Abstract
The armA (aminoglycoside resistance methylase) gene, which confers resistance to 4,6-disubstituted deoxystreptamines and fortimicin, was initially found in Klebsiella pneumoniae BM4536 on IncL/M plasmid pIP1204 of ca. 90 kb which also encodes the extended-spectrum β-lactamase CTX-M-3. Thirty-four enterobacteria from various countries that were likely to produce a CTX-M enzyme since they were more resistant to cefotaxime than to ceftazidime were studied. The armA gene was detected in 12 clinical isolates of Citrobacter freundii, Enterobacter cloacae, Escherichia coli, K. pneumoniae, Salmonella enterica, and Shigella flexneri, in which it was always associated with blaCTX-M-3 on an IncL/M plasmid. Conjugation, analysis of DNA sequences, PCR mapping, and plasmid conduction experiments indicated that the armA gene was part of composite transposon Tn1548 together with genes ant3"9, sul1, and dfrXII, which are responsible for resistance to streptomycin-spectinomycin, sulfonamides, and trimethoprim, respectively. The 16.6-kb genetic element was flanked by two copies of IS6 and migrated by replicative transposition. This observation accounts for the presence of armA on self-transferable plasmids of various incompatibility groups and its worldwide dissemination. It thus appears that posttranscriptional modification of 16S rRNA confers high-level resistance to all the clinically available aminoglycosides except streptomycin in gram-negative human and animal pathogens.
Despite the development of new β-lactams and fluoroquinolones, aminoglycosides are still used for the treatment of severe infections due to gram-negative bacteria. Aminoglycosides act by causing translational errors and by inhibiting translocation (5). Their target sites include ribosomal domains in which the accuracy of the codon-anticodon is assessed (19, 26). In particular, they bind to a highly conserved motif of 16S rRNA, which leads to alterations in ribosome function (15, 28). Since their introduction into clinical use, bacterial resistance to aminoglycosides has been reported (21). There are four known mechanisms of resistance to these drugs in bacterial human pathogens: (i) decreased intracellular accumulation of the antibiotic by alteration of outer membrane permeability (9), diminished inner membrane transport (23), or active efflux (12, 17); (ii) enzymatic modification of the drug (21), primarily through N-acetylation, O-nucleotidylation, or O-phosphorylation, which is the most common mechanism; (iii) modification of the target by mutation in ribosomal proteins or in 16S rRNA (18); and (iv) trapping of the drug (13, 14). Microorganisms that produce aminoglycosides have developed an additional pathway to avoid suicide. This self-defense mechanism involves posttranscriptional methylation of rRNA by the use of S-adenosylmethionine as a cofactor (1).
The armA (aminoglycoside resistance methyltransferase) gene, which confers resistance to 4,6-disubstituted deoxystreptamines (4,6-dds; kanamycin, amikacin, isepamicin, gentamicin, netilmicin, sisomicin, and tobramycin) and fortimicin, was initially found in Klebsiella pneumoniae BM4536 on IncL/M plasmid pIP1204 of ca. 90 kb which also encodes the extended-spectrum β-lactamase CTX-M-3 (7). The deduced amino acid sequence of armA displays from 37 to 47% similarity to 16S rRNA m7G-methyltransferases from antibiotic producers (7).
The goal of this work was to study the extent and mechanism(s) of dissemination of the armA gene among members of the family Enterobacteriaceae that produce CTX-M enzymes and that were isolated from several countries. Conjugation experiments, sequence analysis of plasmid pCTX-M-3 from Citrobacter freundii (GenBank accession number AF550415), and PCR mapping of pIP1204 (7) indicated that armA is borne by a 16.6-kb element flanked by two direct copies of IS6. We therefore tested the transposability of this composite element, designated Tn1548.
(Part of this work was presented at the 43rd Interscience Conference on Antimicrobial Agents and Chemotherapy [M. Galimand, S. Sabtcheva, T. Kantardjiev, L. Poirel, G. Arlet, P. Courvalin, and T. Lambert, Abstr. 43rd Intersci. Conf. Antimicrob. Agents Chemother., abstr. C2-59, 2003] and the 44th Interscience Conference on Antimicrobial Agents and Chemotherapy [T. Lambert, M. Galimand, S. Sabtcheva, and P. Courvalin, 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1496, 2004].)
