Functional Identification of Novel Genes Involved in the Glutathione-Independent Gentisate Pathway in Corynebacterium glutamicum

Abstract

Corynebacterium glutamicum used gentisate and 3-hydroxybenzoate as its sole carbon and energy source for growth. By genome-wide data mining, a gene cluster designated ncg12918-ncg12923 was proposed to encode putative proteins involved in gentisate/3-hydroxybenzoate pathway. Genes encoding gentisate 1,2-dioxygenase (ncg12920) and fumarylpyruvate hydrolase (ncg12919) were identified by cloning and expression of each gene in Escherichia coli. The gene of ncg12918 encoding a hypothetical protein (Ncg12918) was proved to be essential for gentisate-3-hydroxybenzoate assimilation. Mutant strain RES167Δncg12918 lost the ability to grow on gentisate or 3-hydroxybenzoate, but this ability could be restored in C. glutamicum upon the complementation with pXMJ19-ncg12918. Cloning and expression of this ncg12918 gene in E. coli showed that Ncg12918 is a glutathione-independent maleylpyruvate isomerase. Upstream of ncg12920, the genes ncg12921-ncg12923 were located, which were essential for gentisate and/or 3-hydroxybenzoate catabolism. The Ncg12921 was able to up-regulate gentisate 1,2-dioxygenase, maleylpyruvate isomerase, and fumarylpyruvate hydrolase activities. The genes ncg12922 and ncg12923 were deduced to encode a gentisate transporter protein and a 3-hydroxybenzoate hydroxylase, respectively, and were essential for gentisate or 3-hydroxybenzoate assimilation. Based on the results obtained in this study, a GSH-independent gentisate pathway was proposed, and genes involved in this pathway were identified.

Many members of Corynebacterium occur in soil and sediments and take part in decomposition of aromatic compounds (3, 7, 8, 11, 28, 47). Other Corynebacterium species have been isolated from human or animal specimen or agricultural products (6, 55). The universal occurrence and versatile metabolism of organisms belonging to the genus Corynebacterium make this group of bacteria ecologically, medically, and economically important. For example, Corynebacterium glutamicum produces several amino acids used commercially and is a model organism for studying the physiology and biochemistry of this group of bacteria. Recently, the entire genome of C. glutamicum ATCC 13032 was sequenced (26, 33), and several gene clusters encoding enzymes related to aromatic compounds of catabolism have been revealed, but the identities and functions of these genes, except for a catechol 1,2-dioxygenase gene (46), have not been characterized.

Gentisate and substituted gentisates are key intermediates during aerobic degradation of many aromatic compounds, such as 3-hydroxybenzoate (18, 31, 43), 3,5- or 2,5-xylenol (29, 41), salicylate (27, 40, 42), 3,6-dichloro-2-methoxybenzoate (54), and naphthalene (17, 19, 37). In the gentisate pathway, maleylpyruvate is produced, following the aromatic ring cleavage catalyzed by gentisate 1,2-dioxygenase. Further conversion of maleylpyruvate to central metabolic pathways proceeds via (i) direct hydrolysis to pyruvate and maleate (4, 24, 41) or (ii) isomerization to fumarylpyruvate and subsequent hydrolysis to fumarate and pyruvate (4, 10, 31, 48). In the latter pathway, isomerization of maleylpyruvate to fumarylpyruvate is catalyzed by either a glutathione (GSH)-dependent maleylpyruvate isomerase that has been characterized at enzymatic and genetic levels (31, 43, 58), or a second GSH-independent maleylpyruvate isomerase that was characterized based on the results of enzymatic activity assays of gram-positive organisms representing the genera Bacillus, Arthrobacter, Corynebacterium, Nocardia, and Rhodococcus (21). This GSH-independent maleylpyruvate isomerase has not been characterized at the genetic level, and the GSH-independent pathway is largely unclear. In this paper, we report the functional identification of the GSH-independent maleylpyruvate isomerase gene and of other novel genes involved in this GSH-independent gentisate pathway of C. glutamicum.

MATERIALS AND METHODS

Bacterial strains, plasmids, and cultural conditions.

