Extracellular vesicle miR-206 improves chronic binge alcohol-mediated decreased myoblast differentiation in SIV-infected female macaques

Abstract

Alcohol misuse in people with human immunodeficiency virus (HIV) (PWH) and chronic binge alcohol (CBA) administration in simian immunodeficiency virus (SIV)-infected macaques are associated with increased physical frailty and impaired functional skeletal muscle mass, respectively. Previous studies by our group demonstrate that muscle-enriched microRNAs (myomiRs) are differentially expressed in skeletal muscle (SKM) from CBA-administered SIV-infected male macaques and their altered expression contributes to impaired differentiation of SKM stem cells or myoblasts. MicroRNAs can be transported in extracellular vesicles (EVs) to mediate numerous cellular responses through intercellular communication. The present study tested the hypothesis that EV-mediated delivery of miR-206 can ameliorate CBA-mediated decreases in myoblast differentiation. Myoblasts were isolated from SKM of female SIV-infected, antiretroviral therapy-treated macaques that received either CBA (2.5 g/kg/day, CBA/SIV) or water (VEH/SIV) for 14.5 mo. Myotube and myotube-derived EV myomiR expression, including miR-206, was lower in the CBA/SIV group. Overexpression of miR-206 decreased histone deacetylase 4 (HDAC4) and paired box 7 (PAX7) expression in myotubes and increased fusion index, a differentiation index, in CBA/SIV-derived myotubes. Similarly, EV-mediated delivery of miR-206 increased both fusion index and myotube density of CBA/SIV-derived myoblasts. These results support the potential therapeutic utility of EVs in delivering myomiRs to improve SKM stem cell differentiation.

NEW & NOTEWORTHY Alcohol decreases skeletal muscle myoblast differentiation into myotubes, which is associated with decreased expression of microRNA-206. We show that delivering exogenous miR-206 in plasma-derived extracellular vesicles (EVs) to myoblasts derived from alcohol-administered animals increases myotube differentiation. These results support the potential therapeutic utility of EVs in delivering muscle-enriched microRNAs to improve skeletal muscle stem cell differentiation.

INTRODUCTION

Skeletal muscle wasting remains a strong independent predictor of mortality among people with human immunodeficiency virus (HIV) (PWH), despite effective antiretroviral therapy (ART) (1, 2). Clinical studies by the Comprehensive Alcohol-HIV/AIDS Research Center (CARC) show that among PWH in the New Orleans Alcohol Use in HIV (NOAH) study, higher fat-free mass index is associated with reduced risk of frailty (3). Alcohol misuse is more prevalent among PWH compared to the general population (4–6), and lifetime alcohol use is associated with frailty in the NOAH study (7). Preclinical studies by CARC show that chronic binge alcohol (CBA) decreases skeletal muscle (SKM) mass in male macaques at end-stage simian immunodeficiency virus (SIV) infection (8). Thus, both alcohol misuse and HIV contribute to the development of SKM myopathy, or a reduction in functional SKM mass.

One mechanism that contributes to alcohol-induced decreases in functional SKM mass in SIV infection is impaired myoblast differentiation (9, 10). Previous work from our group has identified a mechanistic role for microRNA (miR)-206. We reported downregulation of miR-206 in SKM and in circulation in SIV-infected male macaques and demonstrated that miR-206 inhibition in primary macaque myoblasts impairs myogenic differentiation (10). These data suggest that miR-206 could potentially be used to increase myoblast differentiation. One potential mechanism for miR-206 to improve myoblast differentiation is by inhibiting histone deacetylase 4 (HDAC4) expression (10, 11). We have previously demonstrated that miR-206 directly binds to the 3′-untranslated region (UTR) of rhesus macaque HDAC4 mRNA, using a luciferase reporter assay (10). HDAC4 expression upregulates myocyte enhancing factor 2 C (MEF2C) (12), a transcription factor important for myogenesis. Another mechanism for miR-206 to improve myoblast differentiation is by inhibiting paired box protein 7 (PAX7) expression (13, 14), because PAX7 downregulation is important for exiting the cell cycle and promoting myogenesis (13). miR-206 targets PAX7 UTR and decreases PAX7 protein expression (13). The present study sought to examine whether miR-206 can improve myoblast differentiation by downregulating HDAC4 and PAX7 expression.

There is emerging interest in using muscle-enriched microRNAs (myomiRs) as therapeutics in muscle-related diseases such as motor neuron diseases (15, 16) or age-related muscle disorders (17). Previous studies suggest a potential role for using myomiRs as a therapeutic for alcohol-induced myopathy. However, there are challenges in using miRs or other RNA oligonucleotides as therapeutics, including degradation by nucleases in circulation, activation of innate immune response, poor cell membrane penetration, and poor targeted delivery (18). Nanoparticle-based delivery of miRs to target cells and tissues aims to reduce required dose and systemic side effects while increasing efficacy (19). Extracellular vesicles (EVs) are autologous nanoparticles that we hypothesize could be used for effective delivery of miRs to SKM cells.

EVs mediate cellular changes in numerous pathological and physiological states (20–22). These nanometer-sized vesicles are bound by a lipid bilayer and can act as delivery vehicles for bioactive cargo such as miRs, proteins, RNAs, and lipids to alter recipient cell function (23, 24). Alcohol alters the EV miR cargo in hepatocytes (25), monocytes (26, 27), and neural stem cells (28, 29). Additionally, CBA/SIV alters microRNA cargo of adipocyte- and myotube-derived EVs compared to water (VEH)/SIV-derived cells (30).

