Genetic reduction of skeletal muscle glycogen synthase 1 abundance reveals that the refeeding‐induced reversal of elevated insulin‐stimulated glucose uptake after exercise is not attributable to achieving a high muscle glycogen concentration

Seong Eun Kwak; Haiyan Wang; Xiufang Pan; Dongsheng Duan; Gregory D Cartee

doi:10.1096/fj.202401859R

. 2024 Nov 16;38(22):e70176. doi: 10.1096/fj.202401859R

Genetic reduction of skeletal muscle glycogen synthase 1 abundance reveals that the refeeding‐induced reversal of elevated insulin‐stimulated glucose uptake after exercise is not attributable to achieving a high muscle glycogen concentration

Seong Eun Kwak ¹, Haiyan Wang ¹, Xiufang Pan ², Dongsheng Duan ^2,^3,^4,⁵, Gregory D Cartee ^1,^6,^7,^✉

PMCID: PMC11698010 PMID: 39548965

Abstract

One exercise session can increase subsequent insulin‐stimulated glucose uptake (ISGU) by skeletal muscle. Postexercise refeeding induces reversal of postexercise (PEX)‐enhanced ISGU concomitant with attaining high muscle glycogen in rats. To test the relationship between high glycogen and reversal of PEX‐ISGU, we injected one epitrochlearis muscle from each rat with adeno‐associated virus (AAV) small hairpin RNA (shRNA) that targets glycogen synthase 1 (GS1) and injected contralateral muscles with AAV‐shRNA‐Scrambled (Scr). Muscles from PEX and sedentary rats were collected at 3‐hour PEX (3hPEX) or 6‐hour PEX (6hPEX). Rats were either not refed or refed rat‐chow during the recovery period. Isolated muscles were incubated with [³H]‐3‐O‐methylglucose, with or without insulin. The results revealed: (1) GS1 abundance was substantially lower for AAV‐shRNA‐GS1‐treated versus AAV‐shRNA‐Scr‐treated muscles; (2) reduced GS1 abundance in refed‐rats induced much lower glycogen in AAV‐shRNA‐GS1‐treated versus AAV‐shRNA‐Scr‐treated muscles at 3hPEX or 6hPEX; (3) PEX‐ISGU was elevated in not refed‐rats at either 3hPEX or 6hPEX versus sedentary controls, regardless of GS1 abundance; (4) PEX‐ISGU was not reversed by 3 h of refeeding, regardless of GS1 abundance; (5) despite substantially lower glycogen in AAV‐shRNA‐GS1‐treated versus AAV‐shRNA‐Scr‐treated muscles, elevated PEX‐ISGU was eliminated at 6hPEX in both of the paired muscles of refed‐rats; and (6) 3hPEX versus sedentary non‐refed rats had greater AMP‐activated protein kinase‐γ3 activity in both paired muscles, but this exercise effect was eliminated in both paired muscles by 3 h of refeeding. In conclusion, the results provided compelling evidence that the reversal of exercise‐enhanced ISGU by refeeding was not attributable to the accumulation of high muscle glycogen concentration.

This study investigates the relationship between postexercise muscle glycogen accumulation and the reversal of the exercise‐induced increase in insulin‐stimulated glucose. We used an adeno‐associated virus approach to markedly and selectively reduce glycogen synthase 1 protein levels in one muscle from each rat (leading to very different muscle glycogen concentration after postexercise refeeding compared to the contralateral control muscle from the same animal). Our results provide unique evidence that the reversal of exercise‐enhanced insulin‐stimulated glucose uptake by postexercise refeeding was not attributable to the accumulation of a high muscle glycogen concentration.

graphic file with name FSB2-38-e70176-g009.jpg

Abbreviations

3hPEX: 3 hours postexercise
3‐MG: 3‐methylglucose
6hPEX: 6 hours postexercise
AAV: adeno‐associated virus
AAV‐shRNA‐GS1: glycogen synthase 1 AAV‐shRNA
AAV‐shRNA‐Scr: scrambled AAV‐shRNA
ACC: acetyl CoA carboxylase
AMPK: AMP‐activated protein kinase
AMPK‐gamma3: AMP‐activated protein kinase gamma3
AS160: Akt substrate of 160 kDa
BSA: bovine serum albumin
DTT: dithiothreitol
GLUT4: glucose transporter type 4
GS1: glycogen synthase 1
HBP: hexosamine biosynthetic pathway
HKII: hexokinase II
HRP: horseradish peroxidase
ISGU: insulin‐stimulated glucose uptake
KHB: Krebs Henseleit Buffer
MgCl₂: magnesium chloride
NRF: not refed
OGT: O‐GlcNAc transferase
pACC^Ser79/212: phospho acetyl CoA carboxylase Ser^79/212
pAkt^Thr308: phospho Akt Thr³⁰⁸
pAMPKalpha^Thr172: phospho AMPKalpha Thr¹⁷²
pAS160^Ser588: phospho Akt substrate of 160 kDa Ser⁵⁸⁸
pAS160^Thr642: phospho Akt substrate of 160 kDa Thr⁶⁴²
PEX: postexercise
Q: glutamine
R: arginine
RF: refed
Scr: scrambled
Sed: sedentary
shRNA: small hairpin RNA
T2D: Type 2 diabetes
TBST: Tris‐buffered saline pH 7.5 with 0.1% of Tween‐20
T‐PER: Tissue Protein Extraction Reagent
UDP‐GlcNAc: uridine diphosphate‐N‐acetylglucosamine
W: Tryptophan

1. INTRODUCTION

Over 37 million people in the USA are suffering from diabetes, and 95% of diabetes patients have Type 2 diabetes (T2D). ¹ , ² Skeletal muscle is responsible for the major portion of insulin‐mediated blood glucose clearance, ³ , ⁴ , ⁵ and insulin resistance in this tissue is a primary and essential defect in the progression to T2D. ³ , ⁴ , ⁶ Furthermore, insulin resistance, independent of T2D, is associated with elevated risk for many pathologies, including cardiovascular disease, cognitive dysfunction, Alzheimer's disease, and several cancers. ⁷ , ⁸ , ⁹ , ¹⁰ , ¹¹ , ¹² Accordingly, it is important to understand the interventions and biological processes that can improve insulin sensitivity in skeletal muscle.

One bout of exercise can increase insulin‐independent glucose uptake immediately during and shortly after exercise, with most of this effect typically reversed within about 1 to 2 h postexercise. ¹³ , ¹⁴ Insulin‐stimulated glucose uptake in skeletal muscle can be enhanced compared to sedentary control values for a period ranging from about 2 h to as much as 2 days after acute exercise. ¹⁴ , ¹⁵ , ¹⁶ , ¹⁷ Many studies have demonstrated that enhanced insulin sensitivity occurs several hours after acute exercise in multiple species, including rats, mice, dogs, sheep, and humans. ¹⁷ , ¹⁸ , ¹⁹ , ²⁰ , ²¹ , ²² , ²³ , ²⁴ , ²⁵ , ²⁶ Improved insulin‐stimulated glucose uptake has been reported in various skeletal muscles from rats and mice, including the epitrochlearis, which is mainly comprised of type II, fast‐twitch fibers, and the soleus, which includes a high percentage of type I, slow‐twitch fibers. ²⁵ , ²⁷ , ²⁸ , ²⁹ The mechanisms responsible for enhanced insulin‐stimulated glucose uptake after acute exercise remain to be fully elucidated, but it has been demonstrated to rely on greater insulin‐stimulated translocation of the GLUT4 glucose transporter to cell surface membranes. ³⁰

Glycogen concentration in the active skeletal muscle declines during vigorous exercise. In the seminal study which revealed that acute exercise can lead to elevated insulin‐stimulated glucose uptake, Richter et al. ²⁰ noted that the postexercise effect on insulin‐stimulated glucose uptake was “most prominent in muscle fibers that are deglycogenated during the exercise.” Multiple studies subsequently confirmed that the enhanced insulin‐stimulated glucose uptake after exercise is typically accompanied by reduced muscle glycogen concentration. ¹⁴ , ³¹ , ³² , ³³ , ³⁴ , ³⁵ , ³⁶ As a result, numerous studies have focused on the possibility that muscle glycogen depletion may play a role in triggering the elevated postexercise insulin‐stimulated glucose uptake. ¹⁶ , ¹⁸ , ¹⁹ , ²⁶ , ²⁷ , ³⁷ , ³⁸

In contrast, relatively few studies have focused on the mechanisms that regulate the reversal of increased postexercise insulin‐stimulated glucose uptake. ¹⁵ , ³⁷ , ³⁹ Elevated, postexercise insulin‐stimulated glucose uptake coupled with consuming dietary carbohydrates after exercise enables marked glycogen resynthesis with the eventual attainment of muscle glycogen concentration that substantially exceeds typical resting values (a condition known as glycogen supercompensation). Glycogen supercompensation of skeletal muscle has been extensively evaluated in many studies using humans or rodents, with the focus usually being related to the potential benefits of increasing muscle glycogen on endurance performance. ⁴⁰ , ⁴¹ A few studies have focused on the possibility that muscle glycogen resynthesis and supercompensation may play a role in the reversal of the increased insulin‐stimulated glucose uptake after exercise. ¹⁵ , ³⁷ , ⁴² Cartee et al. ¹⁵ measured glycogen concentration and insulin‐stimulated glucose uptake after an acute bout of exercise with or without dietary carbohydrate refeeding using rats. Refeeding a diet including substantial carbohydrates (e.g., standard rodent chow, ~60% calories as carbohydrate; or corn starch and glucose, 100% calories as carbohydrate) induced faster reversal of enhanced postexercise insulin‐stimulated glucose uptake along with glycogen resynthesis compared to groups that did not consume carbohydrate (either fasted or consuming diet with 100% of calories as fat) after exercise. ¹⁵ , ³⁷

Although previous studies reported that postexercise refeeding results in the reversal of increased insulin‐stimulated glucose uptake concomitant with the attainment of high muscle glycogen concentration, these results cannot establish a causal link between these two processes. Refeeding has many metabolic consequences in addition to its relationship with muscle glycogen resynthesis. Therefore, it would be valuable to devise an experimental approach that enables a more specific test of the potential role that high muscle glycogen concentration might play in the postexercise reversal of elevated insulin‐stimulated glucose uptake.

Glycogen synthase 1 (GS1), the rate‐limiting enzyme that regulates muscle glycogen synthesis, ⁴³ is an attractive target for interventions that aim to modify muscle glycogen concentration. However, whole‐body GS1 deletion in mice resulted in 90% perinatal mortality secondary to abnormal cardiac development and function. ⁴³ Premature death was avoided when GS1 deletion was achieved using an inducible, skeletal muscle‐specific GS1 knockout approach. ⁴⁴ However, skeletal muscle‐specific GS1 knockdown resulted in glucose intolerance, insulin resistance, and diminished exercise capacity. This complex phenotype would confound the interpretation of exercise experiments using this model. An alternative approach to selectively decrease GS1 abundance in a selected skeletal muscle, rather than in all skeletal muscles of an animal would offer major advantages.

Adeno‐associated virus (AAV) can be used to deliver small hairpin RNA (shRNA) that targets specific genes, inducing the reduced expression of the targeted genes. ⁴⁵ , ⁴⁶ Accordingly, we recently studied the effects of injecting the epitrochlearis muscle of rats with AAV‐shRNA that targets GS1 (AAV‐shRNA‐GS1). The contralateral epitrochlearis muscle of each rat was injected with scrambled AAV‐shRNA; AAV‐shRNA‐Scr to serve as a control. The results demonstrated that skeletal muscle GS1 abundance could be substantially reduced in rats, and the muscles with lower GS1 abundance had a markedly slower rate of muscle glycogen accumulation when the rats were refed after exercise. ⁴⁷

The first aim of the current study was to determine if reduced glycogen resynthesis in AAV‐shRNA‐GS1 injected muscle compared to paired AAV‐shRNA‐Scr muscles would prevent or delay the carbohydrate refeeding‐related reversal of enhanced postexercise insulin‐stimulated glucose uptake. We hypothesized that lower muscle glycogen concentration in paired AAV‐shRNA‐GS1 versus AAV‐shRNA‐Scr muscles of rats that were refed for 6 h, but not 3 h postexercise, would be accompanied by greater insulin‐stimulated glucose uptake.