The relevant bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli was grown aerobically on a rotary shaker (150 rpm) at 37°C in Luria-Bertani (LB) broth or on an LB plate with 1.5% (wt/vol) agar. C. glutamicum strains were routinely grown in LB medium supplemented with 2 g liter⁻¹ of glucose or in mineral salts medium (35), pH 8.4, supplemented with 0.05 g liter⁻¹ of yeast extract to meet the requirement of vitamins for the strains on a rotary shaker (150 rpm) at 30°C. Aromatic compounds were added at a final concentration of 200 mg liter⁻¹ (wt/vol) where they served as carbon and energy sources. Cellular growth was monitored by measuring turbidity at 600 nm. For generation of mutants and maintenance of C. glutamicum, BHIS medium (brain heart broth with 0.5 M sorbitol) was used. When needed, antibiotics were used at the following concentrations: kanamycin, 50 μg ml⁻¹ for E. coli and 25 μg ml⁻¹ for C. glutamicum; chloramphenicol, 20 μg ml⁻¹ for E. coli and 10 μg ml⁻¹ for C. glutamicum; ampicillin, 100 μg ml⁻¹ for E. coli.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant characteristic(s)	Source or reference
Strains
E. coli
JM109	recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi Δ(lac-proAB) F′(traD36 proAB lacIqlacZΔM15)	Stratagene (catalogue no. 200235)
BL21(DE3)	hsdS gal (λcIts857 ind-l Sam7 nin-5 lacUV5-T7 gene 1)	Novagen (catalogue no. 69387-3)
C. glutamicum
RES167	Restriction-deficient mutant of ATCC13032; Δ(cglIM-cglIR-cglIIR)	University of Bielefeld
RES167Δncg12918	Fragment of DNA encoding for amino acids 7-147 of Ncg12918 was deleted	This study
RES167Δncg12919	Fragment of DNA encoding for amino acids 109-168 of Ncg12919 was deleted	This study
RES167Δncg12920	Fragment of DNA encoding for amino acids 126-219 of Ncg12920 was deleted	This study
RES167Δncg12921	Fragment of DNA encoding for amino acids 52-243 of Ncg12921 was deleted	This study
RES167Δncg12922	Fragment of DNA encoding for amino acids 114-302 of Ncg12922 was deleted	This study
RES167Δncg12923	Fragment of DNA encoding for amino acids 137-331 of Ncg12923 was deleted	This study
Plasmids
pK18mobsacB	Mobilizable vector; allows for selection of double-crossover in C. glutamicum	45
pK18mobsacBΔncg12918	Carrying ncg19218 deletion (refer to RES167Δncg12918)	This study
pK18mobsacBΔncg12919	Carrying ncg19219 deletion (refer to RES167Δncg12919)	This study
pK18mobsacBΔncg12920	Carrying ncg19220 deletion (refer to RES167Δncg12920)	This study
pK18mobsacBΔncg12921	Carrying ncg19221 deletion (refer to RES167Δncg12921)	This study
pK18mobsacBΔncg12922	Carrying ncg19222 deletion (refer to RES167Δncg12922)	This study
pK18mobsacBΔncg12923	Carrying ncg19223 deletion (refer to RES167Δncg12923)	This study
pXMJ19	Shuttle vector (CamrPtac lacq pBL1 oriVC.g. pK18 oriVE.c.)a	30
pXMJ19-ncg12918	Carrying ncg19218 (to generate complementation for ncg12918)	This study
pXMJ19-ncg12919	Carrying ncg19219 (to generate complementation for ncg12919)	This study
pXMJ19-ncg12921	Carrying ncg19221 (to generate complementation for ncg12921)	This study
pXMJ19-ncg12922	Carrying ncg19222 (to generate complementation for ncg12922)	This study
pXMJ19-ncg12923	Carrying ncg19223 (to generate complementation for ncg12923)	This study
pET28a	Expression vector with N-terminal hexahistidine affinity tag	Novagen
pET28a-ncg12918	pET28a derivative for expression of ncg12918	This study
pET28a-ncg12919	pET28a derivative for expression of ncg12919	This study
pET28a-ncg12920	pET28a derivative for expression of ncg12920	This study
pGEMT-easy	Cloning of PCR products	Promega
pWWF53	739-bp NdeI-EcoRI-cut PCR fragment containing nagL inserted into pET5a	58
pWWF96	800-bp MspA1I fragment containing nagK subcloned into pUC18	58

^aE.c., E. coli; C.g., C. glutamicum.

DNA extraction, manipulation, and electroporation.

The total genomic DNA of C. glutamicum was isolated according to the procedure of Tauch et al. (49). Plasmid isolation, DNA manipulation, and agarose gel electrophoresis were carried out as described by Sambrook et al. (44). DNA restriction enzymes, ligase, and DNA polymerase were used as recommended by the manufacturer's instructions. Restricted DNA fragments were separated by agarose gel electrophoresis and were purified with the agarose gel DNA fragment recovery kit (TaKaRa). E. coli and C. glutamicum were transformed by electroporation according to the method of Tauch et al. (50).

Amplification of DNA fragments with PCR and construction of plasmids.

PCRs were performed by using Pyrobest DNA polymerase (TaKaRa) or Taq DNA polymerase (Promega, Madison, Wis.). PCR products were purified using an agarose gel DNA fragment recovery kit. Cloning of PCR fragments was performed with the pGEM-T Easy vector systems (Promega, Madison, Wis.).

Various plasmids (Table 1) for genetic disruption and complementation in C. glutamicum and for expression in E. coli were constructed with pK18mobsacB, pXMJ19, and pET28a. Primers used for amplification of the entire or partial target gene fragments are listed in Table 2. Deletion of genes on plasmids was performed by either gene splicing by overlap extension (SOEing) (25) on ncg12919 or by removal of regions of each gene on ncg12918, ncg12920, ncg12921, ncg12922, and ncg12923 through restriction enzyme digestion (Fig. 1). The disrupted genes were fused to pK18mobsacB to generate plasmids pK18mobsacBΔncg12918, pK18mobsacBΔncg12919, pK18mobsacBΔncg12920, pK18mobsacBΔncg12921, pK18mobsacBΔncg12922, and pK18mobsacBΔncg12923.Genetically complementary plasmids pXMJ19-ncg12918, pXMJ19-ncg12919, pXMJ19-ncg12921, pXMJ19-ncg12922, and pXMJ19-ncg12923 were created by insertion of each PCR-amplified intact gene into pXMJ19. Except for ncg12923, which kept its native ribosome-binding site in pXMJ19-ncg12923, all the other genes were equipped with strong consensus ribosome-binding sites (1). Plasmids for expression of the target genes in E. coli were constructed from each PCR-amplified gene and pET28a.

TABLE 2.