Based on our recently published data showing that CBA decreases the differentiation potential of myoblasts derived from SIV-infected female rhesus macaques to form myotubes (9), we investigated whether CBA downregulated myomiRs in myotubes and whether increasing miR-206 expression improves myoblast differentiation. Additionally, we tested the hypothesis that EV-mediated delivery of exogenous miR-206 can ameliorate CBA-mediated decreases in myoblast differentiation.

METHODS

Animal Study Design

The Institutional Animal Care and Use Committee (IACUC) at Louisiana State University Health Sciences Center (New Orleans, LA) approved the animal study design. The study adhered to the National Institutes of Health guidelines for the care and use of animals in research. Female rhesus macaques (Macaca mulatta) ages 6–9 yr received CBA (13–14 g of ethanol per kg of body mass per week) or VEH (isovolumetric water) through a gastric catheter. After 3 mo of CBA or VEH administration macaques were vaginally infected with simian immunodeficiency virus (SIV_mac251), and 2.5 mo later all macaques were treated with antiretroviral therapy (ART; 20 mg/kg of tenofovir and 30 mg/kg of emtricitabine; provided by Gilead Sciences, Inc.) for 9 mo. One month into ART administration, animals were ovariectomized or underwent a sham surgery (Sham) as part of the parent study. Macaques continued to receive CBA or VEH throughout the duration of the study (14.5 mo). Macaques were fasted and humanely euthanized 24 h after their last alcohol administration (blood alcohol level = 0 mM at the time of euthanasia). A subgroup of experimental animals (Sham only) was used in the studies outlined in this article. Findings from the larger parent study have been published (9, 31). SKM tissue from the vastus lateralis and plasma at the time of necropsy were collected for downstream experiments.

Cell Cultures

Primary myoblasts were isolated from vastus lateralis muscle within 2 h after euthanasia as previously described (9). Briefly, ∼30 mg of SKM was digested with 0.25% trypsin-EDTA (Gibco Cat. No. 25200056, ThermoFisher Scientific, Waltham, MA) diluted 1:4 in Ham’s F-12 culture medium (GE Healthcare Life Sciences Cat. No. SH30026.01) for two 1-h treatments. Cells were plated with growth medium [Ham’s F-12 medium with 10% FBS, 2% l-glutamine (Gibco Cat. No. 25030081), 1% penicillin-streptomycin (ThermoFisher, Waltham, MA), 0.25 μg/mL amphotericin B (ThermoFisher, Waltham, MA), and 2.5 ng/mL human fibroblast growth factor (R & D Systems, Minneapolis, MN)] and incubated at 37°C and 5% CO₂ overnight (16 h) to allow any fibroblasts to adhere to the plate. Nonadherent cells, media, and tissue were transferred to a fresh plate and left undisturbed for 1–2 wk until myoblast colonies began to form. Growth medium was replaced every 2 days until colonies were confluent (passage 0). Primary myoblasts from passage 4 were used for the present study.

For cell differentiation, myoblasts were proliferated for 2 days. Growth medium was then replaced with differentiation medium [OptiMEM medium with 2% horse serum (ThermoFisher, Waltham, MA), 2% l-glutamine, 1% penicillin-streptomycin, and 0.25 μg/mL amphotericin B], which was considered day 0 of differentiation, and cells were allowed to differentiate for 5 days. To determine the effects of transforming growth factor-β1 (TGF-β1) on myotube differentiation, control (naive) primary macaque myoblasts were differentiated with or without 2 ng/mL of TGF-β1 (Cat. No. 240B, RD Systems) and allowed to differentiate for 5 days.

EV Isolation

EVs were isolated from myotube cultures as previously described by our group (30). Myoblasts were plated at a density of 350,000 cells/10-cm plate, proliferated for 2 days, and switched to differentiation medium as described above. On day 3 of differentiation, cell medium was switched to serum-free differentiation medium (OptiMEM Reduced Serum Medium with 2% l-glutamine, 1% penicillin-streptomycin, and 0.25 μg/mL amphotericin B). After 48 h, supernatant was collected from three 10-cm plates (3–5 million cells) for each primary cell line. Supernatant was centrifuged at 2,000 g for 10 min and 15,500 g for 30 min at 4°C to remove unwanted debris. The supernatant was filtered through a 0.22-µm syringe filter (Whatman PVDF filter, Maidstone, UK) into polycarbonate tubes (Beckman Coulter, Brea, CA, Cat. No. 355618) and ultracentrifuged at 100,000 g for 1.5 h at 4°C (Ti-70 rotor, Optima L-80XP; Beckman Coulter, Brea, CA). Supernatant was discarded, leaving a 1-mL “pellet” in the tube. The pellet was pipette mixed, transferred to 1.5-mL ultracentrifuge tubes (Beckman Coulter, Cat. No. 356090), and ultracentrifuged at 100,000 g for 70 min at 4°C (Optima TLX; Beckman Coulter). Supernatant was removed, and the pellet was resuspended in 0.02-µm (Whatman Anotop Cat. No. WHA68091112)-filtered PBS (100 µL). EVs were used immediately after isolation or frozen at −80°C to measure myomiR expression.