Several lines of evidence support the possibility that stimulation of AMP‐activated protein kinase (AMPK) plays a role in the enhanced postexercise insulin‐stimulated glucose uptake. ²⁴ , ⁴⁸ , ⁴⁹ , ⁵⁰ , ⁵¹ AMPK is a heterotrimeric kinase that is composed of 3 subunits (α, β, and γ), and each subunit has multiple isoforms (α1, α2, β1, β2, γ1, γ2, and γ3). ⁵² The activity of AMPK‐γ3 containing heterotrimers was increased in rat epitrochlearis muscles immediately after an acute bout of exercise, and the increase persisted at 3 h postexercise. ⁵¹ , ⁵³ There is evidence that the γ3‐isoform can influence insulin‐stimulated glucose uptake by skeletal muscle. Previous research using AMPK‐γ3 deficient mice found that muscle incubation with an AMPK activator failed to improve subsequent insulin sensitivity. ⁴⁹ Multiple studies support the idea that the AMPK‐γ3 subunit has a relationship with muscle glycogen. ⁵⁴ , ⁵⁵ , ⁵⁶ , ⁵⁷ , ⁵⁸ , ⁵⁹ , ⁶⁰ AMPK‐γ3 missense mutation on specific arginine (R) site to glutamine (Q) or tryptophan (W) (R200Q in Hampshire pig, R225W in human, and R225Q in mice) resulted in higher glycogen concentration. ⁵⁴ , ⁵⁶ , ⁵⁷ , ⁵⁸ , ⁵⁹ , ⁶⁰ In addition, it has been reported that the magnitude of the exercise‐induced stimulation of AMPK is inversely related to postexercise muscle glycogen concentration. ⁶¹

The sustained elevation in muscle AMPK‐γ3 activity was previously tested in rats that were not refed postexercise, ⁵¹ , ⁵³ but earlier work has not tested if postexercise refeeding alters this outcome. Therefore, a secondary aim of this study was to determine if refeeding would reduce AMPK activation postexercise, and if reduced glycogen resynthesis in AAV‐shRNA‐GS1 injected muscles compared to paired AAV‐shRNA‐Scr muscles would attenuate the reversal of enhanced postexercise AMPK activation with carbohydrate refeeding. We hypothesized that lower muscle glycogen concentration in AAV‐shRNA‐GS1 versus AAV‐shRNA‐Scr muscles of rats at 3 h of postexercise refeeding would be accompanied by greater AMPK‐γ3 activity.

2. RESEARCH DESIGN AND METHODS

2.1. Materials

Chemicals were obtained from Sigma‐Aldrich (St. Louis, MO) or Fisher Scientific (Hanover Park, IL) unless otherwise noted. [³H]‐3‐Methylglucose (ART0126‐5) was from American Radiolabeled Chemicals, Inc. (St. Louis, MO) and [¹⁴C] mannitol (NEC314250UC) was from PerkinElmer (Waltham, MA). Protein G magnetic beads (#10004D) and DynaMag™‐2 magnet (#12321D) were from ThermoFisher (Waltham, MA). The reagents and apparatus for SDS‐PAGE and nonfat dry milk (no. 170–6404) were from Bio‐Rad (Hercules, CA). Pierce MemCode Reversible Protein Stain Kit (#24585), bicinchoninic acid protein assay (#23225), Tissue Protein Extraction Reagent (T‐PER; #78510). Anti‐glycogen synthase 1 (GS; #3893), anti‐hexokinase II (HKII; #2867), anti‐phospho AMPKα Thr¹⁷² (pAMPKα^Thr172; #50081, which recognizes phosphorylation on both α1 and α2 isoforms), anti‐AMPK‐α (AMPKα; #5831, which recognizes both α1 and α2 isoforms), anti‐acetyl CoA carboxylase (ACC; #3676), anti‐phospho ACC^Ser79/212 (pACC^Ser79/212; #3661), anti‐Akt (AKT; #4691), anti‐phospho Akt Thr³⁰⁸ (pAKT^Thr308; #13038), anti‐phospho AS160 (Akt substrate of 160 kDa, also known as TBC1D4) Thr⁶⁴² (pAS160^Thr642; #8881), anti‐phospho AS160 Ser⁵⁸⁸ (pAS160^Ser588; #8730), and anti‐rabbit IgG horseradish peroxidase (HRP) conjugate (#7074) were from Cell Signaling Technology (Danvers, MA). Anti‐Akt Substrate of 160 kDa (AS160; #ABS54), anti‐glucose transporter type 4 (GLUT4; #CBL243), and enhanced chemiluminescence Luminata Forte Western HRP Substrate (#WBLUF0100) were from EMD Millipore (Billerica, MA). Anti‐AMP‐activated protein kinase γ3 (AMPK‐γ3) was provided by Dr. David Thomson (Brigham Young University, Provo, UT, USA). The antigen used to create this antibody was a synthetic peptide corresponding to the amino acid residues of the rat sequence that are equivalent to 72–84 of human γ3. ⁶² The AMPK‐γ3 antibody was validated with muscles from wild‐type and γ3‐AMPK‐KO mice. ⁵¹ [γ‐³³ P]‐ATP was from American Radiolabeled Chemicals, Inc. (St. Louis, MO). The liquid scintillation cocktail (#111195‐CS) was from Research Products International (Mount Prospect, IL).

2.2. Animal treatment

Animal studies were conducted in accordance with the guidelines from the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and with the approval of the University of Michigan Committee on Use and Care of Animals. Male Wistar rats (Charles River Laboratories, Wilmington, MA) were 9–10 weeks old when muscle samples were collected.

2.3. Preparation of AAV expressing short‐hairpin RNAs

As previously reported, potential target sequences (Glycogen synthase 1, GS1) were initially identified using a predesigned shRNA database (MilliporeSigma, Burlington, MA). Candidate sequences were initially tested for efficacy of knocking down endogenous GS1 protein levels by immunoblot in L6 myocytes by transient transfection of siRNA. ⁴⁷ Briefly, L6 myocytes were seeded the day before transfection. L6 myocytes were incubated for 48 h with 10 nM candidate siRNA that was mixed in the OptiMEM with lipofectamine RNAiMax. The myocytes were harvested and analyzed for GS1 expression. Based on the L6 myocyte results, the target sequence (5´‐CCTGGACTTCAACCTAGACAA‐3′) was selected and annealed to short‐hairpin RNA (shRNA) oligo (5´‐CCTGGACTTCAACCTAGACAActcgagTTGTCTAGGTTGAAGTCCAGG ttttt‐3′). The shRNA sequence was then ligated into the pCWB U6‐CMV‐eGFP adeno‐associated virus (AAV) vector cis‐plasmid using XbaI and SalI sites. A scrambled shRNA sequence (5´‐CGCGATAGCGCTAATAATTTC‐3′) was also cloned to the pCWB U6‐CMV‐eGFP AAV vector cis‐plasmid to be used as a control. The cis‐plasmids were used in conventional triple plasmid transfection for the production of the AAV9 serotype vector. AAV9 vectors were purified through two rounds of CsCl ultracentrifugation and the titer was determined by quantitative PCR.

2.4. AAV administration

AAV administration to rats (at 6–7 week old) was performed as previously described. ⁶³ Briefly, the rats were anesthetized (2.5% isoflurane/100% oxygen), their forelimbs shaved, and analgesic (5 mg/kg carprofen) subcutaneously injected. A 5‐ to 7‐mm skin incision was made, and the exposed epitrochlearis rinsed (sterile PBS); paired epitrochlearis muscles from each rat were injected with either AAV that delivers scramble shRNA (AAV‐shRNA‐Scr; 3.5 × 10¹² vg/mL) or GS1 targeting shRNA (AAV‐shRNA‐GS1; 3.5 × 10¹² vg/mL), and the incision was sutured. The rat epitrochlearis is composed mostly of type II fibers ⁶⁴ which correspond to the fiber type profile of most rat skeletal muscles. ⁶⁵ Terminal experiments were performed 3 to 4 weeks post injection.

Rats were fed rodent chow (Laboratory Diet no. 5L0D; LabDiet, St. Louis, MO) until fasted (1700 h the day before the experiment). The following day at ~0900, rats either swam or remained sedentary. The exercise protocol was swim‐exercise in a barrel filled with water (35°C, 45 cm depth, 6 rats swimming at a time) for four 30‐min bouts with 5‐min rest between bouts. ⁶³ Then exercised rats were anesthetized with an intraperitoneal injection of ketamine‐xylazine cocktail (50 mg/kg ketamine and 5 mg/kg xylazine) at 3 and 6 h postexercise (3hPEX, 6hPEX) along with time‐matched sedentary (3hSED, 6hSED) rats. The 3hPEX and 6hPEX along with time‐matched sedentary groups were either refed (RF; provided ad libitum access to rodent chow) or not refed (NRF) postexercise. Both RF and NRF groups were also provided ad libitum access to water. Therefore, there were a total 8 groups: 3hPEX and 6hPEX with refeeding (3hPEX‐RF, 6hPEX‐RF), 3hPEX and 6hPEX without refeeding (3hPEX‐NRF, 6hPEX‐NRF), 3hPEX and 6hPEX time‐matched Sed with refeeding (3hSED‐RF, 6hSED‐RF), and without refeeding (3hSED‐NRF, 6hSED‐NRF). The duration of the fast was approximately 21 h for rats included in the 3hSED and 3hPEX cohorts and approximately 24 h for the rats included in the 6hSED and 6hPEX cohorts (Figure 1).

Experimental design. One epitrochlearis muscle from each rat was injected with adeno‐associated virus (AAV) small hairpin RNA (shRNA) that targets glycogen synthase 1 (GS1), and the contralateral muscle from each rat was injected with AAV‐shRNA‐Scrambled (Scr). Muscles from sedentary (SED) and postexercise (PEX) rats were collected at (A) 3 h of PEX (3hPEX) or (B) 6 h of PEX (6hPEX). Rats were either not refed (NRF) or refed (RF) rat‐chow during the recovery period. Muscles were isolated, and both muscles from each rat were incubated either with or without insulin. All muscles were incubated with [³H]‐3‐O‐methylglucose ([³H]‐3‐MG). Muscles from the 3hPEX and 6hPEX experiments were analyzed for glycogen, 3‐MG uptake, protein phosphorylation, and protein abundance (western blot). Muscles from the 3hPEX experiment were also analyzed for AMP‐associated activated protein kinase‐γ3 (AMPK‐γ3) activity.

2.5. Ex vivo incubations of muscles for glucose uptake

Epitrochlearis muscles were incubated in glass vials gassed (95% O₂, 5% CO₂) in a temperature‐controlled bath by a three‐step incubation process (35°C during both steps). For step 1 (30 min), paired muscles were placed in vials containing 2 mL of media 1 (Krebs Henseleit Buffer, KHB, supplemented with 0.1% bovine serum albumin (BSA), 8 mM glucose, and 2 mM mannitol) with or without 100 μU/mL insulin. Paired muscles were incubated in the same insulin concentration. For incubation step 2 (10 min), these muscles were transferred to a vial containing 2 mL of media 2 (KHB supplemented with 0.1% BSA, 2 mM sodium pyruvate, and 6 mM mannitol) with or without 100 μU/mL insulin. For incubation step 3 (15 min), these muscles were transferred to a vial containing 2 mL of media 2 (KHB supplemented with 0.1% BSA, 8 mM 3‐O‐methylglucose (3‐MG) including [³H]3‐MG 2 uL/mL, and 2 mM mannitol including [¹⁴C]mannitol 2 uL/mL) with or without 100 μU/mL insulin. The second incubation step washed away the glucose that was present in the first incubation step to eliminate competition between extracellular glucose and 3‐O‐methylglucose (3‐MG) for transport into the muscle fibers during the third incubation step. After step 3, muscles were freeze‐clamped, and stored at −80°C until further processing.

2.6. Muscle lysate preparation

Frozen muscles were subsequently rapidly cut into two portions. One portion was used for measuring muscle glycogen measurement and glucose uptake. The other portion was used for measuring AMPK‐γ3 activity assay and immunoblotting.

The muscle portions used for glycogen measurement and glucose uptake were weighed and then homogenized in ice‐cold water with a glass pestle attached to a motorized homogenizer (Caframo, Georgian Bluffs, ON, Canada). These homogenates were heated for 5 min at 95°C and then centrifuged (13 000 g, for 5 min). The supernatants were transferred to microfuge tubes and separate aliquots were used for subsequent glycogen analysis and glucose uptake measurement as described below.

The muscle portion for immunoblotting and AMPK‐γ3 activity assay was weighed and then homogenized with the motorized homogenizer described above in ice‐cold lysis buffer (T‐PER supplemented with 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 1 mM β‐glycerophosphate, 1 μg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride). These lysates were rotated for 1 h at 4°C before centrifugation (15 000 g for 15 min at 4°C). The supernatants were transferred to 1.5 mL microfuge tubes and used for subsequent immunoblotting and AMPK‐γ3 activity assay as described below.