Primers used in this work^a

Name	Sequence (restriction enzyme)	Notes
D12918F	GATTCTAGAGAAGGCGAGATGGCAGTT (XbaI)	To generate pK18mobsacB-Δncg12918
D12918R	ACAGAATTCCACATTCCCGCAAAGGA (EcoRI)
E12918F	AACACATATGACAACTTTCCACGA (NdeI)	To generate pET28a-ncg12918
E12918R	GATAAGCTTAACATGGTCATTTAAGAA (HindIII)
C12918F	GATTCTAGAAAAGGAGGACAACCATGACAACTTTCCACGA (XbaI)	To generate pXMJ19-ncg12918
C12918R	ACAGAATTCTGGAAACTACAGCCAGC (EcoRI)
DC12919a	GATTCTAGAAAAGGAGGACAACCATGCGTCTTGCAACAAT (XbaI)	To generate pK18mobsacB-Δncg12919;
D12919b	GACTTGCCCTGGTGCCACAACATCATCGAAAGGTCC	DC12919a and DC12919d also used
D12919c	GTGGCACCAGGGCAAGTC	for construction of pXMJ19-ncg12919
DC12919d	ACAGAATTCATTTATTCAAACACCGTCT (EcoRI)
E12919F	AACACATATGCGTCTTGCAACAAT (NdeI)	To generate pET28a-ncg12919
E12919R	ACGCGGATCCTTTATTCAAACACCGTC (BamHI)
E12920F	AACACATATGGGCGCCCCAGGTA (NdeI)	To generate pK18mobsacB-Δncg12920 and pET28a-ncg12920
D12920F	ACAGAATTCAGGACTCCAACAATGGG (EcoRI)
DE12920R	ACGCGGATCCGCAAGACGCATAAGTTCTA (BamHI)
D12921F	GATTCTAGAGCCCAAGATGGTGAGG (XbaI)	To generate pK18mobsacB-Δncg12921
D12921R	ACAGAATTCGCCCATTGTTGGAGTC (EcoRI)
C12921F	GATTCTAGAAAAGGAGGACAACCATGGATAACGTCGCC (XbaI)	To generate pXMJ19-ncg12921
C12921R	ACAGAATTCGAATCTAAGTATTCCCCTC (EcoRI)
DC12922F	GATTCTAGAAAAGGAGGACAACCATGACATCACACGCACCAG (XbaI)	To generate pK18mobsacB-Δncg12922 and pXMJ19-ncg12922
DC12922R	ACAGAATTCGCGGAGTTCATCAGAAT (EcoRI)
DC12923F	ACGCGGATCCAGGAAACTTCACCCATGTC (BamHI)	To generate pK18mobsacB-Δncg12923 and pXMJ19-ncg12923
DC12923R	GCAACCCGGGCCTCAAGCTCAATTTCTCAA (SmaI)

^aUnderlined sites indicate restriction enzyme cutting sites added for cloning. Letters in italics denote the annealing regions for gene SOEing PCR. The ribosome binding sites are given in boldface.

FIG. 1.

Physical map of the genetic cluster of the gentisate pathway in Corynebacterium glutamicum (A), construction of plasmids for gene disruption and complementation (B), and the search for ncg homologues in different gram positive bacteria (C). (A) Open reading frames (ORFs) are marked by open arrows, and the deleted regions are in grey. (B) The restriction sites are indicated as follows: E, EcoRI; X, XbaI; B, BamHI; N, NdeI; H, HindIII; S, SmaI; Mb, MboI; Hi, Hin1I; and Sd, SduI. An asterisk (*) represents areas deleted by gene SOEing (25). (C) Numbers above each ORF indicate the identity (expressed as a percentage) to the corresponding ORF of Corynebacterium glutamicum. GenBank accession numbers are as follows: NC0034540 (ncg12918 to ncg12921) for Corynebacterium glutamicum, NC004369 (ce2858 to ce2861) for Corynebacterium efficiens, AB112586 for Streptomyces sp. strain WA46, nfa2300 and nfa42170 for Nocardia farcinica IFM 10152, NC003888 (sco1959 and sco1960) for Streptomyces coelicolor A3 (2), NC003155 (sav6284 and sav6285) for Streptomyces avermitilis MA-4680, and NC006085 (ppa0805 and ppa0806) for Propionibacterium acnes KPA171202. Data for Bacillus halodurans C-125 are from Zhang et al. (57).

Genetic disruption and complementation in C. glutamicum.

The pK18mobsacB derivatives were transformed into C. glutamicum RES167 by electroporation (50). Screening for the first and second recombination events, as well as confirmation of the chromosomal deletion, was performed as described previously (39). The resulting strains were designated C. glutamicum RES167Δncg12918 to RES167Δncg12923 (Table 1). The deletion of the target genes in pK18mobsacB derivatives and in C. glutamicum mutants was verified by DNA sequencing.

Complementary plasmids pXMJ19-ncg12918, pXMJ19-ncg12919, pXMJ19-ncg12921, pXMJ19-ncg12922, and pXMJ19-ncg12923 were introduced into respective mutants by electroporation. Expression of each gene in C. glutamicum was induced by the direct addition of 0.6 mM IPTG (isopropyl-β-d-thiogalactopyranoside) to cultures.

Heterologous expression of various genes in E. coli and purification of recombinant proteins.