To isolate EVs from plasma, 500 µL of plasma was centrifuged at 2,000 g for 10 min, 10,000 g for 30 min, and 20,000 g for 30 min at 4°C. The supernatant was mixed with 500 µL of PBS and filtered through a 0.22-µm PVDF syringe membrane. The filtrate was centrifuged at 100,000 g for 2 h at 4°C to concentrate the EVs. The supernatant was discarded, and the pellet was resuspended in 100 µL of PBS previously filtered through a 0.02-µm PVDF filter.

miR and Gene Expression

Total RNA was isolated from cells or EVs with the miRNeasy mini kit (Qiagen). For miR quantification, cDNA was synthesized from 10 ng of RNA (determined with a NanoDrop ND-1000 Spectrophotometer) and a master mix comprised of 0.15 μL 100 mM dNTP, 1 U multiScribe RT enzyme, 1.5 μL 10× RT buffer, 3.8 U RNase inhibitor, 1.16 μL nuclease-free water, and 6 µL 5× RT primer pool (cDNA Reverse Transcription Kit with RNase Inhibitor; Cat. No. 4374966, ThermoFisher Scientific). The RT primer pool consisted of four miRs of interest including the housekeeping U6 (Applied Biosystems, Waltham, MA). Small nuclear RNA U6 (abbreviated U6) is highly conserved across species (32) and has been shown to be a reliable endogenous miR control in SKM tissue (16). The reaction was carried out on a MyCycler (Bio-Rad Laboratories, Hercules, CA) at 16°C for 30 min, 42°C for 30 min, and 95°C for 5 min. miRs were quantified with TaqMan Universal PCR Master Mix II (ThermoFisher, Cat. No. 4440038). Each reaction was 20 μL and composed of 10 μL of master mix, 1 μL of the TaqMan Small RNA Assay, 7.7 μL of nuclease-free water, and 1.3 μL of cDNA. Quantitative polymerase chain reaction (qPCR)was performed on a CFX96 real-time PCR system (Bio-Rad Laboratories) at 50°C for 2 min, 95°C for 10 min, 95°C for 15 s, 60°C for 1 min and repeated 44 times and then heated to 95°C with 0.5°C decreases until 60°C for the melt curve used to ensure a single product. Each reaction was performed in duplicate. No-template controls, no-reverse transcriptase controls, and cell culture medium-only samples were run for each primer as controls. qPCR data were analyzed with the $2^{\mathrm{-}\Delta \Delta {\mathrm{C}}_{\mathrm{T}}}$ method (where C_T is threshold cycle).

For target gene expression, cDNA was synthesized from a known concentration of total mRNA for each sample with a reverse transcriptase kit (Qiagen, Cat. No. 330404, Hilden, Germany). With RT2 SYBR Green Fluorescent qPCR Mastermix (Qiagen, Cat. No. 330513) and specific primers [(Histone deacetylase 4 (HDAC4) and paired box 7 (PAX7) Integrated DNA Technologies; Coralville, IA], quantitative polymerase chain reactions (qPCRs) were performed with the CFX96 real-time PCR system (Bio-Rad). Ribosomal protein S13 (RPS13) was used as a housekeeping gene (33).

Primer sequences for miRs are found in Table 1 and those for genes are found in Table 2. miR and gene expression data are presented as fold change relative to control according to the $2^{\mathrm{-}\Delta \Delta {\mathrm{C}}_{\mathrm{T}}}$ method.

Table 1.

Applied Biosystems assay numbers and sequences for miRs

Assay Name	Assay Number	Mature miR Sequence
U6	001973	GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT
cel-miR-238	243546_mat	UGGAUGUUCUCGGACGUUCAAAGC
hsa-miR-133a-3p	2246	UUUGGUCCCCUUCAACCAGCUG
hsa-miR-133b	2247	UUUGGUCCCCUUCAACCAGCUA
hsa-miR-206	510	UGGAAUGUAAGGAAGUGUGUGG

Table 2.

Integrated DNA Technologies primer sequences for myogenic genes

Assay Name	Forward Primer	Reverse Primer
RPS13	TCTGACGACGTGAAGGAGCAGATT	TCTCTCAGGATCACACCGATTTGT
HDAC4	GGAGTGTCAACCTCCTATAAC	GTCTTTCGGCCACTTTCT
PAX7	TCCTGGAAGAAGGTGGTTGAATGC	CGTGTGCAGGTCTGGTTCAGTAA

miR Transfection

Cells were plated at a density of 100,000 cells per well in six-well collagen-coated plates (Corning, Life Sciences, St. Petersburg, FL, Cat. No. 356400) and proliferated for 2 days in growth medium at 37°C and 5% CO₂. Room temperature (RT) OptiMEM Reduced Serum Medium without any antibiotics was used to prepare miR mimics and transfection reagent. The transfection reagent Lipofectamine 2000 (Invitrogen, Cat. No. 11668-027) was mixed with culture medium at a 1-to-40 ratio, and 200 μL per well was used. A miR-206 mimic and a miR scramble that included a miR sequence from Caenorhabditis elegans confirmed to not have any cellular targets were used for cell transfection (Dharmacon, Horizon Discovery Biosciences, Cat. No. C300644-03-0020 and No. CN-001000-01-20, respectively, Waterbeach, UK). miR mimics were suspended in siRNA buffer (Dharmacon, Cat. No. B-002000-UB-100) to make a 20 μM stock solution. The mimics were mixed with culture medium so that 200 μL per well could be used. Equal volumes of the transfection reagent solution and mimic solution were pipette mixed to create a 10 μM solution of either miR mimic or miR scramble and incubated at RT for 20 min. Cell culture medium was aspirated from each well, and cells were washed with PBS. Antibiotic-free OptiMEM medium (1.6 mL) was added to each well (2 mL was added to nontransfected control wells). Transfection reagent/miR mimic solution (400 μL) was slowly added to each well with a dropwise approach. The cells were incubated in a humidified environment at 37°C and 5% CO₂ undisturbed for 2 days. Medium was changed every 2 days, and cells were allowed to differentiate for 5 days, where day 0 was considered the day of transfection.