MATERIALS AND METHODS
Strains, plasmids, and growth conditions.
Thirty-four enterobacteria from three hospitals in Paris, France, from two hospitals in Sofia, Bulgaria, and from our laboratory collection that were likely to produce a CTX-M enzyme since they were more resistant to cefotaxime than to ceftazidime were studied (Table 1). Escherichia coli BM694 (10), a spontaneous mutant of E. coli C1a (20) resistant to nalidixic acid, was used as the recipient for conjugation. The E. coli strains and plasmids used in transposition experiments are listed in Table 2. The strains were grown in brain heart infusion broth or on agar (Difco Laboratories, Detroit, Mich.) at 37°C.
TABLE 1.
Properties of the strains studied
| Strain (no. of isolates) | Country of origin | Absence or presence of the followinga:
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| blaCTX-M-2 | blaCTX-M-3 | blaCTX-M-9 | blaCTX-M-14 | blaCTX-M-15 | blaCTX-M-28 | armA | IncL/M | ||
| C. freundii | |||||||||
| 2 | Bulgaria | − | + | − | − | − | − | + | + |
| 1 | Poland | − | + | − | − | − | − | + | + |
| E. coli | |||||||||
| 1 | France | + | − | − | − | − | − | − | − |
| 1 | France | − | + | − | − | − | − | + | + |
| 1 | Bulgaria | − | + | − | − | − | − | + | + |
| 1 | France | − | − | + | − | − | − | − | − |
| 2 | France | − | − | − | + | − | − | − | − |
| 8 | Bulgaria | − | − | − | − | + | − | − | − |
| 1 | India | − | − | − | − | + | − | − | − |
| 4 | France | − | − | − | − | − | + | − | − |
| K. pneumoniae | |||||||||
| 2 | Bulgaria | − | + | − | − | − | − | + | + |
| 2 | France | − | + | − | − | − | − | + | + |
| 1 | Turkey | − | − | − | − | + | − | − | − |
| K. oxytoca (1) | Bulgaria | − | − | − | − | + | − | − | − |
| E. cloacae (1) | France | − | + | − | − | − | − | + | + |
| E. aerogenes (1) | Bulgaria | − | − | − | − | + | − | − | − |
| P. mirabilis (1) | France | − | + | − | − | − | − | − | − |
| S. enterica (1) | Bulgaria | − | + | − | − | − | − | + | + |
| S. flexneri (1) | Bulgaria | − | + | − | − | − | − | + | + |
| S. marcescens (1) | France | − | + | − | − | − | − | − | + |
− and +, absence and presence of the gene, respectively.
TABLE 2.
Strains and plasmids used in transposition experiments
| Strain or plasmid | Relevant characteristicsa | Source or reference |
|---|---|---|
| E. coli | ||
| DH1 | F−supE44 recA1 endA1 gyrA96 (Nalr) thi-1 hsdR17 (rK− mK+) relA1 | 20 |
| HB101 | F−hsd20(rB− mB−) proA2 lacY1 recA13 rpsL20 (Strr) ara-14 galK2 xyl-5 mtl-1 supE44 λ− | 2 |
| K802N | hsdR hsdM+gal met sup rpoB nalA (Nalr) | 25 |
| Plasmids | ||
| pOX38-Neor | F derivative Tra+ Neor; 58.2 kb | 3 |
| pSU18-MluI | Tra− Mob− Cmr; 2.3 kb | This study |
| pAT783 | pSU18-MluIΩ22 kb MluI-AscI from pIP1204 Tra− Mob− Cmr Smr Sulr Tpr 4,6-ddsr | This study |
| pBR322 | Tra− Mob− Apr Tcr; 4.4 kb | 22 |
| pIP1204 | IncL/M Tra+ Apr Cefr Smr Sur Tpr 4,6-ddsr; ca. 90 kb | 7 |
Tra+, self-transferable; Tra−, non-self-transferable, Mob−, nonmobilizable; Apr, ampicillin resistance; Cefr, cefotaxime resistance; Cmr, chloramphenicol resistance; Nalr, nalidixic acid resistance; Neor, neomycin resistance; Smr, streptomycin-spectinomycin resistance; Strr, streptomycin resistance; Sur, sulfonamide resistance; Tcr, tetracycline resistance; Tpr, trimethoprim resistance; 4,6-ddsr, 4,6-disubstituted deoxystreptamine resistance.