To facilitated purification of the proteins Ncg12918, Ncg12919, and Ncg12920, the hexahistidine cascade of pET28a was fused to ncg12918, ncg12919, and ncg12920 at their 5′ ends during plasmid construction. Plasmids (pET28a-ncg12918, pET28a-ncg12919, and pET28a-ncg12920) were electroporated into E. coli BL21(DE3). Synthesis of recombinant proteins in E. coli BL21(DE3) cells was initiated by the addition of 0.6 mM IPTG, and cultivation was continued for additional 3 h. Cells were harvested by centrifugation and were disrupted by sonification. Cellular lysates were fractionated (for details, see the following text), and the supernatant was used for protein purification. Recombinant proteins were purified with the His-Bind protein purification kit (Novagen, Madison, WI) according to the manufacturer's instructions.

Preparation of cellular lysate and assays for enzymatic activity.

Cells were harvested by centrifugation at 10,000 × g, washed twice with ice-cold 50 mM Tris-HCl buffer (pH 8.0), resuspended in the same buffer, and disrupted by sonification in an ice-water bath. After centrifugation at 20,000 × g for 30 min at 4°C, the clear supernatant was used for enzymatic assays and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. All enzymatic assays were performed with a Tris-HCl buffer (50 mM; pH 8.0). Gentisate 1,2-dioxygenase activity was measured spectrophotometrically by measuring the increase of absorption at 330 nm, due to the formation of maleylpyruvate, and was calculated with extinction coefficient of 13,000 M⁻¹ cm⁻¹ (58). To compare the ability to synthesize gentisate 1,2-dioxygenase, C. glutamicum RES167 and mutant RES167Δncg12920 were cultivated in mineral salts medium broth with acetate and gentisate as carbon sources. Maleylpyruvate isomerase was qualitatively monitored by measuring the decrease of absorbance at 330 nm due to the disappearance of maleylpyruvate and the increase of absorption at 340 nm due to the formation of fumarylpyruvate, and it was quantitatively determined in the presence of excess fumarylpyruvate hydrolase by measuring the decrease in A₃₃₀ (58). Fumarylpyruvate hydrolase was assayed by measuring the decrease of A₃₄₀ due to fumarylpyruvate disappearance, and the activity was calculated with an extinction coefficient of 9,400 M⁻¹ cm⁻¹ (58). One unit of enzyme activity is defined as the amount required for the conversion of 1 mmol of substrate or product per min.

SDS-PAGE and determinations of molecular mass of the purified enzymes.

SDS-PAGE was conducted with 5% stacking gels and 12% resolving gel and was run with a Mini-PROTEIN II Electrophoresis Cell (Bio-Rad) according to the manufacturer's instructions. After electrophoresis, the protein bands were visualized by Coomassie brilliant blue staining. Apparent molecular mass was estimated according to the relative mobility of protein markers, with molecular masses ranging from 14 to 97 kDa. The native molecular masses of the enzymes were estimated by gel filtration chromatography on a prepacked Superdex 200 column (Pharmacia). The column was equilibrated and eluted with 0.05 M Tris-HCl (pH 7.6) containing 100 mM NaCl at a flow rate of 0.4 ml min⁻¹. Molecular masses were calculated according to their elution volumes and calibrated with a standard molecular mass kit (MW-GF-1000; Sigma). Protein concentration was determined according to the method of Bradford (5), with bovine serum albumin as the standard.

Enzymatic preparation of maleylpyruvate and fumarylpyruvate and operation of high-performance ion chromatography.

Maleylpyruvate and fumarylpyruvate and maleylpyruvate isomerase and fumarylpyruvate hydrolase substrates were freshly prepared. Maleylpyruvate was prepared by oxidation of 100 mM gentisate with purified gentisate 1,2-dioxygenase. Fumarylpyruvate was prepared by incubation of maleylpyruvate with crude maleylpyruvate isomerase of Ralstonia sp. U2 expressed in E. coli BL21/pWWF53 or purified recombinant maleylpyruvate isomerase of C. glutamicum. All these preparations were performed with 50 mM Tris-HCl buffer (pH 8.0) and were monitored by determination of UV absorption.

Fumarate and pyruvate were identified by ion chromatography (DX-600; Dionex, California) equipped with an electrochemical detector (ED50). A total of 25 μl of sample was injected onto an IonPac AS11 analytical column with an IonPac AG11 guard column and run with 22 mM NaOH as the eluant at a flow rate of 0.2 ml min⁻¹. Fumarate and pyruvate were identified by comparison of elution times of components of tested samples and of the pure fumarate and pyruvate.

Transformation of 3-hydroxybenzoate by E. coli JM109/pXMJ19-ncg12923 and determination of 3-hydrodroxybenzoate and gentisate by high-performance liquid chromatography.

E. coli JM109/pXMJ19-ncg12923 cells growing in LB were induced at an optical density at 600 nm of 0.4 with 0.6 mM IPTG. After an additional 3-h cultivation, cells were harvested by centrifugation, washed with Tris-HCl buffer (50 mM; pH 8.0), and resuspended in the same buffer at an optical density at 600 nm of 2.5. Transformation of 3-hydroxybenzoate into gentisate was started by the addition of 2 mM 3-hydroxybenzoate into this suspension and shaking at 30°C. After a 16-h incubation, samples were acidified to pH 2.0 and extracted by ethyl acetate, dried by being blown with N₂, and dissolved in acetonitrile. Determination of 3-hydroxybenzoate and gentisate was performed with the HPLC 1050 system, which is equipped with a photodiode array detector and an Extend-C18 column (4.6 mm by 240 mm by 0.5 mm). After injection into the column, samples were eluted with 20% (vol/vol) methanol in 100 mM ammonium acetate buffer (pH 4.2). Gentisate and 3-hydroxybenzoate were typically eluted in this system at 4.06 min and 7.65 min, respectively.