2.7. Muscle glucose uptake

The portions of frozen muscles used for glucose uptake were weighed and homogenized using a glass pestle attached to a motorized homogenizer in ice‐cold water. These lysates were heated for 5 min at 95°C before centrifugation (13 000 g for 5 min at 4°C). The supernatants were transferred to 1.5 mL microfuge tubes. Aliquots (200 μL) of supernatant were added to vials along with 8 mL of scintillation cocktail. [³H]3‐MG and [¹⁴C]‐mannitol disintegrations per minute were measured by a scintillation counter, and then 3‐MG uptake was calculated as previously described. ⁶⁶

2.8. AMPK‐γ3 activity

AMPK‐γ3 activity was determined as previously described. ⁶⁷ Briefly, 300 μg of protein from each sample was rotated at 4°C overnight with an antibody specific for the immunoprecipitation of AMPK‐γ3. Then 50 μL of protein G‐magnetic beads were added to the mixture and rotated for 2 h at 4°C. A DynaMag™‐2 magnet was used to pellet the protein G‐immunocomplex. Each immunopellet was washed one time in buffer A [50 mmol/L NaCl, 1% Triton X‐100, 50 mmol/L sodium fluoride, 5 mmol/L sodium‐pyrophosphate, 20 mmol/L Tris‐base (pH 7.5), 500 μmol/L PMSF, 2 mmol/L dithiothreitol (DTT), 4 μg/mL leupeptin, 4 μg/mL aprotinin, and 250 mmol/L sucrose], once in 6X assay buffer (240 mmol/L HEPES, 480 mmol/L NaCl, pH 7.0), and two times in 3X assay buffer. The activity assay was performed in 30 μL of kinase mix buffer [40 mmol/L HEPES, pH 7.5, 80 mmol/L NaCl, 800 μmol/L DTT, 200 μmol/L AMP, 100 μmol/L AMARA peptide, 5 mmol/L magnesium chloride (MgCl₂), 200 μmol/L ATP, and 10 μCi of [γ‐³³P]‐ATP] for 30 min at 30°C. The reaction was stopped by the addition of 10 μL of 1% phosphoric acid and 30 μL of supernatant was transferred to P81 phosphocellulose paper. After 3 × 15 min washes with 1% phosphoric acid, followed by 1 × 5 min washing with acetone, the phosphocellulose papers were dried for 5 min and placed in the vials containing 8 mL of scintillation cocktail for scintillation counting. Results were expressed relative to the normalized mean of all the samples from each experiment.

2.9. Muscle glycogen measurement

Muscle glycogen level was determined using a Glycogen Assay Kit (#MAK016, Sigma‐Aldrich, St. Louis, MO) according to the manufacturer's protocol. Absorbance was measured at 570 nm with a microplate reader. ⁶⁸

2.10. Immunoblotting

For each sample, an equal amount of lysate protein was mixed with 6x Laemmli buffer. The mixed samples were subjected to SDS‐PAGE and transferred to polyvinylidene difluoride membranes. Equal loading was confirmed with the MemCode protein stain kit. ⁶⁸ Membranes were blocked with TBST (Tris‐buffered saline pH 7.5 with 0.1% of Tween‐20) that were mixed with either 5% or nonfat milk or bovine serum albumin (BSA) for 1 hr. at room temperature. Membranes were then washed (3 × 5 min with TBST) and incubated in appropriate primary antibodies (5% of nonfat milk or BSA, overnight at 4°C). Incubated membranes were washed (3 × 5 min with TBST) and incubated in secondary antibody (5% of nonfat milk or BSA, 1 hr. at room temperature). Before membranes were subjected to enhanced chemiluminescence, they were washed (3 × 5 min with TBST, and 2 × 5 min with Tris‐buffered saline pH 7.5, TBS), and then quantified by densitometry (AlphaView; ProteinSimple, San Jose, CA). Individual values were normalized to the mean value of all samples on the same membrane.

2.11. Statistics

Multilevel mixed‐effects linear regression analysis was used to compare group means with Stata/SE 17.0 statistical software (Stata Corporation). Multilevel mixed‐effects linear regression analysis was performed because the results derived for paired muscles (injected with either shRNA‐GS1 or shRNA‐Scr) from the same rat are inherently correlated. Correlation analyses were conducted using the Pearson correlation coefficient. A p‐value ≤0.05 was considered statistically significant.

3. RESULTS

3.1. 3hPEX: Food intake and body mass

The 3hSed‐RF versus 3hPEX‐RF groups did not differ significantly for food intake (6.85 ± 1.77 versus 7.02 ± 1.88, respectively) or body mass (317.1 ± 38.5 versus 306.5 ± 38.8, respectively). The body mass of 3hSed‐NRF rats (294.2 ± 30.8) did not differ significantly from the body mass of 3hPEX‐NRF rats (292.5 ± 32.6).

3.2. 3hPEX: glycogen synthase 1, HKII, and GLUT4 abundance

Regardless of diet or exercise, GS1 abundance was significantly lower in shRNA‐GS1 versus shRNA‐Scr muscles (Figure 2A). In the shRNA‐Scr muscles, GS1 abundance was very slightly, but significantly greater for 3hPEX‐NRF versus 3hSed‐NRF rats and very slightly, but significantly lower for 3hPEX‐RF versus 3hSed‐RF (Figure 2A). In both paired muscles, GS1 abundance was lower in 3hPEX‐RF versus 3hPEX‐NRF (Figure 2A). HKII abundance of 3hPEX rats was greater compared to 3hSed rats regardless of GS1 knockdown or refeeding status (Figure 2B). In the 3hSed‐RF rats, GLUT4 abundance was greater for shRNA‐GS1 versus shRNA‐Scr (Figure 2C). In shRNA‐GS1 muscles, GLUT4 abundance was significantly greater for 3hSed‐RF versus 3hSed‐NRF (Figure 2C).

Glycogen synthase 1 abundance, HKII abundance, and GLUT4 abundance in skeletal muscle from 3 h postexercised rats or time‐matched sedentary rats with or without refeeding. Significant differences between treatments are denoted as follows: Diet‐related differences (Refed versus Not Refed) = D; Exercise status‐related differences (postexercise versus sedentary) = E; and Genotype differences (shRNA‐GS1 versus shRNA‐scr) = G. (A) Glycogen synthase 1 abundance. (B) HKII abundance. (C) GLUT4 abundance. (D) Representative immunoblots. shRNA‐GS1 versus shRNA‐Scr within the same exercise group (3hPEX or 3hSed) and diet group (refed or not refed), ^G p < .05; 3hPEX versus 3hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr) and diet group (refed or not refed), ^E p < .05; 3 h‐RF versus 3 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr) and exercise group (3hPEX or 3hSed), ^D p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 22–42/group for all the immunoblots.

3.3. 3hPEX: muscle glycogen

In the 3 h‐NRF rats, glycogen concentration was lower for the 3hPEX versus 3hSed groups regardless of GS1 knockdown (Figure 3A). In the 3hSed‐NRF rats, glycogen concentration was lower in shRNA‐GS1 versus shRNA‐Scr muscles (Figure 3A). In the 3 h‐RF rats, glycogen level was lower in shRNA‐GS1 versus shRNA‐Scr muscles regardless of exercise status (Figure 3A). In the shRNA‐Scr muscles, glycogen concentration was greater for 3hPEX‐RF versus 3hSed‐RF groups (Figure 3A). In both the 3hSed and 3hPEX rats, glycogen concentration was greater for 3 h‐RF versus 3 h‐NRF groups regardless of GS1 knockdown (Figure 3A).

Glycogen concentration and glucose uptake in skeletal muscle from 3 h postexercised rats or time‐matched sedentary rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D; Exercise = E; Genotype = G; and Insulin versus No Insulin incubation = I. (A) Glycogen concentration. (B) Glucose uptake. shRNA‐GS1 versus shRNA‐Scr within the same insulin group (0 or 100 μU/mL), exercise group (3hPEX or 3hSed), and diet group (refed or not refed), ^G p < .05; 3hPEX versus 3hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and diet group (refed or not refed), ^E p < .05; 3 h‐RF versus 3 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and exercise group (3hPEX or 3hSed), ^D p < .05; 0 μU/mL versus 100 μU/mL within the same AAV (shRNA‐GS1 or shRNA‐Scr), exercise group (3hPEX or 3hSed), and diet group (refed or not refed), ^I p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 49–53/group for the glycogen concentration and n = 9–27/group for glucose uptake.

3.4. 3hPEX: muscle glucose uptake

Glucose uptake was greater in insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of exercise status, refeeding status, or GS1 knockdown (Figure 3B). Regardless of refeeding status or GS1 knockdown, glucose uptake in insulin‐stimulated 3hPEX muscles exceeded that in insulin‐stimulated 3hSed muscles (Figure 3B).

3.5. 3hPEX: AMPK‐γ3 activity and phosphorylation of AMPK and ACC

In 3 h‐NRF rats, pAMPK^Thr172/AMPK was greater for 3hPEX in shRNA‐Scr muscles (Figure 4A). In the 3hPEX‐RF rats, pAMPK^Thr172/AMPK was significantly greater for shRNA‐GS1 versus shRNA‐Scr muscles (Figure 4A). Regardless of exercise status or GS1 knockdown, pAMPK^Thr172/AMPK was lower for 3 h‐RF versus 3 h‐NRF rats (Figure 4A). In 3 h‐NRF rats, pACC^Ser79/212/ACC was greater for 3hPEX in shRNA‐Scr muscles (Figure 4B). In 3hSed‐NRF and 3hPEX‐RF rats, pACC^Ser79/212/ACC were greater for shRNA‐GS1 versus shRNA‐Scr (Figure 4B). In 3hPEX‐NRF rats, pACC^Ser79/212/ACC was lower for shRNA‐GS1 versus shRNA‐Scr (Figure 4B). In shRNA‐Scr muscles, pACC^Ser79/212/ACC was lower for 3hPEX‐RF versus 3hPEX‐NRF (Figure 4B). In 3 h‐NRF rats, AMPK‐γ3 activity was greater for 3hPEX versus 3hSed regardless of GS1 knockdown (Figure 4C). In 3hSed‐NRF rats, AMPK‐γ3 activity was greater for shRNA‐GS1 versus shRNA‐Scr (Figure 4C). In 3hPEX rats, AMPK‐γ3 activity was lower for 3 h‐RF versus 3 h‐NRF groups regardless of GS1 knockdown (Figure 4C). In 3hPEX‐RF rats, AMPK‐γ3 activity was greater for shRNA‐GS1 versus shRNA‐Scr muscles (Figure 4C). Regardless of refeeding, or exercise status, AMPK‐γ3 abundance was lower for shRNA‐GS1 versus shRNA‐Scr (Figure 4D). In 3 h‐Refed rats, AMPK‐γ3 was lower for 3hPEX versus 3hSed groups (Figure 4D).

Protein phosphorylation, AMPK‐γ3 activity, and AMPK‐γ3 abundance in skeletal muscle from 3 h postexercised rats or time‐matched sedentary control rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D; Exercise = E; and Genotype = G. (A) pAMPK^Thr172/AMPK ratio. (B) pACC^Ser79/212/ACC ratio. (C) AMPK‐γ3 activity. (D) AMPK‐γ3 abundance. (E) Representative immunoblots. shRNA‐GS1 versus shRNA‐Scr within the same exercise group (3hPEX or 3hSed) and diet group (refed or not refed), ^G p < .05; 3hPEX versus 3hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr) and diet group (refed or not refed), ^E p < .05; 3 h‐RF versus 3 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr) and exercise group (3hPEX or 3hSed), ^D p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 22–24/group for pAMPK^Thr172/AMPK and pACC^Ser79/212/ACC blots, and n = 17/group for AMPK‐γ3 activity, and n = 18/group for AMPK‐γ3 abundance.

3.6. 3hPEX: Phosphorylation of AKT and AS160

Regardless of refeeding status, exercise status, or GS1 knockdown, pAKT^Thr308/AKT was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles (Figure 5A). In 3 h‐NRF rats, pAKT^Thr308/AKT was greater for 3hPEX versus 3hSed in shRNA‐GS1 muscles that are incubated with insulin (Figure 5A). In 3 h‐RF rats, pAKT^Thr308/AKT was greater for 3hPEX versus 3hSed in shRNA‐GS1 muscles that are incubated with insulin (Figure 5A). In 3hSed‐RF rats, pAKT^Thr308/AKT was lower for shRNA‐GS1 versus shRNA‐Scr muscles that are incubated with insulin (Figure 5A). In 3hPEX‐RF rats, pAKT^Thr308/AKT was greater for shRNA‐GS1 versus shRNA‐Scr muscles that are incubated with insulin (Figure 5A). In 3 h‐NRF rats, pAS160^Ser588/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of exercise status or GS1 knockdown (Figure 5B). In 3 h‐NRF rats, pAS160^Ser588/AS160 was greater for 3hPEX versus 3hSed in shRNA‐Scr muscles that are incubated without or with insulin (Figure 5B). In 3hSed‐RF rats, pAS160^Ser588/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated regardless of GS1 knockdown (Figure 5B). In 3hPEX‐RF rats, pAS160^Ser588/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated in shRNA‐GS1 muscles (Figure 5B). In 3hPEX rats, pAS160^Ser588/AS160 was lower for 3 h‐RF versus 3 h‐NRF rats in shRNA‐Scr muscles that are incubated with insulin (Figure 5B). In 3 h‐NRF rats, pAS160^Thr642/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of exercise status or GS1 knockdown (Figure 5C). In 3hSed‐RF rats, pAS160^Thr642/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of GS1 knockdown (Figure 5C). In 3 h‐RF rats, pAS160^Thr642/AS160 was greater for 3hPEX versus 3hSed in shRNA‐GS1 muscles that are not incubated with insulin (Figure 5C). In 3hPEX‐RF rats, pAS160^Thr642/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated in shRNA‐Scr muscles (Figure 5C).