DNA preparation and transfer.
Isolation of total DNA and small- and large-scale preparation of plasmid DNA were performed as described previously (20). Restriction with endonucleases was performed according to the supplier's recommendations. Amplification of DNA was performed in a 2400 thermal cycler (Perkin-Elmer Cetus, Notwalk, Conn.) with Taq (Qbiogene, Inc., Carlsbad, Calif.) or Pfu (Stratagene, La Jolla, Calif.) DNA polymerase, as recommended by the manufacturers. PCR elongation times and temperatures were adjusted according to the expected size of the PCR product and according to the nucleotide sequence of the primers, respectively. Detection and identification of the genes in pIP1204 were done by PCR with primers described previously (7). Primers IncF and IncR were designed from the sequence of the replicon of pMU407.1 (GenBank accession number U27435), a naturally occurring conjugative plasmid of the IncL/M incompatibility group (Table 3). These primers allowed amplification of a 480-bp portion of the vegetative replication origin of pIP1204, which was 92% identical to that of pMU407.1. The target sites of Tn1548 were determined by sequencing of pBR322::Tn1548 junctions by using the primers described in Table 3. The amplification products were purified by using the QIAquick PCR purification kit (QIAGEN, Inc., Chatsworth, Calif.).
TABLE 3.
Primers used for amplification and sequencing
| Locus | Primer name | Sequence (5′→3′) | Positiona | Source or reference |
|---|---|---|---|---|
| incL/M | IncF | CCCAAAGATGCAAAAAGAATG | 270 to 290 | This study |
| IncR | AAAGACCTTCTACTGACTCAA | 749 to 729 | ||
| blaTEM-1 | A216 | ATAAAATTCTTGAAGACGAAA | −5 to 20 | 11 |
| A217 | GACAGTTACCAATGCTTAATCA | 1074 to 1053 | ||
| tnpIS6 | IS6rev | ACAGAATGATGTCACGCTG | 109 to 91 | This study |
| IS6for | TGCACTACGCAAAGGCCAG | 681 to 699 |
Mating experiments.
Conjugation from clinical isolates to E. coli BM694 was performed with selection on nalidixic acid (40 μg/ml) and amikacin (20 μg/ml) or ampicillin (100 μg/ml). The transposition and cointegrate-forming properties of Tn1548 were studied in a mating assay, as described previously (6, 24). In this system, the mobility of a transposable element carried by a nontransferable and nonmobilizable plasmid (pAT783) to a self-transferable plasmid (pOX38-Neor) was revealed in a standard mating assay between the recA strains E. coli HB101, used as the donor, and E. coli DH1, used as the recipient. In every mating, randomly selected transconjugants were purified and tested for antibiotic resistance to eliminate donor mutants and, when necessary, to discriminate between simple transposition or cointegrate formation.
Susceptibility testing.
Antibiotic susceptibility was determined by disk diffusion on Mueller-Hinton agar (Bio-Rad, Marnes-la-Coquette, France), according to Comité de l'Antibiogramme de la Société Française de Microbiologie standards (4).
DNA sequence determination and analysis.
Both strands of the DNA were sequenced by using synthetic primers and a CEQ 2000 DNA analysis system automatic sequencer (Beckman Coulter, Fullerton, Calif.). The nucleotide and deduced amino acid sequences were analyzed with the GCG sequence analysis software package (version 10.1; Genetics Computer Group, Madison, Wis.). BLAST program searches were performed by using the National Center for Biotechnology Information website (http://www.ncbi.nim.nlh.gov/).