Sequence data analysis.

The genome sequences of C. glutamicum ATCC13032 (accession no. NC 003450) and amino acid sequences of gentisate 1,2-dioxygenase, maleylpyruvate isomerase, and fumarylpyruvate hydrolase of Ralstonia strain U2 (AF036940) were retrieved from GenBank. Sequence comparisons and database searches were carried out using BLAST programs at the BLAST server of the National Center for Biotechnology Informaiton (http://www.ncbi.nlm.nih.gov). Pairwise and multiple protein sequence alignments were made with the CLUSTAL W program (51). Motif searches were performed with the tools CD-search (http://www.ncbi.nlm.nih.gov), Motif (http://motif.genome.jp/), and Network Protein Sequence Analysis (http://npsa-pbil.ibcp.fr) (12).

RESULTS

Assimilation of gentisate/3-hydroxybenzoate and detection of enzymatic activity.

C. glutamicum used 4-hydroxybenzoate, benzoate, protocatechuate, gentisate, and 3-hydroxybenzoate as sole carbon and energy sources for growth. When the cells were cultivated with gentisate or 3-hydroxybenzoate and were assayed for ring cleavage enzymatic activity, gentisate 1,2-dioxygenase activity (but not catechol 1,2-dioxygenase, catechol 2,3-dioxygenase, or protocatechuate 3,4-dioxygenase activity) was detected. Gentisate 1,2-dioxygenase activity was not observed when 4-hydroxybenzoate, benzoate, protocatechuate, or acetate was used as a substrate for growth. These results indicated that gentisate and 3-hydroxybenzoate were assimilated through the gentisate pathway and that gentisate 1,2-dioxygenase was inducible in C. glutamicum.

Mining the genomic data of C. glutamicum.

By use of the gentisate 1,2-dioxygenase (NagI) of Ralstonia strain U2 and results of a BLAST search, the gene (ncg12920) encoding the putative gentisate 1,2-dioxygenase of C. glutamicum was identified. The ncg12920 of C. glutamicum is located at bp 3225561 to 3226688 (Fig. 1A), encoding a putative protein of 376 amino acid residues with a molecular mass of 41.5 kDa. A potential ribosome-binding site (GGAGGA) was found eight nucleotides upstream of the putative translational start codon (ATG). The Ncg12920 shares amino acids sequence identities of 60, 36, 35, 34, and 30% with the identified gentisate 1,2-dioxygenase of Streptomyces sp. strain WA46 (27), Sphingomonas sp. strain RW5 (54), Haloferax sp. strain D1227 (16), Pseudomonas alcaligenes (15), and Ralstonia sp. strain U2 (58), respectively (Table 3).

TABLE 3.

BLAST searching results and annotated and identified functions of genes involved in gentisate pathway of C. glutamicum

Gene	Position (bp)/gene product	Annotated function of gene products	Identified function of gene products	Sequence identity (%)	Related gene product (organism; accession no.)
ncg12918	3223990-3224715/241	Hypothetical protein	GSH-independent maleylpyruvate isomerase	202/244 (82)	Hypothetical protein (C. efficiens YS-314; BAC19668)
				85/233 (36)	Hypothetical protein (Streptomyces sp. strain WA46; SdgF/BAC78377)
				75/236 (31)	Hypothetical protein (Streptomyces coelicolor A3(2); CAB38149)
				64/231 (27)	Hypothetical protein (Streptomyces avermitilis MA-4680; BAC73996)
ncg12919	3224716-3225555/279	2-Hydroxyhepta-2,4-dine-1,7-dioatesomerase	Fumarylpyruvate hydrolase	244/279 (87)	Conserved hypothetical protein (C. efficiens YS-314; BAC19669)
				125/278 (44)	Putative hydrolase (Streptomyces sp. strain WA46; SdgE/BAC78376)
				107/271 (39)	2-Hydroxyhepta-2,4-diene- 1,7-dioate isomerase (B. halodurans C125; BH2000/BAB05719)
				52/168 (30)	Fumarylpyruvate hydrolase (Ralstonia sp. strain U2; NagK/AF036940)
ncg12920	3225561-3226688/375	Gentisate 1,2-dioxygenase	Gentisate 1,2-dioxygenase	347/375 (92)	Putative 1,2-dioxygenase (C. efficiens YS-314; BAC19670)
				211/351 (60)	Gentisate 1,2-dioxygenase (Streptomyces sp. strain WA46; SdgD/BAC78375)
				128/353 (36)	Gentisate 1,2-dioxygenase (Sphingomonas sp. strain RW5; GtdA/CAA12267)
				124/340 (34)	Gentisate 1,2-dioxygenase (B. halodurans C-125; BH2002/B83930)
ncg12921	3226908-3227684/258	Transcriptional regulator	Transcriptional regulator (IclR family)	199/255 (78)	Putative transcription regulator (C. efficiens YS-314; BAC19671)
				75/223 (33)	Putative transcriptional regulator (Streptomyces sp. strain WA46; SdgR/BAC78374)
				79/236 (33)	PhtR (A. keysere; AAK16539)
				58/228 (25)	HmgR transcriptional repressor (P. putida; AAO12526)
ncg12922	3227749-3229083/444	Putative benzoate transporter	Gentisate transporter	359/446 (80)	Putative transport protein (C. efficiens YS-314; BAC19672)
				156/440 (35)	Benzoate transporter protein (Pseudomonas sp. strain ND6; BenK/AAP44250)
				150/445 (33)	Benzoate transport protein (Acinetobacter sp. strain ADP1; BenK/AAC46425)
				118/421 (28)	4-Hydroxybenzoate transport protein (P. putida; PcaK/AAA85137)
ncg12923	3229120-3230448/442	Putative hydroxylase/monooxygenase	3-Hydroxybenzoate 6-hydroxylase	333/439 (75)	Conserved hypothetical protein (C. efficiens YS-314; BAC19673)
				132/404 (32)	Putative 3-hydroxybenzoate hydroxylase (Salmonella enterica subsp. enterica; CAD02555)
				122/451 (27)	Salicylate 1-monooxygenase (P. putida strain PpG7; P23262)
				88/367 (23)	4-Aminobenzoate hydroxylase (A. bisporusBAA07468)