Protein phosphorylation in skeletal muscle from 3 h postexercised rats or time‐matched sedentary control rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D; Exercise = E; Genotype = G; and Insulin = I. (A) pAKT^Thr308/AKT ratio. (B) pAS160^Ser588/AS160 ratio. (C) pAS160^Thr642/AS160 ratio. (D) Representative immunoblots. shRNA‐GS1 versus shRNA‐Scr within the same insulin group (0 or 100 μU/mL), exercise group (3hPEX or 3hSed), and diet group (refed or not refed), ^G p < .05; 3hPEX versus 3hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and diet group (refed or not refed), ^E p < .05; 3 h‐RF versus 3 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and exercise group (3hPEX or 3hSed), ^D p < .05; 0 μU/mL versus 100 μU/mL within the same AAV (shRNA‐GS1 or shRNA‐Scr), exercise group (3hPEX or 3hSed), and diet group (refed or not refed), ^I p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 11–12/group for all the immunoblots.

3.7. 6hPEX: Food intake and body mass

The 6hSed‐RF versus 6hPEX‐RF groups did not differ significantly for food intake (10.86 ± 1.60 versus 10.90 ± 1.46, respectively) or body mass (313.7 ± 34.2 versus 308.7 ± 19.0, respectively). The body mass was also not significantly different for 6hSed‐NRF rats (282.7 ± 22.9) versus 6hPEX‐NRF rats (279.5 ± 15.7).

3.8. 6hPEX: Glycogen synthase 1, HKII, and GLUT4 abundance

Regardless of diet or exercise, GS1 abundance was significantly lower in shRNA‐GS1 versus shRNA‐Scr muscles (Figure 6A). In the shRNA‐Scr muscles, GS1 abundance was significantly greater for 6hPEX‐NRF versus 6hSed‐NRF rats, and was lower for 6hPEX‐RF versus 6hSed‐RF (Figure 6A). In shRNA‐Scr muscles, GS1 abundance was lower for 6 h‐RF versus 6‐NRF regardless of exercise status (Figure 6A). HKII abundance of 6hPEX rats was greater compared to 6hSed rats regardless of GS1 knockdown or refeeding status (Figure 6B). In 6hSed‐NRF rats, HKII abundance was greater for shRNA‐GS1 versus shRNA‐Scr muscles (Figure 6B). In the 6hSed‐RF rats, GLUT4 abundance was greater for shRNA‐GS1 versus shRNA‐Scr (Figure 6C). In shRNA‐Scr muscles, GLUT4 abundance was significantly greater for 6hSed‐RF versus 6hSed‐NRF (Figure 6C). In 6 h‐RF rats, GLUT4 abundance was lower for 6hPEX versus 6hSed in shRNA‐GS1 muscles (Figure 6C).

Glycogen synthase 1 abundance, HKII abundance, and GLUT4 abundance in skeletal muscle from 6 h postexercised rats or time‐matched sedentary rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D; Exercise = E; and Genotype = G. (A) Glycogen synthase 1 abundance. (B) HKII abundance. (C) GLUT4 abundance. (D) Representative immunoblots. shRNA‐GS1 versus shRNA‐Scr within the same exercise group (6hPEX or 6hSed) and diet group (refed or not refed), ^G p < .05; 6hPEX versus 6hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr) and diet group (refed or not refed), ^E p < .05; 6 h‐RF versus 6 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr) and exercise group (6hPEX or 6hSed), ^D p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 18/group for all the immunoblots.

3.9. 6hPEX: Muscle glycogen

In 6 h‐NRF rats, glycogen concentration was lower for the 6hPEX versus 6hSed groups regardless of GS1 knockdown, and glycogen concentration was lower in shRNA‐GS1 versus shRNA‐Scr muscles regardless of exercise status (Figure 7A). In the 6 h‐RF rats, glycogen concentration was lower in shRNA‐GS1 versus shRNA‐Scr muscles regardless of exercise status (Figure 7A). In the shRNA‐Scr muscles, glycogen concentration was greater for 6hPEX‐RF versus 6hSed‐RF groups (Figure 7A). Regardless of exercise status or GS1 knockdown, glycogen concentration was greater for 6 h‐RF versus 6 h‐NRF groups (Figure 7A).

Glycogen concentration and glucose uptake in skeletal muscle from 6 h postexercised rats or time‐matched sedentary rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D; Exercise = E; and Genotype = G. (A) Glycogen concentration. (B) Glucose uptake. shRNA‐GS1 versus shRNA‐Scr within the same insulin group (0 or 100 μU/mL), exercise group (6hPEX or 6hSed), and diet group (refed or not refed), ^G p < .05; 6hPEX versus 6hSed within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and diet group (refed or not refed), ^E p < .05; 6 h‐RF versus 6 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr), insulin group (0 or 100 μU/mL), and exercise group (6hPEX or 6hSed), ^D p < .05; 0 μU/mL versus 100 μU/mL within the same AAV (shRNA‐GS1 or shRNA‐Scr), exercise group (6hPEX or 6hSed), and diet group (refed or not refed), ^I p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. 0 μU/mL versus 100 μU/mL AAV shRNA‐Scr muscles from 6hSed not refed rats, *p < .05 using one‐tailed t‐test (unpaired). Values are means ± SD; n = 22–25/group for the glycogen concentration and n = 10–14/group for the glucose uptake.

3.10. 6hPEX: Muscle glucose uptake

In the 6hSed‐NRF rats, glucose uptake was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles in shRNA‐GS1 muscles (Figure 7B). In the 6hPEX‐NRF rats, glucose uptake was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of GS1 knockdown (Figure 7B). In the 6 h‐NRF rats, regardless of GS1 knockdown, glucose uptake in insulin‐stimulated 6hPEX muscles exceeded that in 6hSed (Figure 7B). In the 6 h‐RF rats, glucose uptake level was greater in insulin‐stimulated versus non‐insulin‐stimulated muscles regardless of exercise status or GS1 knockdown (Figure 7B). In the 6 h‐RF rats, glucose uptake level in insulin‐stimulated 6hPEX muscles was not significantly different from that in 6hSed regardless of GS1 knockdown (Figure 7B). In the 6hPEX rats, glucose uptake level in non‐insulin‐stimulated muscles was lower for 6 h‐RF versus 6 h‐NRF in shRNA‐GS1 muscles (Figure 7B). Importantly, in the 6hPEX rats, glucose uptake level in insulin‐stimulated muscles was lower for 6 h‐RF versus 6 h‐NRF muscles regardless of GS1 knockdown (Figure 7B).

3.11. 3hPEX and 6hPEX: Correlations between muscle glucose uptake and glycogen

We performed correlation analysis between muscle glycogen and postexercise insulin‐stimulated glucose uptake of muscles from 3hPEX‐RF and 6hPEX‐RF groups. In the 3hPEX‐RF rats, neither shRNA‐Scr (R ² = 0.0002, p = .946) nor shRNA‐GS1 (R ² = 0.0003, p = .937) muscles showed a significant correlation between muscle glycogen and postexercise insulin‐stimulated glucose uptake (Figure 8A). In the 6hPEX‐RF rats, there was a statistically nonsignificant trend for a positive correlation between muscle glycogen and postexercise insulin‐stimulated glucose uptake for either shRNA‐Scr (R ² = 0.164, p = .151) or shRNA‐GS1 (R ² = 0.225, p = .087) muscles (Figure 8B). Values for shRNA‐Scr and shRNA‐GS1 muscles were pooled, and correlation analysis was performed between muscle glycogen and postexercise insulin‐stimulated glucose uptake of muscles from 3hPEX‐RF and 6hPEX‐RF groups. Pooling the values for shRNA‐Scr and shRNA‐GS1 muscles from 3hPEX‐RF rats (R ² = 0.003, p = .688) did not reveal a significant correlation between muscle glycogen and postexercise insulin‐stimulated glucose uptake (Figure 8A). For pooled values from 6hPEX‐RF rat muscles, there was a significant correlation between muscle glycogen and postexercise insulin‐stimulated glucose uptake (R ² = 0.159, p < .05, Figure 8B).

Pearson correlations analysis using muscles from rats that were exercised and refed at 3 and 6 h. Significant differences between treatments are denoted by: Diet = D. (A) Pearson correlations between muscle glycogen and glucose uptake using insulin‐stimulated muscles from the 3hPEX‐RF rats; shRNA‐GS1 (Red, circle), shRNA‐Scr (Blue, square) separately, and using pooled data from both shRNA‐GS1 and shRNA‐Scr (Black). (B) Pearson correlations between muscle glycogen and glucose uptake using insulin‐stimulated muscles from the 6hPEX‐RF rats; shRNA‐GS1 (Red, circle), shRNA‐Scr (Blue, square) separately, and using pooled data from both shRNA‐GS1 and shRNA‐Scr (Black).

3.12. 6hPEX: Phosphorylation of AMPK and ACC

Regardless of exercise status or GS1 knockdown, pAMPK^Thr172/AMPK and pACC^Ser79/212/ACC were significantly lower in 6 h‐RF versus 6 h‐NRF (Figure 9A,B).

Protein phosphorylation was determined in skeletal muscle from 6 h postexercised rats or time‐matched sedentary control rats with or without refeeding. Significant differences between treatments are denoted by: Diet = D. (A) pAMPK^Thr172/AMPK ratio. (B) pACC^Ser79/212/ACC ratio. (C) Representative immunoblots. 6 h‐RF versus 6 h‐NRF within the same AAV (shRNA‐GS1 or shRNA‐Scr) and exercise group (6hPEX or 6hSed), ^D p < .05. Comparisons between the two groups were analyzed by a multilevel mixed‐effects linear regression analysis. Values are means ± SD; n = 18/group for all the immunoblots.

3.13. 6hPEX: Phosphorylation AKT and AS160

Regardless of exercise condition, refeeding condition, or GS1 knockdown, pAKT^Thr308/AKT was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles (Figure 10A). In the shRNA‐GS1 muscles that are incubated with insulin, pAKT^Thr308/AKT was greater for 6 h‐RF versus 6 h‐NRF rats (Figure 10A). Regardless of exercise, refeeding, or GS1 knockdown, pAS160^Ser588/AS160 was greater for insulin‐stimulated versus non‐insulin‐stimulated muscles (Figure 10B). In the shRNA‐Scr muscles that were not incubated with insulin, pAS160^Ser588/AS160 was greater for 6hPEX versus 6hSed (Figure 10B). In the 6hPEX‐NRF rats, pAS160^Ser588/AS160 was greater for shRNA‐GS1 versus shRNA‐Scr muscles when the muscles were incubated with insulin (Figure 10B). In the muscles that were incubated with insulin, pAS160^Ser588/AS160 was lower for 6hSed‐RF versus 6hSed‐NRF, and also for 6hPEX‐RF versus 6hPEX‐NRF (Figure 10B). In the shRNA‐GS1 muscles that were incubated without insulin, pAS160^Ser588/AS160 was lower for 6hPEX‐RF versus 6hPEX‐NRF (Figure 10B). In the shRNA‐GS1 muscles that were incubated without insulin, pAS160^Thr642/AS160 was greater for 6hPEX‐NRF versus 6hSed‐NRF (Figure 10C). In the 6hPEX‐NRF rats, pAS160^Thr642/AS160 was greater for shRNA‐GS1 versus shRNA‐Scr when the muscles were incubated without insulin (Figure 10C). In the shRNA‐GS1 muscles that are incubated without insulin, pAS160^Thr642/AS160 was lower for 6hPEX‐RF versus 6hPEX‐NRF (Figure 10C).

4. DISCUSSION

The primary goal of this study was to rigorously investigate the potential role of postexercise muscle glycogen concentration in reversing exercise‐enhanced insulin‐stimulated glucose uptake using a genetic model in which GS1 abundance was markedly reduced in one epitrochlearis muscle compared to the contralateral muscle from each rat. The most important findings included: (1) in rats that were not refed after exercise at either 3hPEX or 6hPEX, insulin‐stimulated glucose uptake was elevated to a similar extent in paired muscles treated with shRNA‐Scr compared to shRNA‐GS1; (2) 3 h of refeeding did not attenuate the exercise‐enhanced insulin‐stimulated glucose uptake in either shRNA‐Scr or shRNA‐GS1 muscles; (3) the ~45% lower muscle glycogen concentration in shRNA‐GS1 versus shRNA‐Scr muscles did not prevent the complete reversal of the exercise‐enhanced insulin‐stimulated glucose uptake at 6 h postexercise in rats that were refed; and (4) exercise led to similarly enhanced muscle AMPK‐γ3 activity regardless of GS1 abundance in rats that were not refed at 3hPEX, but this exercise effect was eliminated by refeeding at 3 h postexercise regardless of GS1 abundance. These results offer evidence that the attainment of a high muscle glycogen concentration is not essential for the refeeding‐induced reversal of enhanced insulin‐stimulated glucose uptake by muscle after exercise.