Measuring Myoblast Differentiation

Myotubes were fixed in ice-cold methanol and stained, using HEMA-3 staining to determine indexes of differentiation as previously described (9). Briefly, images of the cells were captured on an Olympus BX51 microscope with an Olympus DP72 camera at ×20 magnification. ImageJ (NIH.gov) was used to count myotube and myoblast nuclei per frame. Cells were considered myotubes if the cell contained more than one nucleus. Myotube density values are the average number of myotubes per frame, and fusion index was calculated as the percentage of myotube nuclei to total nuclei.

Nanoparticle Tracking for EV Concentration and Size Distribution

Particle concentration and size distribution were measured by nanoparticle tracking analysis (NTA) with the NanoSight (NS300; Malvern, UK) as previously described (30). Briefly, EVs suspended in PBS were loaded into the NTA chamber. Measurements of size and number of particles were captured in triplicate over 60 s where the suspension was traveling over the frame at a speed of 35 µL/min. Between samples, the tubing was flushed with air, water, and then air again. Total particle concentration and size distribution were calculated by the NTA software (Malvern Analytical, Malvern, UK).

EV Uptake Visualization

Chambered coverslips (µ-Slide 4 Well, Ibidi, Cat. No. 80426, Fitchburg, WI) were coated with 5 µg/cm² of rat tail collagen 1 (ThermoFisher Scientific, Cat. No. A1048301) in 20 mM acetic acid before myoblast plating. The wells were coated at a high density (∼20,000 cells/well) to ensure cell adherence. The myoblasts were allowed to adhere and proliferate for 24 h before addition of stained EVs.

To visualize myoblast EV uptake, EVs were stained with the PKH67 Green Florescent Cell Linker Kit for General Cell Membrane Labeling (Cat. No. PKH67GL, Millipore Sigma, Burlington, MA) as suggested by the protocol. Briefly, freshly isolated EVs or PBS alone was stained with 6 μL of the PKH67 stain. After a 5-min incubation with stain, 500 μL of 1% BSA in PBS was added and ultracentrifuged at 100,000 g for 70 min at 4°C. The supernatant was discarded, and the pellet was resuspended in 500 μL of filtered PBS by gentle pipetting. To further remove the unbound dye, the solution was transferred to a 2-mL Amicon 10 kDa MWCO (molecular weight cutoff) filter column (Cat. No. UFC201024, Millipore Sigma), centrifuged at 3,000 g for 10 min, washed with medium, and centrifuged again at 3,000 g for 10 min. The stained EVs were resuspended in serum-free medium and added to the previously plated myoblast wells. After 16 h, the cells were washed carefully with PBS and fixed with fresh 4% paraformaldehyde (PFA) for 15 min. The nuclei of the myoblasts were stained with 10 μM DRAQ5 Fluorescent Probe Solution (Cat. No. 62251, ThermoFisher) for 30 min. Cells were washed, and confocal microscopy was used to image cells at Tulane University Health Science Center.

EV Loading

The ExoFect siRNA/miR Transfection Kit (Systems Biosciences, Cat. No. EXFT200A-1, Palo Alto, CA) was used to manipulate the EVs according to the kit’s instructions. The miR-206 mimic was used as the miR of interest, and a xenomiR, cel-miR-238 mimic (mirVana miR mimics, Ambion, Cat. No. 4464066, Austin, TX) was used as the control, as it is not expressed in mammalian myoblasts and does not have an effect on target genes in mammalian cells. Each reaction tube contained 10 μL of ExoFect solution, 20 μL of 100 pmol of miR mimic, 70 μL of sterile PBS, and 50 μL of EVs isolated from pooled macaque plasma (∼10¹³ EVs) as recommended by the manufacturer. The contents of the tube were gently mixed by rotation and incubated at 37°C for 10 min and then immediately placed on ice. To stop the reaction, 30 μL of the ExoQuick TC reagent provided in the kit was added to the EV solution and mixed by inverting six times. The solution was placed on ice for 30 min and then centrifuged for 3 min at 12,000 g at RT. The supernatant was removed, and the manipulated EV pellet was resuspended in OptiMEM culture medium. This resulted in EVs with supraphysiological levels of miR-206 (∼9.8 × 10⁵ times endogenous EV levels).

Uptake of EVs in SKM Tissue

To explore the feasibility of using EVs to deliver miRs to SKM tissue as opposed to two-dimensional (2-D) cultures, we isolated fresh SKM tissue ($\sim$20 g) from seven separate macaque biopsies and incubated muscle explants in medium alone (control), medium with free miR-206 (100 pmol), or medium with miR-206 enriched EVs (prepared as described above). The muscle tissue was cut into small pieces with sterile scissors before incubation. The solutions and tissue were incubated at 37°C in wells of a 24-well plate. After 48 h, the muscle tissue was washed with PBS and frozen at −80°C, and miR-206 expression was determined.

