.0.13 [13]. A phylogenetic tree was constructed based on the sequences of DNA regions isolated from the B. holosericea genome (ITS, matK, trnL-trnF, trnH-psbA, and rpoC1) using the Tamura-Nei model [14]. A bootstrap consensus tree derived from 1000 replicates [15] was used to represent the evolutionary history of the analyzed species.

Limitations

None.

Ethics Statement

The authors have read and followed the ethical requirements for publication in Data in Brief and confirmed that the current work does not involve human subjects, animal experiments, or any data collected from social media platforms.

CRediT Author Statement

Quan Huu Nguyen: Conceptualization, Collect samples, Data analysis, Writing manuscript; Trinh Van Nguyen, Thuy Thi Xuan Vi and Tan Quang Tu: Collect samples, Search for data, Data curation; Thuy Thi Thu Vu, Lan Thi Ngoc Nguyen, Yen Thi Hai Nguyen and Hung Duc Nguyen: Search for data, Data analysis, writing – original draft preparation; Mau Hoang Chu: Conceptualization, Methodology, Supervision, Review and Editing of the manuscript.

Data Availability

• Mendeley DataSequence data of the ITS region and the matK, rpoC1, trnL-trnF, and trnH-psbA gene regions (Original data).