The results at the 3 h postexercise timepoint revealed that, regardless of refeeding or exercise status, there were no differences in insulin‐stimulated glucose uptake between the paired muscles that had markedly different GS1 abundance. Numerous earlier studies reported improved insulin‐stimulated glucose uptake at 3hPEX compared to sedentary controls in rats that were either fasted or refed a carbohydrate‐free diet. ¹⁵ , ²⁷ , ²⁹ , ³⁹ , ⁵¹ , ⁶³ , ⁶⁹ , ⁷⁰ , ⁷¹ Consistent with those findings for rats that were not refed, insulin‐stimulated glucose uptake at 3hPEX, regardless of AAV‐treatment group, was elevated above sedentary values. A previous study reported that refeeding chow to rats for 3hPEX did not result in the loss of exercise‐enhanced insulin‐stimulated glucose uptake, ¹⁵ and this outcome agrees with our observation that 3 h of refeeding did not attenuate the exercise‐enhanced insulin‐stimulated glucose uptake regardless of GS1 abundance. The greater insulin‐stimulated glucose uptake in the muscle with shRNA‐Scr muscles at 3hPEX versus 3hSed in refed rats was accompanied by greater muscle glycogen concentration. These findings align with the results of earlier research. ¹⁵ In contrast, glycogen concentration was not significantly greater for muscles with shRNA‐GS1 treatment in the 3hPEX‐RF versus 3hSed‐RF rats. Furthermore, glycogen concentration was more than 100% greater in shRNA‐Scr muscles versus paired shRNA‐GS1 muscles from 3hPEX‐RF rats. Thus, the sustained improvement in insulin‐stimulated glucose uptake was similar in paired muscles with markedly different muscle glycogen concentrations.

There was also no difference between paired muscles for 6hPEX insulin‐stimulated glucose uptake regardless of large differences in GS1 abundance. In contrast to the 3hPEX timepoint, the exercise‐induced improvement in insulin‐stimulated glucose uptake was eliminated with 6 h of refeeding in both shRNA‐Scr and shRNA‐GS1 muscles compared to their respective sedentary controls. Earlier research demonstrated that the postexercise enhancement of insulin‐stimulated glucose uptake persisted 18 or 27 h after exercise in rats that were not refed. ¹⁵ , ³⁷ In this context, it was unsurprising that, in rats that were not refed at 6hPEX, insulin‐stimulated glucose uptake remained elevated above sedentary control values regardless of the AAV‐treatment group. As predicted, 6 h of refeeding reversed exercise‐enhanced insulin‐stimulated glucose uptake in shRNA‐Scr muscles. This observation was accompanied by the attainment of a high muscle glycogen concentration that was significantly greater than shRNA‐Scr muscles from time‐matched sedentary rats that were refed. However, in contrast to the hypothesis, exercise‐enhanced insulin‐stimulated glucose uptake was also eliminated in shRNA‐GS1 muscles at 6hPEX when the rats were refed. This reversal occurred even though muscle glycogen did not exceed values in shRNA‐GS1 muscles from time‐matched sedentary rats that were refed. In addition, muscle glycogen concentration was 45% lower in shRNA‐GS1 muscles compared to shRNA‐Scr muscles at 6hPEX when the rats were refed. Furthermore, the shRNA‐Scr muscles, but not the shRNA‐GS1 muscles, of refed rats had a significant exercise‐related increase in glycogen concentration. If the accumulation of a high muscle glycogen concentration was important for the reversal of the postexercise increase in insulin‐stimulated glucose uptake in refed rats, a negative correlation between insulin‐stimulated glucose uptake and muscle glycogen concentration would be expected. In contrast, a modest, positive correlation was observed between these outcomes. A speculative hypothesis for this finding is that greater insulin‐stimulated glucose uptake would favor greater muscle glycogen accumulation. Finally, muscle glycogen concentration of shRNA‐GS1 muscles at 6hPEX with refeeding (which had no postexercise increase in insulin‐stimulated glucose uptake) was comparable to the muscle glycogen concentration of shRNA‐Scr muscles (which had a postexercise increase in insulin‐stimulated glucose uptake) at 3hPEX with refeeding. Taken together, these results provide multiple lines of evidence against the idea that the attainment of a high muscle glycogen concentration is primarily responsible for the reversal of exercise‐enhanced insulin‐stimulated glucose uptake.

Although attaining a high muscle glycogen concentration is unlikely to directly cause the reversal of greater insulin sensitivity after exercise, it is possible that there is an indirect relationship to muscle glycogen accumulation. Glucose incorporation into glycogen is a major metabolic fate of glucose transported into the muscle of refed rats after exercise, but muscle glycogen concentration does not continue to increase indefinitely with postexercise refeeding. Less glucose being used for glycogen synthesis may favor alternative metabolic fates for the glucose entering the muscle cell. In this scenario, the finite capacity for muscle glycogen accumulation may be indirectly linked to the reversal of the postexercise increase in insulin‐stimulated glucose uptake.

Eating a carbohydrate‐rich diet (carbohydrate accounts for ~60% of caloric content in standard rodent chow) after exercise can induce higher circulating concentrations of glucose and insulin. ³⁹ , ⁷² Gulve et al. ³⁹ reported that isolated muscles incubated with elevated glucose and insulin for several hours after acute exercise (simulating the effect of consuming a carbohydrate‐rich diet on circulating glucose and insulin) led to the reversal of exercise‐enhanced insulin‐stimulated glucose uptake. Greater extracellular glucose and insulin might increase glucose flux through multiple metabolic pathways other than glycogen synthesis, including the hexosamine biosynthetic pathway (HBP; which provides the substrate required for greater O‐linked glycosylation of proteins) and the pentose phosphate pathway. ⁷³ , ⁷⁴ HBP products, including uridine diphosphate‐N‐acetylglucosamine (UDP‐GlcNAc), can reduce insulin‐stimulated glucose uptake. ⁷⁴ , ⁷⁵ , ⁷⁶ UDP‐GlcNAc is the obligatory substrate of O‐GlcNAc transferase (OGT) which is the enzyme that catalyzes a posttranslational modification of proteins known as O‐GlcNAcylation. ⁷⁷ Incubation of skeletal muscles with an inhibitor of β‐N‐acetylglucosaminidase, the enzyme that removes O‐GlcNAc modifications from proteins, ⁷⁴ caused reduced insulin‐stimulated glucose uptake. It is uncertain if the refeeding‐related accumulation of metabolites from the HBP and/or O‐GlcNAcylated proteins plays a role in a negative feedback loop that contributes to the refeeding‐related reversal of the exercise‐induced increase in insulin‐stimulated glucose uptake.

We hypothesized that lower muscle glycogen concentration in shRNA‐GS1 versus shRNA‐Scr muscles of rats at 3hPEX with refeeding would be accompanied by greater AMPK‐γ3 activity. Earlier studies showed greater AMPK‐γ3 activity at 3hPEX when the rats were not refed. ⁵¹ , ⁶³ Consistent with these earlier studies, AMPK‐γ3 activity in shRNA‐Scr muscles was greater at 3hPEX compared to time‐matched sedentary controls when the rats were not refed. There was also an exercise‐induced increase in the shRNA‐GS1 muscle of rats that were not refed at 3hPEX, and no difference in AMPK‐γ3 activity between shRNA‐Scr and shRNA‐GS1 muscles at 3hPEX when the rats were not refed. Earlier studies have not evaluated if refeeding alters postexercise enhanced AMPK‐γ3 activity, so it was notable that 3 h of refeeding reduced AMPK‐γ3 activity, regardless of exercise status or GS1 abundance. Several lines of evidence have implicated a possible role for AMPK‐γ3 in improved insulin sensitivity after exercise. ⁵¹ , ⁶³ Multiple earlier studies have demonstrated increased rat epitrochlearis muscle AMPK‐γ3 activity immediately postexercise. ⁵¹ , ⁵³ It remains possible this effect may play a role in triggering the subsequent increase in insulin sensitivity because the downstream consequences of transiently elevated AMPK‐γ3 activity may persist after the reversal of the enzyme activity. However, the current results indicate that a sustained increase in AMPK‐γ3 activity was not essential for the persistent increase in insulin‐stimulated glucose uptake in rats that were refed for 3hPEX.

We expected that lower muscle glycogen concentration in paired shRNA‐GS1 versus shRNA‐Scr muscles of rats at either 3hPEX or 6hPEX with refeeding would be accompanied by greater pAS160^Ser588/AS160 and pAS160^Thr642/AS160. However, neither pAS160^Ser588/AS160 nor pAS160^Thr642/AS160 was different between paired shRNA‐GS1 versus shRNA‐Scr muscles of rats at either 3hPEX or 6hPEX despite the large differences in muscle glycogen between these muscles in the refed rats. These results are not consistent with the idea that postexercise glycogen concentration is an important regulator of postexercise AS160 phosphorylation.

Earlier studies reported that the exercise‐enhanced insulin‐stimulated glucose uptake was accompanied by greater insulin‐stimulated pAS160^Ser588 and/or pAS160^Thr642 at 3hPEX when the rats were not refed. ²⁷ , ³⁷ , ⁵¹ , ⁶³ , ⁶⁹ , ⁷⁰ Consistent with previous studies, insulin‐stimulated pAS160^Ser588/AS160 in shRNA‐Scr muscles was greater for 3hPEX‐NRF versus 3hSed‐NRF rats. However, AS160 phosphorylation was not increased on either site at 6hPEX regardless of diet or GS1 abundance. These results indicate that an exercise‐induced elevation in AS160 phosphorylation of these sites was not essential for enhanced insulin‐stimulated glucose uptake at 6hPEX regardless of GS1 abundance. Recent research using AS160 knockout rats revealed that muscle AS160 expression is essential for the postexercise increase in insulin‐stimulated glucose uptake. ⁶³ Experiments using rats expressing AS160 with mutations that completely eliminated the ability to phosphorylation keys sites (AS160^Ser588, AS160^Thr642, and AS160^Ser704) demonstrated that phosphorylation of one or more of these sites was required for a portion (~45%), but not all of the exercise‐induced increase in insulin‐stimulated glucose uptake. ⁶³ Another recent study of muscles expressing mutated AS160 that prevented phosphorylation of only one site (AS160^Ser704) did not reduce the magnitude of the postexercise increase in insulin‐stimulated glucose uptake. ⁶⁹ These results suggest that enhanced insulin sensitivity might require only the ability to phosphorylate AS160 on key sites rather than requiring an exercise‐induced elevation above sedentary values in the amount of phosphorylation on these sites.

In conclusion, the results provided the first rigorous test of the long‐held belief that the reversal of exercise‐enhanced insulin‐stimulated glucose uptake by refeeding is secondary to attaining a high concentration of muscle glycogen. The results offer compelling evidence against this idea. It was also noteworthy that the exercise‐induced increase in AMPK‐γ3 activity was eliminated by 3 h of carbohydrate refeeding in muscles with markedly different levels of glycogen accumulation and without reducing the postexercise increase in insulin‐stimulated glucose uptake, demonstrating that sustained activation of AMPK‐γ3 was not required for a persistent elevation of insulin‐stimulated glucose uptake. These findings reveal the importance for future research to pursue mechanisms other than attaining high muscle glycogen concentration whereby carbohydrate refeeding leads to a reversal of elevated postexercise insulin‐stimulated glucose uptake.

AUTHOR CONTRIBUTIONS

G.D.C. conceived the experiments and supervised the project. S.E.K. contributed to the conception and design of the experiments. S.E.K. and G.D.C. wrote the first draft of the manuscript. S.E.K. performed experiments, analyzed data, performed statistics, and created figures. H.W. performed experiments and reviewed/edited the manuscript. X.P. generated the AAV reagents and reviewed/edited the manuscript. D.D. supervised the generation of the AAV reagents and reviewed/edited the manuscript. All authors reviewed the manuscript and approved its submission. G.D.C. is the guarantor of this work and, as such, has full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

FUNDING INFORMATION

This research was supported by grants from the National Institutes of Health (R01‐DK‐071771; R01‐DK‐136700).

DISCLOSURES

No potential conflicts of interest relevant to this article were reported.

Supporting information

Figure S1.

FSB2-38-e70176-s001.pptx^{(2.2MB, pptx)}

ACKNOWLEDGMENTS

The authors thank Dr. Arun Srivastava (University of Florida) for providing the AAV9 tyrosine mutant Rep‐Cap packaging plasmid, Yongping Yue (University of Missouri) for AAV production and purification, and Andrew Renaud, Jiwei Hao, and Linda Kong for assisting with the exercise protocols and the isolated muscle incubation procedures.