Neighbors to ncg12920 were the putative fumarylpyruvate hydrolase gene (ncg12919), the unknown protein gene (ncg12918), and the putative regulator gene (ncg12921). Further upstream from ncg12920 were two genes, ncg12922 and ncg12923, which encoded the putative mono-oxygenase and transporter protein. The latter two genes were orientated in opposite directions from ncg12920 (Table 3 and Fig. 1A).

Functional identification of genes ncg12919 and ncg12920.

According to the BLAST search results (Table 3), ncg12920 encoded a putative gentisate 1,2-dioxygenase. This gene was cloned into E. coli, and the resulting E. coli BL21/pET28a-ncg12920 actively synthesized gentisate 1,2-dioxygenase. When cellular lysate was analyzed with SDS-PAGE, a prominent 44-kDa protein was observed (Fig. 2, lane 3). This protein was purified (Fig. 2, lane 4), and it showed gentisate 1,2-dioxygenase activity of 306.4 U mg⁻¹ of protein. When analysis with gel permeation chromatography was carried out, it was eluted as a molecule of 180 kDa. Thus, the gentisate 1,2-dioxygenase of C. glutamicum was a homotetramer. The ncg12920 encoding the gentisate 1,2-dioxygenase was further confirmed by disruption of the ncg12920 gene in C. glutamicum. When this gene was disrupted, the mutant lost the ability to synthesize gentisate 1,2-dioxygenase. During our preparation of this paper, we found that ncg12920 had also been functionally expressed in E. coli by Hintner et al. (23).

FIG. 2.

Overexpressed and purified Ncg12920, Ncg12919, and Ncg12918 from recombinant Escherichia coli strains. M, protein marker. Molecular masses are indicated at the left. Lanes 1, 5, and 9, E. coli/pET28a; lane 2, E. coli/pET28a-ncg12920 (not induced); lane 3, E. coli/pET28a-ncg12920 (induced); lane 4, purified Ncg12920; lane 6, E. coli/pET28a-ncg12919 (not induced); lane 7, E. coli/pET28a-ncg12919 (induced); lane 8, purified Ncg12919; lane 10, E. coli/pET28a-ncg12918 (not induced); lane 11, E. coli/pET28a-ncg12918 (induced); lane 12, purified Ncg12918.

Involvement of ncg12919 in the assimilation of gentisate and 3-hydroxybenzoate was demonstrated by gene disruption and complementation. A mutant of C. glutamicum at this locus lost the ability to grow with gentisate and 3-hydroxybenzoate, and complementation of this gene by the addition of plasmid pXMJ19-ncg12919 restored the ability to grow with the above substrate (Fig. 3A). The ncg12919 encoding fumarylpyruvate hydrolase was subsequently confirmed through heterologous expression in E. coli (Fig. 2) and enzymatic activity assay (Fig. 4A). Pyruvate and fumarate were identified as products of this enzymatic catalysis by high-performance ion chromatography. E. coli/pET28a-ncg12919 synthesized a recombiant protein of ca. 36 kDa during SDS-PAGE (Fig. 2, lane 7). When this protein was purified, it showed fumarylpyruvate hydrolase activity of 8.7 U mg⁻¹ of protein.

FIG. 3.

Phenotypic characterization of various genetically disrupted and complemented strains of Corynebacterium glutamicum. To observe the phenotypes after gene disruption or complementation, strains were cultivated with 3-hydroxybenzoate (A, B, C, E, and F) and the ncg12922 mutant was also tested for growth on gentisate (D). Bacterial growth after disruption and complementation of ncg12919 (A), ncg12918 (B), ncg12921 (C), ncg12922 (D and E), and ncg12923 (F) are shown. Symbols: ▪, parent strain RES167; •, mutants; ▴, complemented.

FIG. 4.

Determination of the fumarylpyruvate hydrolase activity of Ncg12919 (A) and the maleylpyruvate isomerase activity of Ncg12918 (B) in cellular lysates of recombinant Escherichia coli that harbors the corresponding genes of Corynebacterium glutamicum. The absorption spectra were recorded every 30 s.

The ncg12918 was essential to gentisate-3-hydroxybenzoate assimilation and encoded a novel GSH-independent maleylpyruvate isomerase.

The ncg12918 encoded a hypothetical protein, the function of which had not been identified. To identify the necessity of ncg12918 for gentisate-3-hydroxybenzoate assimilation, we disrupted this gene in C. glutamicum. The resulting mutant lost the ability to grow with gentisate and 3-hydroxybenzoate but retained the ability to grow with other aromatic compounds such as phenol, benzoate, 4-hydroxybenzoate, and protocatechuate. When complemented with plasmid pXMJ19-ncg12918, the ability to grow with gentisate and 3-hydroxybenzoate restored (Fig. 3B). This clearly indicated that ncg12918 was essential to gentisate and 3-hydroxybenzoate assimilation.