Statistical Analysis

All data presented were analyzed and graphed in GraphPad Prism version 9 (La Jolla, CA). Data are presented as means ± standard error of the mean (SE). Individual data points on bar graphs represent individual animals. Data between VEH/SIV and CBA/SIV groups were analyzed with an unpaired Student’s t test if the data were normally distributed or a Mann–Whitney U test if the data were not normally distributed. Data with three or more groups were analyzed with a dependent one-way ANOVA and post hoc Fisher’s least significant difference test. Outcomes determined to be statistically significant had a P value < 0.05.

RESULTS

Myotube myomiR Expression

Myotube myomiR expression was determined after 5 days of differentiation. Relative expression of miR-133a (VEH/SIV 1.0 ± 0.2, CBA/SIV 0.3 ± 0.4), miR-133b (VEH/SIV 1.0 ± 0.3, CBA/SIV 0.3 ± 0.3), and miR-206 (VEH/SIV 1.0 ± 0.5, CBA/SIV 0.3 ± 0.3) was significantly (P < 0.05) lower in CBA/SIV-derived myotubes compared to VEH/SIV-derived myotubes (Fig. 1, A–C, respectively). Similarly, TGF-β1 decreased the expression of miR-206 and decreased myotube density (Supplemental Fig. S1, A and B).

Figure 1.

Muscle-enriched microRNA (myomiR) expression in myotubes of vehicle (VEH)- and chronic binge alcohol (CBA)-administered simian immunodeficiency virus-infected (SIV) macaques. miR-133a (A), miR-133b (B), and miR-206 (C) expression is lower in myotubes derived from CBA/SIV compared to VEH/SIV groups. Means $\pm$ SE are shown. Unpaired Student’s t tests, *P < 0.05.

Overexpression of Myotube miR-206 and Target Gene Expression

Two targets of miR-206, HDAC4 and PAX7, were measured in myotubes after miR-206 transfection. There was a 226-fold increase (P < 0.01) in myotube miR-206 expression in the cells transfected with miR-206 mimic compared to the cells transfected with the miR scramble (Fig. 2A). Relative HDAC4 expression (scramble 1.0 ± 0.8, miR-206 0.3 ± 0.1) was nonsignificantly lower in miR-206-transfected cells at day 2 of differentiation (P = 0.05; Fig. 2B). At day 5 of differentiation, relative HDAC4 expression (scramble 1.0 ± 0.5, miR-206 0.5 ± 0.2) was significantly lower in miR-206-transfected cells (P < 0.05; Fig. 2C). Relative PAX7 expression at day 2 (scramble 1.0 ± 0.8, miR-206 0.1 ± 0.1) and day 5 (scramble 1.0 ± 0.7, miR-206 0.4 ± 0.3) of differentiation was lower in miR-206-transfected myotubes (P < 0.05, Fig. 2, D and E).

Figure 2.

Histone deacetylase 4 (HDAC4) and Paired Homeobox 7 (PAX7) gene expression in miR-206 overexpressed myotubes. A: relative miR-206 expression was significantly increased in cells transfected with miR-206 mimic compared to miR scramble at day 5 of differentiation. B: there was a nonsignificant decrease in HDAC4 expression at day 2 of differentiation in miR-206-transfected cells compared to scramble-transfected cells (P = 0.05). C: HDAC4 expression was decreased at day 5 of differentiation in miR-206-transfected cells. D and E: PAX7 expression was decreased at both day 2 (D) and day 5 (E) of differentiation in miR-206 transfected cells. Vehicle/simian immunodeficiency virus-infected (VEH/SIV) cell lines are shown by open shapes and chronic binge alcohol (CBA)/SIV cell lines are shown by black shapes. Each shape corresponds to a single animal. Graphs display mean and SE. Paired t tests, *P < 0.05, **P < 0.01.

Overexpression of Myotube miR-206 and Myoblast Differentiation

On day 5 of differentiation, fusion index and myotube density were determined. In VEH/SIV-derived myotubes, fusion index (scramble 8.4 ± 3.2%, miR-206 10.4 ± 1.5%) and myotube density (scramble 5.8 ± 3.2, miR-206 9.6 ± 4.9 myotubes per frame) were not significantly different between cells transfected with scramble or miR-206 mimic (Fig. 3, A and C). In CBA/SIV-derived myotubes, fusion index (scramble 5.1 ± 3.0%, miR-206 8.7 ± 1.4%) was significantly higher in cells transfected with the miR-206 mimic (Fig. 3B). Myotube density (scramble 3.4 ± 2.2%, miR-206 7.7 ± 3.5 myotubes per frame) was not significantly different between the groups (Fig. 3D).

Figure 3.

Measures of myoblast differentiation in vehicle (VEH)- and chronic binge alcohol (CBA)-administered simian immunodeficiency virus-infected (SIV) macaque-derived myotubes after overexpression of miR-206. A: fusion index was not significantly different between miR scramble- and miR-206-transfected cells in the VEH/SIV myotubes. B: fusion index was significantly increased in miR-206-transfected cells compared to scramble in the CBA/SIV myotubes at day 5 of differentiation. C and D: myotube (MT) density was not significantly different in VEH/SIV (C) or CBA/SIV (D) groups between scramble- and miR-206-transfected cells. VEH/SIV cell lines are shown by open shapes and CBA/SIV cell lines are shown by black shapes. Each shape corresponds to a single animal. E: representative images of CBA/SIV myotubes transfected with miR scramble and CBA/SIV myotubes transfected with miR-206 mimic. Graphs display means ± SE. Paired t tests, *P < 0.05.