Kwak SE, Wang H, Pan X, Duan D, Cartee GD. Genetic reduction of skeletal muscle glycogen synthase 1 abundance reveals that the refeeding‐induced reversal of elevated insulin‐stimulated glucose uptake after exercise is not attributable to achieving a high muscle glycogen concentration. The FASEB Journal. 2024;38:e70176. doi: 10.1096/fj.202401859R

DATA AVAILABILITY STATEMENT

Data from the current study are available from the corresponding author upon reasonable request.

REFERENCES

1. CDC . National Diabetes Statistics Report. US Department HHS; 2022. [Google Scholar]
2. Moller DE. New drug targets for type 2 diabetes and the metabolic syndrome. Nature. 2001;414:821‐827. [DOI] [PubMed] [Google Scholar]
3. DeFronzo RA, Jacot E, Jequier E, Maeder E, Wahren J, Felber JP. The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes. 1981;30:1000‐1007. [DOI] [PubMed] [Google Scholar]
4. DeFronzo RA, Tripathy D. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care. 2009;32(Suppl 2):S157‐S163. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Merz KE, Thurmond DC. Role of skeletal muscle in insulin resistance and glucose uptake. Compr Physiol. 2020;10:785‐809. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. DeFronzo RA. Lilly lecture 1987. The triumvirate: beta‐cell, muscle, liver. A collusion responsible for NIDDM. Diabetes. 1988;37:667‐687. [DOI] [PubMed] [Google Scholar]
7. Facchini FS, Hua N, Abbasi F, Reaven GM. Insulin resistance as a predictor of age‐related diseases. J Clin Endocrinol Metab. 2001;86:3574‐3578. [DOI] [PubMed] [Google Scholar]
8. Haffner SM. Epidemiology of insulin resistance and its relation to coronary artery disease. Am J Cardiol. 1999;84:11J‐14J. [DOI] [PubMed] [Google Scholar]
9. Krentz AJ, Viljoen A, Sinclair A. Insulin resistance: a risk marker for disease and disability in the older person. Diabet Med. 2013;30:535‐548. [DOI] [PubMed] [Google Scholar]
10. Berlanga‐Acosta J, Guillen‐Nieto G, Rodriguez‐Rodriguez N, et al. Insulin resistance at the crossroad of Alzheimer disease pathology: a review. Front Endocrinol (Lausanne). 2020;11:560375. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Chiefari E, Mirabelli M, La Vignera S, et al. Insulin resistance and cancer: in search for a causal link. Int J Mol Sci. 2021;22:11137. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Ginsberg HN. Insulin resistance and cardiovascular disease. J Clin Invest. 2000;106:453‐458. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Wallberg‐Henriksson H, Constable SH, Young DA, Holloszy JO. Glucose transport into rat skeletal muscle: interaction between exercise and insulin. J Appl Physiol (1985). 1988;65:909‐913. [DOI] [PubMed] [Google Scholar]
14. Cartee GD. Mechanisms for greater insulin‐stimulated glucose uptake in normal and insulin‐resistant skeletal muscle after acute exercise. Am J Physiol Endocrinol Metab. 2015;309:E949‐E959. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Cartee GD, Young DA, Sleeper MD, Zierath J, Wallberg‐Henriksson H, Holloszy JO. Prolonged increase in insulin‐stimulated glucose transport in muscle after exercise. Am J Phys. 1989;256:E494‐E499. [DOI] [PubMed] [Google Scholar]
16. Perseghin G, Price TB, Petersen KF, et al. Increased glucose transport‐phosphorylation and muscle glycogen synthesis after exercise training in insulin‐resistant subjects. N Engl J Med. 1996;335:1357‐1362. [DOI] [PubMed] [Google Scholar]
17. Mikines KJ, Sonne B, Farrell PA, Tronier B, Galbo H. Effect of physical exercise on sensitivity and responsiveness to insulin in humans. Am J Phys. 1988;254:E248‐E259. [DOI] [PubMed] [Google Scholar]
18. Wojtaszewski JF, Hansen BF, Kiens B, Richter EA. Insulin signaling in human skeletal muscle: time course and effect of exercise. Diabetes. 1997;46:1775‐1781. [DOI] [PubMed] [Google Scholar]
19. Wojtaszewski JF, Hansen BF, Gade Kiens B, Markuns JF, Goodyear LJ, Richter EA. Insulin signaling and insulin sensitivity after exercise in human skeletal muscle. Diabetes. 2000;49:325‐331. [DOI] [PubMed] [Google Scholar]
20. Richter EA, Garetto LP, Goodman MN, Ruderman NB. Muscle glucose metabolism following exercise in the rat: increased sensitivity to insulin. J Clin Invest. 1982;69:785‐793. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Pencek RR, James F, Lacy DB, et al. Interaction of insulin and prior exercise in control of hepatic metabolism of a glucose load. Diabetes. 2003;52:1897‐1903. [DOI] [PubMed] [Google Scholar]
22. Nagasawa J, Sato Y, Ishiko T. Time course of in vivo insulin sensitivity after a single bout of exercise in rats. Int J Sports Med. 1991;12:399‐402. [DOI] [PubMed] [Google Scholar]
23. McConell GK, Kaur G, Falcao‐Tebas F, Hong YH, Gatford KL. Acute exercise increases insulin sensitivity in adult sheep: a new preclinical model. Am J Physiol Regul Integr Comp Physiol. 2015;308:R500‐R506. [DOI] [PubMed] [Google Scholar]
24. Kjobsted R, Munk‐Hansen N, Birk JB, et al. Enhanced muscle insulin sensitivity after contraction/exercise is mediated by AMPK. Diabetes. 2017;66:598‐612. [DOI] [PubMed] [Google Scholar]
25. Hamada T, Arias EB, Cartee GD. Increased submaximal insulin‐stimulated glucose uptake in mouse skeletal muscle after treadmill exercise. J Appl Physiol (1985). 2006;101:1368‐1376. [DOI] [PubMed] [Google Scholar]
26. Bogardus C, Thuillez P, Ravussin E, Vasquez B, Narimiga M, Azhar S. Effect of muscle glycogen depletion on in vivo insulin action in man. J Clin Invest. 1983;72:1605‐1610. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Castorena CM, Arias EB, Sharma N, Cartee GD. Postexercise improvement in insulin‐stimulated glucose uptake occurs concomitant with greater AS160 phosphorylation in muscle from normal and insulin‐resistant rats. Diabetes. 2014;63:2297‐2308. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Iwabe M, Kawamoto E, Koshinaka K, Kawanaka K. Increased postexercise insulin sensitivity is accompanied by increased AS160 phosphorylation in slow‐twitch soleus muscle. Physiol Rep. 2014;2:e12162. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Schweitzer GG, Arias EB, Cartee GD. Sustained postexercise increases in AS160 Thr642 and Ser588 phosphorylation in skeletal muscle without sustained increases in kinase phosphorylation. J Appl Physiol (1985). 2012;113:1852‐1861. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Hansen PA, Nolte LA, Chen MM, Holloszy JO. Increased GLUT‐4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise. J Appl Physiol (1985). 1998;85:1218‐1222. [DOI] [PubMed] [Google Scholar]
31. Henriksson J. Influence of exercise on insulin sensitivity. J Cardiovasc Risk. 1995;2:303‐309. [PubMed] [Google Scholar]
32. Goodyear LJ, Kahn BB. Exercise, glucose transport, and insulin sensitivity. Annu Rev Med. 1998;49:235‐261. [DOI] [PubMed] [Google Scholar]
33. Borghouts LB, Keizer HA. Exercise and insulin sensitivity: a review. Int J Sports Med. 2000;21:1‐12. [DOI] [PubMed] [Google Scholar]
34. Richter EA, Derave W, Wojtaszewski JF. Glucose, exercise and insulin: emerging concepts. J Physiol. 2001;535:313‐322. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Holloszy JO. Exercise‐induced increase in muscle insulin sensitivity. J Appl Physiol (1985). 2005;99:338‐343. [DOI] [PubMed] [Google Scholar]
36. Jensen J, Rustad PI, Kolnes AJ, Lai YC. The role of skeletal muscle glycogen breakdown for regulation of insulin sensitivity by exercise. Front Physiol. 2011;2:112. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Funai K, Schweitzer GG, Sharma N, Kanzaki M, Cartee GD. Increased AS160 phosphorylation, but not TBC1D1 phosphorylation, with increased postexercise insulin sensitivity in rat skeletal muscle. Am J Physiol Endocrinol Metab. 2009;297:E242‐E251. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Koshinaka K, Sano A, Howlett KF, et al. Effect of high‐intensity intermittent swimming on postexercise insulin sensitivity in rat epitrochlearis muscle. Metabolism. 2008;57:749‐756. [DOI] [PubMed] [Google Scholar]
39. Gulve EA, Cartee GD, Zierath JR, Corpus VM, Holloszy JO. Reversal of enhanced muscle glucose transport after exercise: roles of insulin and glucose. Am J Phys. 1990;259:E685‐E691. [DOI] [PubMed] [Google Scholar]
40. Burke LM, van Loon LJC, Hawley JA. Postexercise muscle glycogen resynthesis in humans. J Appl Physiol (1985). 2017;122:1055‐1067. [DOI] [PubMed] [Google Scholar]
41. Hingst JR, Bruhn L, Hansen MB, et al. Exercise‐induced molecular mechanisms promoting glycogen supercompensation in human skeletal muscle. Mol Metab. 2018;16:24‐34. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Derave W, Hansen BF, Lund S, Kristiansen S, Richter EA. Muscle glycogen content affects insulin‐stimulated glucose transport and protein kinase B activity. Am J Physiol Endocrinol Metab. 2000;279:E947‐E955. [DOI] [PubMed] [Google Scholar]
43. Pederson BA, Chen H, Schroeder JM, Shou W, DePaoli‐Roach AA, Roach PJ. Abnormal cardiac development in the absence of heart glycogen. Mol Cell Biol. 2004;24:7179‐7187. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Xirouchaki CE, Mangiafico SP, Bate K, et al. Impaired glucose metabolism and exercise capacity with muscle‐specific glycogen synthase 1 (gys1) deletion in adult mice. Mol Metab. 2016;5:221‐232. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Moore CB, Guthrie EH, Huang MT, Taxman DJ. Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol. 2010;629:141‐158. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Rao DD, Vorhies JS, Senzer N, Nemunaitis J. siRNA vs. shRNA: similarities and differences. Adv Drug Deliv Rev. 2009;61:746‐759. [DOI] [PubMed] [Google Scholar]
47. Kwak SE, Zheng A, Arias EB, et al. A novel genetic model provides a unique perspective on the relationship between postexercise glycogen concentration and increases in the abundance of key metabolic proteins after acute exercise. PLoS One. 2024;19:e0295964. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Fisher JS, Gao J, Han DH, Holloszy JO, Nolte LA. Activation of AMP kinase enhances sensitivity of muscle glucose transport to insulin. Am J Physiol Endocrinol Metab. 2002;282:E18‐E23. [DOI] [PubMed] [Google Scholar]
49. Kjobsted R, Treebak JT, Fentz J, et al. Prior AICAR stimulation increases insulin sensitivity in mouse skeletal muscle in an AMPK‐dependent manner. Diabetes. 2015;64:2042‐2055. [DOI] [PubMed] [Google Scholar]
50. Pataky MW, Yu CS, Nie Y, et al. Skeletal muscle fiber type‐selective effects of acute exercise on insulin‐stimulated glucose uptake in insulin‐resistant, high‐fat‐fed rats. Am J Physiol Endocrinol Metab. 2019;316:E695‐E706. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Wang H, Arias EB, Pataky MW, Goodyear LJ, Cartee GD. Postexercise improvement in glucose uptake occurs concomitant with greater gamma3‐AMPK activation and AS160 phosphorylation in rat skeletal muscle. Am J Physiol Endocrinol Metab. 2018;315:E859‐E871. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Kjobsted R, Hingst JR, Fentz J, et al. AMPK in skeletal muscle function and metabolism. FASEB J. 2018;32:1741‐1777. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Pataky MW, Arias EB, Wang H, Zheng X, Cartee GD. Exercise effects on gamma3‐AMPK activity, phosphorylation of Akt2 and AS160, and insulin‐stimulated glucose uptake in insulin‐resistant rat skeletal muscle. J Appl Physiol (1985). 2020;128:410‐421. [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Milan D, Jeon JT, Looft C, et al. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science. 2000;288:1248‐1251. [DOI] [PubMed] [Google Scholar]
55. Barnes BR, Marklund S, Steiler TL, et al. The 5'‐AMP‐activated protein kinase gamma3 isoform has a key role in carbohydrate and lipid metabolism in glycolytic skeletal muscle. J Biol Chem. 2004;279:38441‐38447. [DOI] [PubMed] [Google Scholar]
56. Costford SR, Kavaslar N, Ahituv N, et al. Gain‐of‐function R225W mutation in human AMPKgamma(3) causing increased glycogen and decreased triglyceride in skeletal muscle. PLoS One. 2007;2:e903. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Crawford SA, Costford SR, Aguer C, et al. Naturally occurring R225W mutation of the gene encoding AMP‐activated protein kinase (AMPK)gamma(3) results in increased oxidative capacity and glucose uptake in human primary myotubes. Diabetologia. 2010;53:1986‐1997. [DOI] [PubMed] [Google Scholar]
58. Barnes BR, Glund S, Long YC, Hjalm G, Andersson L, Zierath JR. 5'‐AMP‐activated protein kinase regulates skeletal muscle glycogen content and ergogenics. FASEB J. 2005;19:773‐779. [DOI] [PubMed] [Google Scholar]
59. Barnes BR, Long YC, Steiler TL, et al. Changes in exercise‐induced gene expression in 5'‐AMP‐activated protein kinase gamma3‐null and gamma3 R225Q transgenic mice. Diabetes. 2005;54:3484‐3489. [DOI] [PubMed] [Google Scholar]
60. Garcia‐Roves PM, Osler ME, Holmstrom MH, Zierath JR. Gain‐of‐function R225Q mutation in AMP‐activated protein kinase gamma3 subunit increases mitochondrial biogenesis in glycolytic skeletal muscle. J Biol Chem. 2008;283:35724‐35734. [DOI] [PubMed] [Google Scholar]
61. Janzen NR, Whitfield J, Hoffman NJ. Interactive roles for AMPK and glycogen from cellular energy sensing to exercise metabolism. Int J Mol Sci. 2018;19:3344. [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Hardman SE, Hall DE, Cabrera AJ, Hancock CR, Thomson DM. The effects of age and muscle contraction on AMPK activity and heterotrimer composition. Exp Gerontol. 2014;55:120‐128. [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Zheng A, Arias EB, Wang H, et al. Exercise‐induced improvement in insulin‐stimulated glucose uptake by rat skeletal muscle is absent in male AS160‐knockout rats, partially restored by muscle expression of Phosphomutated AS160, and fully restored by muscle expression of wild‐type AS160. Diabetes. 2022;71:219‐232. [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Castorena CM, Mackrell JG, Bogan JS, Kanzaki M, Cartee GD. Clustering of GLUT4, TUG, and RUVBL2 protein levels correlate with myosin heavy chain isoform pattern in skeletal muscles, but AS160 and TBC1D1 levels do not. J Appl Physiol (1985). 2011;111:1106‐1117. [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Delp MD, Duan C. Composition and size of type I, IIA, IID/X, and IIB fibers and citrate synthase activity of rat muscle. J Appl Physiol (1985). 1996;80:261‐270. [DOI] [PubMed] [Google Scholar]
66. Cartee G, Bohn E. Growth hormone reduces glucose transport but not GLUT‐1 or GLUT‐4 in adult and old rats. American Journal of Physiology‐Endocrinology and Metabolism. 1995;268:E902‐E909. [DOI] [PubMed] [Google Scholar]
67. Wang H, Zheng A, Arias EB, Cartee GD. Prior AICAR induces elevated glucose uptake concomitant with greater gamma3‐AMPK activation and reduced membrane cholesterol in skeletal muscle from 26‐month‐old rats. Facets (Ott). 2022;7:774‐791. [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Wang H, Arias EB, Treebak JT, Cartee GD. Exercise effects on gamma3‐AMPK activity, Akt substrate of 160 kDa phosphorylation, and glucose uptake in muscle of normal and insulin‐resistant female rats. J Appl Physiol (1985). 2022;132:140‐153. [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Wang H, Kwak SE, Zheng A, et al. Phosphorylation of AS160‐serine 704 is not essential for exercise‐increase in insulin‐stimulated glucose uptake by skeletal muscles from female or male rats. Am J Physiol Endocrinol Metab. 2024;326:E807‐E818. [DOI] [PMC free article] [PubMed] [Google Scholar]
70. Arias EB, Wang H, Cartee GD. Akt substrate of 160 kDa dephosphorylation rate is reduced in insulin‐stimulated rat skeletal muscle after acute exercise. Physiol Res. 2018;67:143‐147. [DOI] [PMC free article] [PubMed] [Google Scholar]
71. Schweitzer GG, Cartee GD. Postexercise skeletal muscle glucose transport is normal in kininogen‐deficient rats. Med Sci Sports Exerc. 2011;43:1148‐1153. [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Holtz KA, Stephens BR, Sharoff CG, Chipkin SR, Braun B. The effect of carbohydrate availability following exercise on whole‐body insulin action. Appl Physiol Nutr Metab. 2008;33:946‐956. [DOI] [PubMed] [Google Scholar]
73. An HJ, Froehlich JW, Lebrilla CB. Determination of glycosylation sites and site‐specific heterogeneity in glycoproteins. Curr Opin Chem Biol. 2009;13:421‐426. [DOI] [PMC free article] [PubMed] [Google Scholar]
74. Arias EB, Kim J, Cartee GD. Prolonged incubation in PUGNAc results in increased protein O‐linked glycosylation and insulin resistance in rat skeletal muscle. Diabetes. 2004;53:921‐930. [DOI] [PubMed] [Google Scholar]
75. Nelson BA, Robinson KA, Koning JS, Buse MG. Effects of exercise and feeding on the hexosamine biosynthetic pathway in rat skeletal muscle. Am J Phys. 1997;272:E848‐E855. [DOI] [PubMed] [Google Scholar]
76. Robinson KA, Weinstein ML, Lindenmayer GE, Buse MG. Effects of diabetes and hyperglycemia on the hexosamine synthesis pathway in rat muscle and liver. Diabetes. 1995;44:1438‐1446. [DOI] [PubMed] [Google Scholar]
77. Nie H, Yi W. O‐GlcNAcylation, a sweet link to the pathology of diseases. J Zhejiang Univ Sci B. 2019;20:437‐448. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