To further identify the function of ncg12918, this gene was cloned and expressed in E. coli. When the recombinant E. coli was induced with IPTG, a peptide of approximately 32 kDa was prominently synthesized (Fig. 2, lane 11). This protein was subsequently purified (Fig. 2, lane 12) and analyzed for enzymatic activity. Enzymatic assays showed that this protein catalyzed the isomerization of mayleypyruvate to fumarylpyruvate (Fig. 4B). The product of fumayrylpyruvate was tentatively identified according to its featured maximal absorptions at the following wavelengths: 335 nm at pH 1.0, 340 nm at pH 7.3, and 350 nm at pH 13, as shown previously (48). It was further confirmed to be fumarylpyruvate becuase fumarylpyruvate hydrolase from Ralstonia strain U2 converted it into fumarate and pyruvate, which were identified in our experiments by ion-exchange chromatography.

The catalysis with Ncg12918 was totally independent of GSH, as demonstrated by our experiments. (i) Addition of 0.02 mM glutathione did not stimulate the activity of Ncg12918. (ii) Additions of 1 mM each N-ethylmaleimide, p-chloromercuribenzoate, and iodoacetamide, which are typical -SH modifying agents, did not inhibit the activity of Ncg12918. The specific activity of purified maleylpyruvate isomerase was 19.4 U mg⁻¹ of protein. Thus, Ncg12918 represents a new category of maleylpyruvate isomerase that is different from the maleylpyruvate isomerase of Ralstonia sp. U2 needing GSH as a cofactor.

Identification of the regulator gene (ncg12921).

Upstream of the gentisate 1,2-dioxygenase gene (ncg12920), we located a putative regulator gene (ncg12921) (Fig. 1A; Table 3). Function of this gene was identified by gene disruption and complementation with C. glutamicum. As demonstrated by enzymatic assays, disruption of ncg12921 in C. glutamicum resulted in significant loss of the gentisate 1,2-dioxygenase (Ncg12920), maleylpyruvate isomerase (Ncg12918), and fumarylpyruvate hydrolase (Ncg12919) activities (Table 4). Thus, we tentatively concluded that Ncg12921 was an activator. When the mutant was complemented with pXMJ19-ncg12921, the gentisate 1,2-dioxygenase, maleylpyruvate isomerase, and fumarylpyruvate hydrolase activity levels were as high as they were in the parent strain or even higher (Table 4). Moreover, our experiment further demonstrated that ncg12921 was necessary for gentisate and 3-hydroxybenzoate assimilation. When ncg12921 was disrupted, the mutant strain RES167Δncg12921 lost its ability to grow on gentisate and 3-hydroxybenzoate; this ability was restored when the ncg12921 gene was supplied with pXMJ19-ncg12921 (Fig. 3C).

TABLE 4.

Enzymatic activities of gentisate 1,2-dioxygenase, maleylpyruvate isomerase, and fumarylpyruvate hydrolase in C. glutamicum RES167 (parent), RES167Δncg12921 (mutant), and RES167Δncg12921/pMXJ19-ncg12921 (complemented)^a

Strain	Sp act (U/mg of protein)
	Gentisate 1,2-dioxygenase	Maleylpyruvate isomerase	Fumarylpyruvate hydrolase
RES167	0.17	0.42	0.55
RES167Δncg12921	0.01	0.01	0.04
RES167Δncg12921/pMXJ19-ncg12921	0.22	0.54	0.31

^aAll strains were cultivated with 3-hydroxybenzoate plus acetate to serve as carbon sources.

Ncg12922 and Ncg12923 were essential to gentisate and 3-hydroxybenzoate assimilation, respectively.

According to BLAST results (Table 3), Ncg12922 showed moderate identity (28 to 33%) to the 4-hydroxybenzoate transport protein of Pseudomonas putida (22) and the benzoate transport protein of Acinetobacter ADP1 (9). Ncg12923 showed 27% and 23% identities to the salicylate 1-mono-oxygenase of Pseudomonas PpG7 (56) and 4-aminobenzoate hydroxylase of Agaricus bisporus (Table 3) (53), respectively. To identify their involvement in the gentisate pathway, both genes were disrupted in C. glutamicum. Disruption of ncg12922 in C. glutamicum resulted in the loss of the ability to grow with gentisate (Fig. 3D) but did not affect growth with 3-hydroxybenzoate (Fig. 3E) or other aromatic acids. When the mutant was complemented with pXMJ19-ncg12922, the ability to grow with gentisate was restored (Fig. 3D). With the results of BLAST search, we tentatively proposed that ncg12922 encoded a gentisate transporter protein in C. glutamicum.

The disruption of ncg12923 of C. glutamicum resulted in mutant strain RES167Δncg12923. We tested the ability of this mutant to assimilate the following compounds: 3-hydroxybenzoate, gentisate, benzoate, 4-hydroxybenzoate, and protocatechuate. Results showed that only growth with 3-hydroxybenzoate was disturbed and that growth of the mutant strain RES167Δncg12923 with gentisate and other aromatic substrates was the same as that of the parent strain RES167. Further, this inability to grow with 3-hydroxybenzoate of strain RES167Δncg12923 could be restored by complementation with pXMJ19-ncg12923 (Fig. 3F). E. coli cells synthesizing Ncg12923 actively transformed 3-hydroxybenzoate into gentisate. With the consideration that Ncg12923 exhibited moderate amino acid sequence identity (27%) to salicylate mono-oxygenase of Pseudomonas PpG7, we tentatively propose that this gene encoded a putative 3-hydroxybenzoate hydroxylase.