RESULTS
Distribution of the armA gene in enterobacteria.
Among the 34 clinical isolates of enterobacteria, collected in several countries, likely to produce a CTX-M enzyme since they were more resistant to cefotaxime than to ceftazidime (Table 1), the blaCTX-M-3 gene was identified in 14 strains, the blaCTX-M-2 gene was identified in 1 strain, the blaCTX-M-9 gene was identified in 1 strain, the blaCTX-M-14 gene was identified in 2 strains, the blaCTX-M-15 gene was identified in 12 strains, and the blaCTX-M-28 gene was identified in 4 strains. The armA gene was detected in 12 isolates, including C. freundii (3 of 3 strains), Enterobacter cloacae (1 of 1), E. coli (2 of 19), K. pneumoniae (4 of 5), Salmonella enterica serotype Enteritidis (1 of 1), and Shigella flexneri (1 of 1). The strains harboring the armA and the blaCTX-M-3 genes, except for the two Citrobacter freundii strains from Bulgaria, were isolated in different hospitals. The blaCTX-M-2, blaCTX-M-9, blaCTX-M-14, blaCTX-M-15, and blaCTX-M-28genes were not carried by IncL/M plasmids.
In two strains harboring blaCTX-M-3, the armA gene could not be detected by PCR. In a Proteus mirabilis strain, no plasmid belonging to incompatibility group IncL/M was found. In a Serratia marcescens strain, the IncL/M origin of vegetative replication and the blaTEM-1 and blaCTX-M-3 genes were detected by PCR and sequencing.
Conjugation experiments.
Transfer of high-level aminoglycoside resistance from the 12 armA-containing E. coli, K. pneumoniae, C. freundii, S. enterica, and S. flexneri strains to E. coli BM694 was obtained with selection on nalidixic acid and amikacin. By disk diffusion, PCR with specific primers, and sequence analysis, the E. coli transconjugants were found to express resistance to 4,6-disubstituted deoxystreptamines because of armA, to β-lactams because of acquisition of blaTEM-1 and blaCTX-M-3, to certain aminoglycosides because of aac3, to streptomycin-spectinomycin because of ant3"9, to sulfonamides because of sul1, and to trimethoprim because of dfrXII. All the resistance genes were always carried by an IncL/M plasmid of ca. 80 to 90 kb.
When the transfer from the same strains to E. coli BM694 was selected on nalidixic acid and ampicillin, for 11 of the 12 donors transfer of armA, blaTEM-1, and blaCTX-M-3 was associated with that of the aac3, ant3"9, sul1, and dfrXII genes, as tested by PCR with specific primers. The transconjugant from S. enterica serotype Enteritidis was resistant to β-lactams after the acquisition of blaTEM-1 and blaCTX-M-3 and was resistant to certain aminoglycosides, such as gentamicin, kanamycin, netilmicin, and tobramycin, by the presence of the aac3 gene; but it remained susceptible to amikacin, fortimicin, streptomycin-spectinomycin, sulfonamides, and trimethoprim, probably due to the loss of the armA, ant3"9, sul1, and dfrXII genes during conjugation.
These data, together with those drawn from sequence analysis of plasmid pCTX-M-3 from C. freundii (GenBank accession number AF550415) and PCR mapping of pIP1204 (7) and of the plasmids from the S. enterica serotype Enteritidis donor and from the corresponding transconjugant (data not shown), indicated that the ant3"9, sul1, dfrXII, and armA genes were part of a 16.6-kb element flanked by two direct copies of IS6. This composite element was designated Tn1548.
Transposition of Tn1548.