Characteristics of EVs from VEH/SIV- and CBA/SIV-Derived Myotubes

NTA was used to measure the number and size of particles isolated from VEH/SIV and CBA/SIV myotubes. There were no significant differences in the number (VEH/SIV 2.9 × 10¹⁰ ± 9.3 × 10⁹, CBA/SIV 1.9 × 10¹⁰ ± 4.0 × 10⁹ particles/mL) or size (VEH/SIV 155 ± 16 nm, CBA/SIV 159 ± 5 nm) of EVs between the two groups (Fig. 4, A and B). Average size distribution curves are shown in Fig. 4C, showing that isolated EVs were <400 nm in size, with peak counts between 100 and 150 nm.

Figure 4.

Number and size of particles from myotube extracellular vesicle (EV) isolates measured by nanoparticle tracking analysis (NTA) and relative expression of muscle-enriched microRNAs (myomiRs) in myotube-derived EVs from vehicle (VEH)- and chronic binge alcohol (CBA)-administered simian immunodeficiency virus-infected (SIV) groups. A: total numbers of particles/mL were not significantly different in myotube cultures (days 3–5 of differentiation) between VEH/SIV and CBA/SIV groups. B: average sizes of particles were not significantly different in EVs isolated from myotube culture (days 3–5 of differentiation) between VEH/SIV and CBA/SIV groups. C: average size distribution for VEH/SIV and CBA/SIV groups. D: expression of miR-133a in VEH/SIV and CBA/SIV myotube-derived EVs is not significantly different. E and F: expression of miR-133b (E) and miR-206 (F) from CBA/SIV macaque myotube EVs isolated between days 3 and 5 of differentiation is decreased compared to the VEH/SIV group. Means and SE are shown in the graphs. Unpaired Student’s t tests were used in A and B; Mann–Whitney U tests were used for D–F. *P < 0.05.

MyomiR concentration of VEH/SIV and CBA/SIV myotube-derived EVs were measured. miR-133a expression was not significantly different between the groups (VEH/SIV 1.0 ± 0.4, CBA/SIV 2.6 ± 1.8) (Fig. 4D). Relative miR-133b expression (VEH/SIV 1.0 ± 0.6, CBA/SIV 0.02 ± 0.004) (Fig. 4E) and miR-206 expression (VEH/SIV 1.0 ± 0.2, CBA/SIV 0.2 ± 0.09) (Fig. 4F) were lower in the CBA/SIV myotube-derived EVs compared to VEH/SIV myotube-derived EVs.

Although the VEH/SIV-derived EVs contained higher miR-206 expression compared to CBA/SIV-derived EVs, VEH/SIV-derived EVs failed to improve CBA/SIV myoblast differentiation (Supplemental Fig. S2, A and B). This is likely because there was not a significant increase in miR-206 expression in CBA/SIV myoblasts treated with the VEH/SIV-derived EVs (Supplemental Fig. S1C).

EV Delivery of miRs to Myoblasts

EVs isolated from macaque plasma were stained with PKH67 membrane stain, and nuclei were stained with DRAQ5. Cells were imaged with confocal microscopy (Fig. 5). Little to no PKH67 was visualized in the cells treated with PBS control. This suggests that the washing steps were effective at removing unbound dye from the solution. In the cells treated with stained EVs, the EVs appear to be congregating around nuclei, suggesting that they have been taken up by the myoblasts.

Figure 5.

Extracellular vesicle (EV) uptake into myoblasts shown by confocal microscopy. EVs isolated from plasma were stained with a PKH67 membrane stain (green), and myoblasts were treated with EVs for 16 h. Cells were fixed, and DRAQ5 (purple) was used to stain myoblast nuclei. Cells were imaged by confocal microscopy.

VEH/SIV- and CBA/SIV-derived myoblasts were treated with medium only, medium + free miR-206, medium + EVs transfected with cel-miR-238, and medium + EVs transfected with miR-206. Myotube expression of miR-206 was measured (Fig. 6A). Relative miR-206 expression was significantly upregulated in myotubes treated with EVs transfected with miR-206 (medium only 1.0 ± 0.4, medium + free miR-206 0.6 ± 0.2, cel-miR-238 EVs 0.9 ± 0.3, and miR-206 EVs 360.7 ± 53.6) (Fig. 6B). Additionally, cel-miR-238 expression in myotubes treated with EVs transfected with cel-miR-238 was significantly higher than in myotubes treated with medium only (Supplemental Fig. S3).

Figure 6.

Myotube miR-206 expression after treatment with miR-loaded extracellular vesicles (EVs). A: timeline showing myoblasts treated with medium only, medium + free miR-206, medium + EVs transfected with 100 pmol cel-miR-238, or medium + EVs transfected with 100 pmol miR-206 at day 0 of differentiation. Myoblasts were differentiated for 5 days. B: relative miR-206 expression was significantly higher in myotubes treated with miR-206 EVs compared to control groups. Vehicle/simian immunodeficiency virus-infected (VEH/SIV) cell lines are shown by open shapes and chronic binge alcohol (CBA)/SIV cell lines are shown by black shapes. Each shape corresponds to a single animal. Means and SE are shown in the graphs. One-way dependent ANOVA with post hoc Fisher’s least significant difference tests, ***P < 0.01.