DISCUSSION

We demonstrated in this report that a GSH-independent pathway occurred in C. glutamicum for the assimilation of gentisate and 3-hydroxybenzoate (Fig. 5). Genes encoding the enzymes involved in this pathway were located at the genetic locus ncg12918-ncg12921 of the C. glutamicum chromosome. So far, this is the first time that a GSH-independent maleylpyruvate isomerase involved in aromatic assimilation has been identified at the genetic level. We further proposed, with results from BLAST searches, that putative GSH-independent maleylpyruvate isomerases occur in the following organisms (Fig. 1B): Corynebacterium efficiens YS314 (BAC19668), Streptomyces strain WA46 (SdgF), Streptomyces coelicolor A3 (CAB38149), Streptomyces avemitilis MA-4680 (BAC73996), Nocardia farcinica IFM 10152, and Propionibacterium acnes KPA171202. Previously, a GSH-dependent maleylpyruvate isomerase was characterized in Ralstonia strain U2 (58), and the -SH group of GSH was supposed to play a key role in catalysis (36). Although amino acid sequence analyses revealed that there were two cystein residues existing in the maleylpyruvate isomerase of C. glutamicum, our experiments suggested that the -SHs of those cystein residues did not play a role in catalysis, as indicated by the addition of -SH modifying agents, which did not inhibit the catalysis of isomerization. Moreover, sequence analysis of the GSH-dependent and -independent maleylpyruvate isomerases revealed that the two isomerases were neither homologous nor phylogenetically related. Therefore, Ncg12918 represents a novel type of maleylpyruvate isomerase.

FIG. 5.

Representative branches of gentisate pathway in gram-positive and -negative bacteria. Enzymes involved in the reactions were as follows: i, salicylyl-AMP ligase; ii, salicylyl-coenzyme A (CoA) synthetase; iii, salicylyl-CoA 5-hydroxylase; iv, gentisyl-CoA thioesterase; I, 3-hydroxybenzoate hydroxylase; I′, salicylate 5-hydroxylase; II/v/II′, gentisate 1,2-dioxygenase; III/vi, maleylpyruvate isomerase (GSH independent); III′, maleylpyruvate isomerase (GSH dependent); IV/vii/IV′, fumarylpyruvate hydrolase. The dotted line indicates that the reaction is proposed, based on the results of an enzymatic activity assay, and has not been characterized at the genetic level.

Assimilation of 3-hydroxybenzoate by C. glutamicum might require hydroxylation of 3-hydroxybenzoate into gentisate (2,5-dihydroxybenzoate) and active transport of gentisate into the cell if gentisate was provided in the culture medium. These functions were fulfilled by the genes ncg12922 and ncg12923, respectively, which were oriented in opposite directions to the genes ncg12918 to ncg12921. Regardless of low (200 mg/liter) or high (750 mg/liter) concentrations of gentisate (a high concentration of gentisate could promote its passive diffusion into cells), mutant RES167Δncg12922 did not grow with gentisate. Thus, active transport of gentisate into cells might be an important step during gentisate assimilation in C. glutamicum. Recently, Ishiyama et al. (27) reported that Streptomyces WA46 metabolized salicylate via gentisate as an intermediate, but gentisate did not support growth when supplied in culture medium; the reason attributed to this finding was that gentisate did not enter the cells (27). Ncg12923 was required only when 3-hydroxybenzoate as a substrate. It showed moderate identity (23 to 27%) to the 4-aminobenzoate hydroxylase from Agaricus bisporus and salicylate 1-mono-oxygenase of Pseudomonas putida PpG7. The substrate spectra of Ncg12922 and Ncg12923 were not defined in this study, and whether or not those genes involved in assimilation of other aromatic compounds needs further study.

Regulation of the gentisate pathway is also important for aromatic assimilation. In Ralstonia strain U2, regulation of gentisate pathway was achieved through a LysR-type transcriptional activator (32). Located upstream of the gentisate 1,2-dioxygenase gene (ncg12920), ncg12921 encoded a regulator. As demonstrated in this study, the activation of ncg12918 to ncg12920 genes required the coexistence of the Ncg12921 and gentisate (or 3-hydroxybenzoate). Ncg12921 exhibits moderate identities to the transcriptional regulators of the IclR family for aromatic assimilation pathways, including PhtR (33%) of the phthalate catabolism pathways in Arthrobacter keyseri 12B (13), SdgR (33%) of Streptomyces sp. strain WA46, HmgR (25%) of the homogentisate degradation pathways in P. putida (2), PcaU (23%) and PobR (16%) of the 4-hydroxybenzoate and protocatechuate degradation pathways in Acinetobacter sp. strain ADP1 (34), and PcaR (23%) of the protocatechuate degradation pathways in P. putida (20). That Ncg12921 behaves as a positive regulator is supported by genetic organization and sequence analyses (52). Like other IclR-type regulators such as PcaU from Acinetobacter sp. strain ADP1, PcaR from Rhodococcus opacus (14), and NpdR from Rhodococcus opacus HL PM-1 (38), IclR-type regulators lie upstream of their target gene cluster, are transcribed in the opposite direction, and contain an HTH motif at the N terminus (positions 35 to 56 of Ncg12921).