Transposition of Tn1548, which conferred resistance to 4,6-disubstituted deoxystreptamines, fortimicin, streptomycin-spectinomycin, sulfonamides, and trimethoprim, was studied by plasmid conduction in E. coli by using pOX38-Neor. Plasmid pOX38 is a conjugative F derivative which does not carry any known insertion sequence except a small region of IS3. Plasmid pOX38-Neor was constructed by cloning the aph3 gene, which confers neomycin resistance, into pOX38 (3). A ca. 22-kb MluI-AscI fragment from pIP1204 (7) encompassing the entire Tn1548 putative transposon was cloned into pSU18-MluI, generating plasmid pAT783 (Tra− Mob− Cmr 4,6-ddsr Smr Sulr Tpr; 24.3 kb), which was introduced by transformation into E. coli HB101 (recA Strr) harboring pOX38-Neor (Tra+ Neor) (Table 2). Transfer by mobilization of amikacin resistance (Akr) from the resulting strain, HB101(pOX38-Neor pAT783), into E. coli DH1 (recA Nalr) was obtained at a frequency of ca. 10−4 per donor cell. A DH1 transconjugant was selected, and in mating experiments into HB101, it cotransferred the antibiotic resistance conferred by pAT783 and pOX38-Neor, suggesting the formation of a pOX38-Neor::pAT783 cointegrate.
The pOX38-Neor::pAT783 cointegrate was transferred by conjugation from HB101 into rec+ E. coli K802N, and transconjugants were selected on plates containing amikacin plus nalidixic acid. The HB101(pOX38-Neor::pAT783) donors and the K802N(pOX38-Neor::pAT783) transconjugants were grown for approximately 100 generations in the absence of antibiotic and plated onto brain heart infusion agar, and the colonies were tested for their antibiotic susceptibilities by disk diffusion. All HB101 donors tested (200 colonies) remained resistant to amikacin, streptomycin-spectinomycin, sulfonamides, trimethoprim, neomycin, and chloramphenicol. By contrast, in the K802N recipient, the loss of resistance (i) to amikacin, streptomycin-spectinomycin, sulfonamides, and trimethoprim secondary to excision of Tn1548, (ii) to neomycin due to segregation of pOX38-Neor, and (iii) to chloramphenicol following the loss of pSU18-MluI was observed (in 2 of 200 colonies tested), indicating resolution of the pOX38-Neor::pAT783 cointegrate in a recombination-proficient host. The cointegrates generated by IS6 were stable in a recA genetic background, since this element does not encode a site-specific resolvase (16, 24). However, in a rec-positive bacterium, homologous recombination can occur between two directly oriented copies of IS6 that are generated during replicative transposition (24).
Target sites of Tn1548.
Plasmid pBR322 (Tra− Mob− Apr Tcr) was introduced by transformation into HB101(pOX38-Neor::Tn1548). Transfer of resistance to amikacin and to ampicillin or tetracycline from HB101(pOX38-Neor::Tn1548 pBR322) to E. coli K802N was obtained at a frequency of ca. 10−5 per donor cell. The transconjugants were tested for their antibiotic susceptibilities by disk diffusion. One transconjugant susceptible to ampicillin, in which integration of pOX38-Neor::Tn1548 occurred in or in the regulatory region of the β-lactamase gene, was selected for sequencing of the junctions between pBR322 and Tn1548. Primer pairs consisting of primers A216 and IS6rev and primers IS6for and A217 (Table 3) were used to amplify and sequence the junction fragments. The ends of the insert in the blaTEM-1 gene of pBR322 corresponded to the terminal inverted repeats of Tn1548. Eight base pairs (CTTTTTTG) of blaTEM-1 duplicated in direct orientation were found at the borders of the transposon (Fig. 1).
FIG. 1.
Sequences of the left and right pBR322::Tn1548 junctions and the blaTEM-1 target gene. The sequences of blaTEM-1 and IS6 are indicated in lower- and uppercase letters, respectively. Horizontal arrows delineate the 14-bp inverted repeats (IR) of IS6, and the 8-bp duplicated motif at the insertion site is in italics. The coordinates refer to the first bases of blaTEM-1 and IS6 (16).
DISCUSSION
We have studied the extent and the mechanism(s) of dissemination of the armA gene among enterobacteria from several countries. The armA gene is of clinical importance since it confers high-level resistance to all the clinically available aminoglycosides except streptomycin. The results indicate that armA was disseminated by a broad-host-range IncL/M conjugative plasmid. It was linked to blaTEM-1 and blaCTX-M-3, which confer resistance to all β-lactams with the exception of carbapenems, and also to the aac3, ant3"9, sul1, and dfrXII genes. Aminoglycoside resistance due to armA has recently been reported in human clinical isolates of enterobacteria and Acinetobacter baumannii. Transfer of high-level aminoglycoside resistance to E. coli was obtained from 15 of 28 armA-containing E. coli and K. pneumoniae isolates from Taiwan, and cotransfer with blaCTX-M-3 and blaTEM-1 was also observed (27). In addition, the armA gene has been shown to be transferable by conjugation from E. coli and S. marcescens clinical isolates from Japan to E. coli but not from A. baumannii to E. coli or Acinetobacter calcoaceticus (J. Wachino, K. Yamane, H. Kurokawa, S. Suzuki, N. Shibata, and Y. Arakawa, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C2-1889, 2004). However, in both studies the incompatibility group of the carrier plasmid was not determined, and in the latter work, cotransfer of another resistance gene(s) was not screened for. More recently, the presence of armA on a self-transferable IncN plasmid in an E. coli pig isolate from Spain has been reported (8).
We have demonstrated that armA, together with the ant3"9, sul1, and dfrXII genes, was part of functional transposon Tn1548 in plasmid pIP1204. This 16.6-kb transposon is a typical composite element flanked by two copies of IS6 in direct orientation. Tn1548 transposed consecutively in E. coli by replicative transposition, which led to the formation of cointegrates and which generated a target duplication of 8 bp. The functionality of Tn1548 under natural conditions was confirmed by its presence on plasmids of different incompatibility groups (7, 8).
Taken together, these data support the notion that the spread of armA results from both conjugation and transposition. These combinatorial genetics account for the documented worldwide dissemination of aminoglycoside resistance by 16S rRNA methylation in enterobacteria of human or animal origin and in A. baumannii (7, 8, 27; Wachino et al., 44th ICAAC).
Acknowledgments
We thank G. Arlet and L. Poirel for the gifts of strains.
REFERENCES
- 1.Beauclerck, A. A., and E. Cundliffe. 1987. Sites of action of two ribosomal RNA methylases responsible for resistance to aminoglycosides. J. Mol. Biol. 193:661-671. [DOI] [PubMed] [Google Scholar]
- 2.Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472. [DOI] [PubMed] [Google Scholar]
- 3.Chandler, M., and D. J. Galas. 1983. Cointegrate formation mediated by Tn9. II Activity of IS1 is modulated by external DNA sequences. J. Mol. Biol. 170:61-91. [DOI] [PubMed] [Google Scholar]
- 4.Comité de l'Antibiogramme de la Société Française de Microbiologie. 2004. Communiqué 2004. [Online.] http://www.sfm.asso.fr/.
- 5.Davies, J., and B. D. Davis. 1968. Misreading of ribonucleic acid code words induced by aminoglycoside antibiotics. The effect of drug concentration. J. Biol. Chem. 243:3312-3316. [PubMed] [Google Scholar]
- 6.Galas, D. J., and M. Chandler. 1982. Structure and stability of Tn9-mediated cointegrates, evidence for two pathways of transposition. J. Mol. Biol. 154:245-272. [DOI] [PubMed] [Google Scholar]
- 7.Galimand, M., P. Courvalin, and T. Lambert. 2003. Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob. Agents Chemother. 47:2565-2571. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gonzáles-Zorn, B., et al. 2005. armA and aminoglycoside resistance in Escherichia coli. Emerg. Infect. Dis. 11:954-956. [DOI] [PMC free article] [PubMed]
- 9.Hancock, R. E. W. 1981. Aminoglycoside uptake and mode of action with special reference to streptomycin and gentamicin. J. Antimicrob. Chemother. 8:249-276. [DOI] [PubMed] [Google Scholar]
- 10.Labigne-Roussel, A., G. Gerbaud, and P. Courvalin. 1981. Translocation of sequences encoding antibiotic resistance from the chromosome to a receptor plasmid in Salmonella ordonez. Mol. Gen. Genet. 182:390-408. [DOI] [PubMed] [Google Scholar]
- 11.Mabilat, C., and S. Goussard. 1993. PCR detection and identification of genes for extended-spectrum β-lactamases, p. 553-559. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology: principles and applications. American Society for Microbiology, Washington, D.C.