FSB2-38-e70176-s001.pptx^{(2.2MB, pptx)}

Data Availability Statement

Data from the current study are available from the corresponding author upon reasonable request.

[fsb270176-bib-0001] 1. CDC . National Diabetes Statistics Report. US Department HHS; 2022. [Google Scholar]

[fsb270176-bib-0002] 2. Moller DE. New drug targets for type 2 diabetes and the metabolic syndrome. Nature. 2001;414:821‐827. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0003] 3. DeFronzo RA, Jacot E, Jequier E, Maeder E, Wahren J, Felber JP. The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes. 1981;30:1000‐1007. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0004] 4. DeFronzo RA, Tripathy D. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes Care. 2009;32(Suppl 2):S157‐S163. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0005] 5. Merz KE, Thurmond DC. Role of skeletal muscle in insulin resistance and glucose uptake. Compr Physiol. 2020;10:785‐809. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0006] 6. DeFronzo RA. Lilly lecture 1987. The triumvirate: beta‐cell, muscle, liver. A collusion responsible for NIDDM. Diabetes. 1988;37:667‐687. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0007] 7. Facchini FS, Hua N, Abbasi F, Reaven GM. Insulin resistance as a predictor of age‐related diseases. J Clin Endocrinol Metab. 2001;86:3574‐3578. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0008] 8. Haffner SM. Epidemiology of insulin resistance and its relation to coronary artery disease. Am J Cardiol. 1999;84:11J‐14J. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0009] 9. Krentz AJ, Viljoen A, Sinclair A. Insulin resistance: a risk marker for disease and disability in the older person. Diabet Med. 2013;30:535‐548. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0010] 10. Berlanga‐Acosta J, Guillen‐Nieto G, Rodriguez‐Rodriguez N, et al. Insulin resistance at the crossroad of Alzheimer disease pathology: a review. Front Endocrinol (Lausanne). 2020;11:560375. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0011] 11. Chiefari E, Mirabelli M, La Vignera S, et al. Insulin resistance and cancer: in search for a causal link. Int J Mol Sci. 2021;22:11137. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0012] 12. Ginsberg HN. Insulin resistance and cardiovascular disease. J Clin Invest. 2000;106:453‐458. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0013] 13. Wallberg‐Henriksson H, Constable SH, Young DA, Holloszy JO. Glucose transport into rat skeletal muscle: interaction between exercise and insulin. J Appl Physiol (1985). 1988;65:909‐913. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0014] 14. Cartee GD. Mechanisms for greater insulin‐stimulated glucose uptake in normal and insulin‐resistant skeletal muscle after acute exercise. Am J Physiol Endocrinol Metab. 2015;309:E949‐E959. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0015] 15. Cartee GD, Young DA, Sleeper MD, Zierath J, Wallberg‐Henriksson H, Holloszy JO. Prolonged increase in insulin‐stimulated glucose transport in muscle after exercise. Am J Phys. 1989;256:E494‐E499. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0016] 16. Perseghin G, Price TB, Petersen KF, et al. Increased glucose transport‐phosphorylation and muscle glycogen synthesis after exercise training in insulin‐resistant subjects. N Engl J Med. 1996;335:1357‐1362. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0017] 17. Mikines KJ, Sonne B, Farrell PA, Tronier B, Galbo H. Effect of physical exercise on sensitivity and responsiveness to insulin in humans. Am J Phys. 1988;254:E248‐E259. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0018] 18. Wojtaszewski JF, Hansen BF, Kiens B, Richter EA. Insulin signaling in human skeletal muscle: time course and effect of exercise. Diabetes. 1997;46:1775‐1781. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0019] 19. Wojtaszewski JF, Hansen BF, Gade Kiens B, Markuns JF, Goodyear LJ, Richter EA. Insulin signaling and insulin sensitivity after exercise in human skeletal muscle. Diabetes. 2000;49:325‐331. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0020] 20. Richter EA, Garetto LP, Goodman MN, Ruderman NB. Muscle glucose metabolism following exercise in the rat: increased sensitivity to insulin. J Clin Invest. 1982;69:785‐793. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0021] 21. Pencek RR, James F, Lacy DB, et al. Interaction of insulin and prior exercise in control of hepatic metabolism of a glucose load. Diabetes. 2003;52:1897‐1903. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0022] 22. Nagasawa J, Sato Y, Ishiko T. Time course of in vivo insulin sensitivity after a single bout of exercise in rats. Int J Sports Med. 1991;12:399‐402. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0023] 23. McConell GK, Kaur G, Falcao‐Tebas F, Hong YH, Gatford KL. Acute exercise increases insulin sensitivity in adult sheep: a new preclinical model. Am J Physiol Regul Integr Comp Physiol. 2015;308:R500‐R506. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0024] 24. Kjobsted R, Munk‐Hansen N, Birk JB, et al. Enhanced muscle insulin sensitivity after contraction/exercise is mediated by AMPK. Diabetes. 2017;66:598‐612. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0025] 25. Hamada T, Arias EB, Cartee GD. Increased submaximal insulin‐stimulated glucose uptake in mouse skeletal muscle after treadmill exercise. J Appl Physiol (1985). 2006;101:1368‐1376. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0026] 26. Bogardus C, Thuillez P, Ravussin E, Vasquez B, Narimiga M, Azhar S. Effect of muscle glycogen depletion on in vivo insulin action in man. J Clin Invest. 1983;72:1605‐1610. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0027] 27. Castorena CM, Arias EB, Sharma N, Cartee GD. Postexercise improvement in insulin‐stimulated glucose uptake occurs concomitant with greater AS160 phosphorylation in muscle from normal and insulin‐resistant rats. Diabetes. 2014;63:2297‐2308. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0028] 28. Iwabe M, Kawamoto E, Koshinaka K, Kawanaka K. Increased postexercise insulin sensitivity is accompanied by increased AS160 phosphorylation in slow‐twitch soleus muscle. Physiol Rep. 2014;2:e12162. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0029] 29. Schweitzer GG, Arias EB, Cartee GD. Sustained postexercise increases in AS160 Thr642 and Ser588 phosphorylation in skeletal muscle without sustained increases in kinase phosphorylation. J Appl Physiol (1985). 2012;113:1852‐1861. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0030] 30. Hansen PA, Nolte LA, Chen MM, Holloszy JO. Increased GLUT‐4 translocation mediates enhanced insulin sensitivity of muscle glucose transport after exercise. J Appl Physiol (1985). 1998;85:1218‐1222. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0031] 31. Henriksson J. Influence of exercise on insulin sensitivity. J Cardiovasc Risk. 1995;2:303‐309. [PubMed] [Google Scholar]