miR-206 Enriched EVs and Myoblast Differentiation

Myotubes treated with cel-miR-238 EVs and miR-206 EVs were fixed and stained for imaging. EVs transfected with cel-miR-238 were used as a control. Fusion index and myotube density were determined for each cell line for each group. In VEH/SIV-derived myotubes, fusion index (cel-238 EVs 11.9 ± 2.7%, miR-206 EVs 12.7 ± 3.4%) and myotube density (cel-238 EVs 6.6 ± 1.4, miR-206 EVs 7.5 ± 0.9 myotubes per frame) were not significantly different between cells treated with cel-miR-238 EVs and those treated with miR-206 EVs (Fig. 7, A and C). In the CBA/SIV-derived myotubes, fusion index (cel-238 EVs 4.2 ± 1.9%, miR-206 EVs 9.8 ± 3.6%) and myotube density (cel-238 EVs 2.3 ± 0.5, miR-206 EVs 5.2 ± 0.4 myotubes per frame) were significantly greater in cells treated with miR-206 EVs compared to those treated with cel-miR-238 EVs (Fig. 7, B and D). Representative images of CBA/SIV myotubes treated with cel-miR-238 EVs and miR-206 EVs are shown in Fig. 7E.

Figure 7.

Myotube fusion index and myotube density after treatment with miR-loaded extracellular vesicles (EVs). A: fusion index at day 5 of differentiation for vehicle/simian immunodeficiency virus-infected (VEH/SIV) myotubes treated with cel-miR-238 EVs and miR-206 EVs at day 0 of differentiation was not significantly different. B: fusion index at day 5 of differentiation for chronic binge alcohol (CBA)/SIV myotubes treated with miR-206 EVs was greater than that for myotubes treated with cel-miR-238 EVs. C: myotube (MT) density at day 5 of differentiation for VEH/SIV myotubes treated with cel-miR-238 EVs and miR-206 EVs was not significantly different. D: myotube density at day 5 of differentiation for CBA/SIV myotubes treated with miR-206 EVs was greater than that for myotubes treated with cel-miR-238 EVs. VEH/SIV cell lines are shown by open shapes and CBA/SIV cell lines are shown by black shapes. Each shape corresponds to a single animal. E: representative images of CBA/SIV myotubes treated with either cel-238 EVs or miR-206 EVs. Means and SE are shown in the graphs. Paired t tests, *P < 0.05, ***P < 0.001.

miR-206 Enriched EV Delivery to SKM Tissue

Fresh SKM tissue from macaque biopsies was incubated in medium alone (control), medium with free miR-206, or medium with miR-206 enriched EVs, and miR-206 expression in the muscle tissue was measured. Relative miR-206 expression was significantly greater in the tissue treated with miR-206 enriched EVs compared to tissue treated with medium or tissue treated with medium and free miR-206 (medium only 1.0 ± 0.4, medium + free miR-206 17.8 ± 5.7, medium + miR-206 EVs 57.8 ± 18.1) (Fig. 8), indicating that EVs can deliver miR-206 to whole muscle tissue.

Figure 8.

miR-206 expression in whole skeletal muscle (SKM) tissue treated with miR-206 extracellular vesicles (EVs). Whole SKM tissue was treated with medium only, medium + free miR-206, or medium + EVs transfected with 100 pmol miR-206. There was a significant increase in miR-206 expression of SKM treated with free miR-206 and miR-206 EVs. There was a significant increase in miR-206 expression of SKM treated with miR-206 EVs compared to SKM treated with free miR-206. Each shape represents a different muscle biopsy. One-way dependent ANOVA with post hoc Fisher’s least significant difference tests, *P < 0.05.

DISCUSSION

Previous studies have shown that CBA in SIV-infected, ART-treated macaques significantly decreases ex vivo myoblast differentiation (9, 10). The present study examined a potential method for reversing the effect of CBA on myoblast differentiation. Data suggest that overexpressing miR-206 increased differentiation potential in the CBA/SIV-derived myoblasts and that a potential mechanism is by downregulating HDAC4 and PAX7 expression. The present study also demonstrated that endogenous plasma-derived EVs may be used to deliver exogenous miRs to primary myoblasts to improve differentiation of myoblasts derived from CBA-administered SIV-infected macaques. Figure 9 summarizes our findings.

Figure 9.

Summary. Chronic binge alcohol (CBA) decreases differentiation of myoblasts isolated from simian immunodeficiency virus (SIV)-infected, antiretroviral therapy (ART)-treated female macaques and downregulates miR-206 expression in myotubes and myotube-derived extracellular vesicles (EVs). CBA/SIV myotubes transfected with a miR-206 mimic have decreased PAX7 and HDAC4 expression, which could mechanistically explain the miR-206 transfection-mediated increase in differentiation. Exogenous miR-206 expression can be increased in EVs, and miR-206 EVs improve CBA/SIV-mediated decreased myoblast differentiation. Created with BioRender.com.

CBA downregulated miR-133a, miR-133b, and miR-206 in the myotubes of SIV-infected female macaques. This is consistent with studies from male macaques showing that CBA decreases SKM and plasma miR-206 expression (10). Previous studies have shown that CBA promotes SKM profibrotic milieu, including an increase in TGF-β1 expression, in SIV-infected macaques (34). We speculate that the TGF-β1-mediated profibrotic milieu modulates miR-206 expression, leading to impaired myoblast differentiation (11). Future studies will determine the mechanistic role of TGF-β1 in contributing to alcohol-related impaired regeneration. Additionally, CBA/SIV myotube-derived EVs have decreased expression of miR-133b and miR-206, with no significant difference for miR-133a. The differences in relative expression of myomiRs in the myotubes compared to secreted EVs suggest that the process of incorporating miRs into EVs is not random and may have functional relevance yet to be identified (35).

miR-206 inhibition impairs primary macaque myoblast differentiation and results in the upregulation of HDAC4 expression (10). Additionally, inhibition of HDAC4 upregulates MEF2C expression, which is associated with improved myoblast differentiation (12). The present study complements those findings by demonstrating that exogenous overexpression of miR-206 increased CBA/SIV myoblast differentiation and downregulated HDAC4 gene expression. Additionally, exogenous overexpression of miR-206 downregulated PAX7 gene expression as was shown in C2C12 myoblasts (13, 14). PAX7 is a transcription factor expressed in quiescent and proliferating myoblasts, and its downregulation is important for myoblast differentiation and fusion required for myogenesis (13). Thus, miR-206-mediated improvements in differentiation could occur through inhibition of both HDAC4 and PAX7 expression. There are numerous other myomiR gene targets that may play a role in differentiation (36, 37); thus, studies are warranted to explore the effect of these targets on differentiation. To our knowledge, this is the first study to show that miR-206 can improve alcohol-induced decreased myoblast differentiation.

CBA did not alter the number of EVs released from myotubes. This is similar to data from myotubes derived from male macaques that did not show a change in number or size of EVs (30). Other studies have shown that alcohol increases EV release from hepatocytes in vitro (38), and total circulating EVs are increased in alcohol-administered mice and in people with alcohol-induced hepatitis (25). In the present study, the blood alcohol concentration was zero at the time of sample collection, and there were no overt signs of liver injury. Therefore, studies are warranted to determine if these null findings would translate to other models of alcohol-induced myopathy.

Although previous studies have shown that miRs can be loaded into EVs and used to deliver the miRs to target cells (39–41), these studies are limited to supporting this concept in immortalized cell lines and using miRNAs that are endogenously expressed in cells. Our studies support and extend the current literature by demonstrating the delivery of miRs to primary macaque myoblasts in lieu of immortalized cell lines. Additionally, our studies uniquely demonstrate that we can deliver cel-miR-238, a xenomiR, to cells with EVs, providing direct evidence that miRs can be effectively delivered to cells with EVs.

The present study is not without limitations. One major limitation is the small sample size due to the nature of nonhuman primate research. Although the number of animals used in our studies is small, the use of primary macaque cell lines instead of an immortalized cell line enhances the ability to translate our findings to humans since the genetic variability of macaques is similar to that seen in humans. Additionally, our experiments are performed ex vivo. Previous studies by our group have found that changes seen in myotube cultures reflect what is seen in the SKM (42). Although the improvements in myoblast differentiation would theoretically improve SKM regeneration, we have not tested this hypothesis. Future studies should consider delivering miR-206 EVs in vivo to determine potential systemic effects of miR-206 EVs and to determine whether whole SKM regeneration is improved with miR-206 enriched EVs. Finally, there are still many unanswered questions regarding cellular targeting and uptake of EVs. Although we have demonstrated that EVs are taken up by myoblasts, we did not investigate the mechanism by which this occurs. Mechanisms of EV cellular uptake include endocytosis, clathrin- or caveolin-dependent endocytosis, micropinocytosis, and phagocytosis (24); however, further research is needed to determine the specific mechanism of EV uptake in myoblasts.

With the population of PWH getting older and the high prevalence of alcohol use in this population, frailty and other SKM-related diseases are of increasing concern. The present study explores a potential therapeutic option for treating alcohol-induced SKM myopathy in the context of HIV infection. miR-206 or other myomiRs may provide a potential treatment option for improving SKM regenerative capacity (43–45) and thus improving overall muscle health. There are numerous benefits in utilizing EVs as a miR delivery vehicle, such as their stability, low immunogenicity, and high delivery capacity (46, 47). This study provides an initial step in utilizing endogenous EVs to deliver miRs that can improve SKM stem cell differentiation.

DATA AVAILABILITY

Data will be made available upon reasonable request.

SUPPLEMENTAL MATERIAL

Supplemental Figures 1: https://doi.org/10.6084/m9.figshare.26152636.v1.

Supplemental Figures 2: https://doi.org/10.6084/m9.figshare.26152663.

Supplemental Figures 3: https://doi.org/10.6084/m9.figshare.26153137.v1.

GRANTS

This work was supported by NIH/National Institute on Alcohol Abuse and Alcoholism (NIAAA): P60AA009803 (P.E.M.), K01AA024494 (L.S.), F30AA029358 (B.L.B.), F32AA027982 (D.E.L.), and T32AA007577 (P.E.M.).

DISCLAIMERS

The content is solely the authors’ responsibility and does not necessarily represent the official views of the Louisiana State University Health Sciences Center New Orleans or the National Institutes of Health.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

B.L.B., P.E.M., and L.S. conceived and designed research; B.L.B., E.M.G., P.J.B., and L.S. performed experiments; B.L.B., E.M.G., D.E.L., and P.J.B. analyzed data; B.L.B., D.E.L., P.J.B., and L.S. interpreted results of experiments; B.L.B. and E.M.G. prepared figures; B.L.B. drafted manuscript; B.L.B., E.M.G., D.E.L., P.J.B., P.E.M., and L.S. edited and revised manuscript; B.L.B., E.M.G., D.E.L., P.J.B., P.E.M., and L.S. approved final version of manuscript.