- 12.Magnet, S., P. Courvalin, and T. Lambert. 2001. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob. Agents Chemother. 45:3375-3380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Magnet, S., T. A. Smith, R. Zheng, P. Nordmann, and J. S. Blanchard. 2003. Aminoglycoside resistance resulting from tight drug binding to an altered aminoglycoside acetyltransferase. Antimicrob. Agents Chemother. 47:1577-1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ménard, R., C. Molinas, M. Arthur, J. Duval, P. Courvalin, and R. Leclercq. 1993. Overproduction of 3′-aminoglycoside phosphotransferase type I confers resistance to tobramycin in Escherichia coli. Antimicrob. Agents Chemother. 37:78-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Moazed, D., and H. F. Noller. 1987. Interaction of antibiotics with functional sites in 16S ribosomal RNA. Nature 327:389-394. [DOI] [PubMed] [Google Scholar]
- 16.Mollet, B., S. Iida, J. Shepherd, and W. Arber. 1983. Nucleotide sequence of IS26, a new prokaryotic mobile element. Nucleic Acids Res. 18:6319-6330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Moore, R. A., D. Deshazer, S. Reckseidler, A. Weissman, and D. E. Woods. 1999. Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 43:465-470. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.O'Connor, M., E. A. De Stasio, and A. E. Dahlberg. 1991. Interaction between 16S ribosomal RNA and ribosomal protein S12: differential effects of paromomycin and streptomycin. Biochimie 73:1493-1500. [DOI] [PubMed] [Google Scholar]
- 19.Purohit, P., and S. Stern. 1994. Interactions of a small RNA with antibiotic and RNA ligands of the 30S subunit. Nature 370:659-662. [DOI] [PubMed] [Google Scholar]
- 20.Sambrook, J., and D. Russel. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
- 21.Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular genetics of aminoglycoside resistant genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 57:138-163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Sutcliffe, J. G. 1978. Complete nucleotide sequence of the Escherichia coli plasmid pBR322. Cold Spring Harbor Symp. Quant. Biol. 43:77-90. [DOI] [PubMed] [Google Scholar]
- 23.Taber, H. W., J. P. Mueller, P. F. Miller, and A. Arrow. 1987. Bacterial uptake of aminoglycoside antibiotics. Microbiol. Rev. 51:439-457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Trieu-Cuot, P., and P. Courvalin. 1985. Transposition behavior of IS15 and its progenitor IS15-Δ: are cointegrates exclusive end products? Plasmid 14:80-89. [DOI] [PubMed] [Google Scholar]
- 25.Wood, W. B. 1966. Host specificity of DNA produced by Escherichia coli: bacterial mutations affecting the restriction and the modification of DNA. J. Mol. Biol. 16:118-133. [DOI] [PubMed] [Google Scholar]
- 26.Woodcock, J., D. Moazed, M. Cannon, J. Davies, and H. F. Noller. 1991. Interaction of antibiotics with A- and P-site-specific bases in 16S ribosomal RNA. EMBO J. 10:3099-3103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yan, J.-J., J.-J. Wu, W.-C. Ko, S.-H. Tsai, C.-L. Chuang, H.-M. Wu, Y.-J. Lu, and J.-D. Li. 2004. Plasmid-mediated 16S rRNA methylases conferring high-level aminoglycoside resistance in Escherichia coli and Klebsiella pneumoniae isolates from two Taiwanese hospitals. J. Antimicrob. Chemother. 54:1007-1012. [DOI] [PubMed] [Google Scholar]
- 28.Yoshizawa, S., D. Fourmy, and J. D. Puglisi. 1999. Recognition of the codon-anticodon helix by ribosomal RNA. Science 285:1722-1725. [DOI] [PubMed] [Google Scholar]