[fsb270176-bib-0032] 32. Goodyear LJ, Kahn BB. Exercise, glucose transport, and insulin sensitivity. Annu Rev Med. 1998;49:235‐261. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0033] 33. Borghouts LB, Keizer HA. Exercise and insulin sensitivity: a review. Int J Sports Med. 2000;21:1‐12. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0034] 34. Richter EA, Derave W, Wojtaszewski JF. Glucose, exercise and insulin: emerging concepts. J Physiol. 2001;535:313‐322. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0035] 35. Holloszy JO. Exercise‐induced increase in muscle insulin sensitivity. J Appl Physiol (1985). 2005;99:338‐343. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0036] 36. Jensen J, Rustad PI, Kolnes AJ, Lai YC. The role of skeletal muscle glycogen breakdown for regulation of insulin sensitivity by exercise. Front Physiol. 2011;2:112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0037] 37. Funai K, Schweitzer GG, Sharma N, Kanzaki M, Cartee GD. Increased AS160 phosphorylation, but not TBC1D1 phosphorylation, with increased postexercise insulin sensitivity in rat skeletal muscle. Am J Physiol Endocrinol Metab. 2009;297:E242‐E251. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0038] 38. Koshinaka K, Sano A, Howlett KF, et al. Effect of high‐intensity intermittent swimming on postexercise insulin sensitivity in rat epitrochlearis muscle. Metabolism. 2008;57:749‐756. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0039] 39. Gulve EA, Cartee GD, Zierath JR, Corpus VM, Holloszy JO. Reversal of enhanced muscle glucose transport after exercise: roles of insulin and glucose. Am J Phys. 1990;259:E685‐E691. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0040] 40. Burke LM, van Loon LJC, Hawley JA. Postexercise muscle glycogen resynthesis in humans. J Appl Physiol (1985). 2017;122:1055‐1067. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0041] 41. Hingst JR, Bruhn L, Hansen MB, et al. Exercise‐induced molecular mechanisms promoting glycogen supercompensation in human skeletal muscle. Mol Metab. 2018;16:24‐34. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0042] 42. Derave W, Hansen BF, Lund S, Kristiansen S, Richter EA. Muscle glycogen content affects insulin‐stimulated glucose transport and protein kinase B activity. Am J Physiol Endocrinol Metab. 2000;279:E947‐E955. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0043] 43. Pederson BA, Chen H, Schroeder JM, Shou W, DePaoli‐Roach AA, Roach PJ. Abnormal cardiac development in the absence of heart glycogen. Mol Cell Biol. 2004;24:7179‐7187. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0044] 44. Xirouchaki CE, Mangiafico SP, Bate K, et al. Impaired glucose metabolism and exercise capacity with muscle‐specific glycogen synthase 1 (gys1) deletion in adult mice. Mol Metab. 2016;5:221‐232. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0045] 45. Moore CB, Guthrie EH, Huang MT, Taxman DJ. Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol. 2010;629:141‐158. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0046] 46. Rao DD, Vorhies JS, Senzer N, Nemunaitis J. siRNA vs. shRNA: similarities and differences. Adv Drug Deliv Rev. 2009;61:746‐759. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0047] 47. Kwak SE, Zheng A, Arias EB, et al. A novel genetic model provides a unique perspective on the relationship between postexercise glycogen concentration and increases in the abundance of key metabolic proteins after acute exercise. PLoS One. 2024;19:e0295964. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0048] 48. Fisher JS, Gao J, Han DH, Holloszy JO, Nolte LA. Activation of AMP kinase enhances sensitivity of muscle glucose transport to insulin. Am J Physiol Endocrinol Metab. 2002;282:E18‐E23. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0049] 49. Kjobsted R, Treebak JT, Fentz J, et al. Prior AICAR stimulation increases insulin sensitivity in mouse skeletal muscle in an AMPK‐dependent manner. Diabetes. 2015;64:2042‐2055. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0050] 50. Pataky MW, Yu CS, Nie Y, et al. Skeletal muscle fiber type‐selective effects of acute exercise on insulin‐stimulated glucose uptake in insulin‐resistant, high‐fat‐fed rats. Am J Physiol Endocrinol Metab. 2019;316:E695‐E706. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0051] 51. Wang H, Arias EB, Pataky MW, Goodyear LJ, Cartee GD. Postexercise improvement in glucose uptake occurs concomitant with greater gamma3‐AMPK activation and AS160 phosphorylation in rat skeletal muscle. Am J Physiol Endocrinol Metab. 2018;315:E859‐E871. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0052] 52. Kjobsted R, Hingst JR, Fentz J, et al. AMPK in skeletal muscle function and metabolism. FASEB J. 2018;32:1741‐1777. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0053] 53. Pataky MW, Arias EB, Wang H, Zheng X, Cartee GD. Exercise effects on gamma3‐AMPK activity, phosphorylation of Akt2 and AS160, and insulin‐stimulated glucose uptake in insulin‐resistant rat skeletal muscle. J Appl Physiol (1985). 2020;128:410‐421. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0054] 54. Milan D, Jeon JT, Looft C, et al. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science. 2000;288:1248‐1251. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0055] 55. Barnes BR, Marklund S, Steiler TL, et al. The 5'‐AMP‐activated protein kinase gamma3 isoform has a key role in carbohydrate and lipid metabolism in glycolytic skeletal muscle. J Biol Chem. 2004;279:38441‐38447. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0056] 56. Costford SR, Kavaslar N, Ahituv N, et al. Gain‐of‐function R225W mutation in human AMPKgamma(3) causing increased glycogen and decreased triglyceride in skeletal muscle. PLoS One. 2007;2:e903. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0057] 57. Crawford SA, Costford SR, Aguer C, et al. Naturally occurring R225W mutation of the gene encoding AMP‐activated protein kinase (AMPK)gamma(3) results in increased oxidative capacity and glucose uptake in human primary myotubes. Diabetologia. 2010;53:1986‐1997. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0058] 58. Barnes BR, Glund S, Long YC, Hjalm G, Andersson L, Zierath JR. 5'‐AMP‐activated protein kinase regulates skeletal muscle glycogen content and ergogenics. FASEB J. 2005;19:773‐779. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0059] 59. Barnes BR, Long YC, Steiler TL, et al. Changes in exercise‐induced gene expression in 5'‐AMP‐activated protein kinase gamma3‐null and gamma3 R225Q transgenic mice. Diabetes. 2005;54:3484‐3489. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0060] 60. Garcia‐Roves PM, Osler ME, Holmstrom MH, Zierath JR. Gain‐of‐function R225Q mutation in AMP‐activated protein kinase gamma3 subunit increases mitochondrial biogenesis in glycolytic skeletal muscle. J Biol Chem. 2008;283:35724‐35734. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0061] 61. Janzen NR, Whitfield J, Hoffman NJ. Interactive roles for AMPK and glycogen from cellular energy sensing to exercise metabolism. Int J Mol Sci. 2018;19:3344. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0062] 62. Hardman SE, Hall DE, Cabrera AJ, Hancock CR, Thomson DM. The effects of age and muscle contraction on AMPK activity and heterotrimer composition. Exp Gerontol. 2014;55:120‐128. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0063] 63. Zheng A, Arias EB, Wang H, et al. Exercise‐induced improvement in insulin‐stimulated glucose uptake by rat skeletal muscle is absent in male AS160‐knockout rats, partially restored by muscle expression of Phosphomutated AS160, and fully restored by muscle expression of wild‐type AS160. Diabetes. 2022;71:219‐232. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0064] 64. Castorena CM, Mackrell JG, Bogan JS, Kanzaki M, Cartee GD. Clustering of GLUT4, TUG, and RUVBL2 protein levels correlate with myosin heavy chain isoform pattern in skeletal muscles, but AS160 and TBC1D1 levels do not. J Appl Physiol (1985). 2011;111:1106‐1117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0065] 65. Delp MD, Duan C. Composition and size of type I, IIA, IID/X, and IIB fibers and citrate synthase activity of rat muscle. J Appl Physiol (1985). 1996;80:261‐270. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0066] 66. Cartee G, Bohn E. Growth hormone reduces glucose transport but not GLUT‐1 or GLUT‐4 in adult and old rats. American Journal of Physiology‐Endocrinology and Metabolism. 1995;268:E902‐E909. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0067] 67. Wang H, Zheng A, Arias EB, Cartee GD. Prior AICAR induces elevated glucose uptake concomitant with greater gamma3‐AMPK activation and reduced membrane cholesterol in skeletal muscle from 26‐month‐old rats. Facets (Ott). 2022;7:774‐791. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0068] 68. Wang H, Arias EB, Treebak JT, Cartee GD. Exercise effects on gamma3‐AMPK activity, Akt substrate of 160 kDa phosphorylation, and glucose uptake in muscle of normal and insulin‐resistant female rats. J Appl Physiol (1985). 2022;132:140‐153. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0069] 69. Wang H, Kwak SE, Zheng A, et al. Phosphorylation of AS160‐serine 704 is not essential for exercise‐increase in insulin‐stimulated glucose uptake by skeletal muscles from female or male rats. Am J Physiol Endocrinol Metab. 2024;326:E807‐E818. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0070] 70. Arias EB, Wang H, Cartee GD. Akt substrate of 160 kDa dephosphorylation rate is reduced in insulin‐stimulated rat skeletal muscle after acute exercise. Physiol Res. 2018;67:143‐147. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0071] 71. Schweitzer GG, Cartee GD. Postexercise skeletal muscle glucose transport is normal in kininogen‐deficient rats. Med Sci Sports Exerc. 2011;43:1148‐1153. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0072] 72. Holtz KA, Stephens BR, Sharoff CG, Chipkin SR, Braun B. The effect of carbohydrate availability following exercise on whole‐body insulin action. Appl Physiol Nutr Metab. 2008;33:946‐956. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0073] 73. An HJ, Froehlich JW, Lebrilla CB. Determination of glycosylation sites and site‐specific heterogeneity in glycoproteins. Curr Opin Chem Biol. 2009;13:421‐426. [DOI] [PMC free article] [PubMed] [Google Scholar]

[fsb270176-bib-0074] 74. Arias EB, Kim J, Cartee GD. Prolonged incubation in PUGNAc results in increased protein O‐linked glycosylation and insulin resistance in rat skeletal muscle. Diabetes. 2004;53:921‐930. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0075] 75. Nelson BA, Robinson KA, Koning JS, Buse MG. Effects of exercise and feeding on the hexosamine biosynthetic pathway in rat skeletal muscle. Am J Phys. 1997;272:E848‐E855. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0076] 76. Robinson KA, Weinstein ML, Lindenmayer GE, Buse MG. Effects of diabetes and hyperglycemia on the hexosamine synthesis pathway in rat muscle and liver. Diabetes. 1995;44:1438‐1446. [DOI] [PubMed] [Google Scholar]

[fsb270176-bib-0077] 77. Nie H, Yi W. O‐GlcNAcylation, a sweet link to the pathology of diseases. J Zhejiang Univ Sci B. 2019;20:437‐448. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Genetic reduction of skeletal muscle glycogen synthase 1 abundance reveals that the refeeding‐induced reversal of elevated insulin‐stimulated glucose uptake after exercise is not attributable to achieving a high muscle glycogen concentration

Seong Eun Kwak

Haiyan Wang

Xiufang Pan

Dongsheng Duan

Gregory D Cartee

Abstract

Abbreviations

1. INTRODUCTION

2. RESEARCH DESIGN AND METHODS

2.1. Materials

2.2. Animal treatment

2.3. Preparation of AAV expressing short‐hairpin RNAs

2.4. AAV administration

FIGURE 1.

2.5. Ex vivo incubations of muscles for glucose uptake

2.6. Muscle lysate preparation

2.7. Muscle glucose uptake

2.8. AMPK‐γ3 activity

2.9. Muscle glycogen measurement

2.10. Immunoblotting

2.11. Statistics

3. RESULTS

3.1. 3hPEX: Food intake and body mass

3.2. 3hPEX: glycogen synthase 1, HKII, and GLUT4 abundance

FIGURE 2.

3.3. 3hPEX: muscle glycogen

FIGURE 3.

3.4. 3hPEX: muscle glucose uptake

3.5. 3hPEX: AMPK‐γ3 activity and phosphorylation of AMPK and ACC

FIGURE 4.

3.6. 3hPEX: Phosphorylation of AKT and AS160

FIGURE 5.

3.7. 6hPEX: Food intake and body mass

3.8. 6hPEX: Glycogen synthase 1, HKII, and GLUT4 abundance

FIGURE 6.

3.9. 6hPEX: Muscle glycogen

FIGURE 7.

3.10. 6hPEX: Muscle glucose uptake

3.11. 3hPEX and 6hPEX: Correlations between muscle glucose uptake and glycogen

FIGURE 8.

3.12. 6hPEX: Phosphorylation of AMPK and ACC

FIGURE 9.

3.13. 6hPEX: Phosphorylation AKT and AS160

FIGURE 10.

4. DISCUSSION

AUTHOR CONTRIBUTIONS

FUNDING INFORMATION

DISCLOSURES

Supporting information

ACKNOWLEDGMENTS

DATA AVAILABILITY STATEMENT

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases