Circulating mRNA Expression of VEGF, PTEN, and SOCS1 as Potential Prognostic Predictor for Nasopharyngeal Carcinoma Progression

Abstract

Background:

The molecular mechanisms underlying nasopharyngeal carcinoma (NPC) progression remain poorly understood. In particular, the roles of circulating mRNAs encoding key regulatory proteins have yet to be explored. This study aimed to identify NPC-associated expression signatures of circulating VEGF, PTEN, and SOCS1 mRNAs and their potential as biomarkers.

Methods:

A case-control study was conducted comprising 160 nasopharyngeal carcinoma (NPC) patients and 80 controls, from whom peripheral blood samples. Total RNA was extracted and the levels of VEGF, PTEN, and SOCS1 mRNAs were quantified using reverse transcription quantitative PCR (RT-qPCR). Relative expression was calculated using the 2^-ΔΔCt method. Bioinformatic analyses, including GeneMANIA, Gene Ontology (GO), and KEGG pathway analysis, were performed to predict the functional roles and interactions of these mRNAs.

Results:

We identified significantly increased circulating VEGF mRNA in lymph node metastases (1.66-fold, p<0.05) and elevated SOCS1 mRNA in late-stage NPC (20-fold, p<0.05). PTEN mRNA was reduced 4.26-fold in NPC patients. These data suggest that circulating VEGF, PTEN, and SOCS1 mRNAs represent signatures of NPC progression and can potentially be biomarkers. Network analyses implicate these mRNAs in mechanisms enabling NPC pathogenesis.

Conclusions:

Our study reveals NPC-associated expression changes of circulating VEGF, PTEN, and SOCS1 mRNAs. These molecular signatures may serve as biomarkers during NPC progression and provide insights into underlying mechanisms. Further validation of their utility as prognostic indicators of NPC is warranted.

Introduction

Nasopharyngeal carcinoma (NPC) is an epithelial malignancy arising within the nasopharynx [1, 2]. In 2018, approximately 129,079 people worldwide, with 85% in Asia, were diagnosed with nasopharyngeal cancer, making it the 23rd most common cancer globally. Indigenous populations in East and Southeast Asia, the Arctic, North Africa, and the Middle East have been affected by NPC for many years. In Southeast Asia, NPC ranked 9th among incident cancers and 8th among cancer-related deaths [3]. In 2020, NPC caused the death of 80,008 cancer patients worldwide, with 85.5% in Asia of those deaths occurring in Asia [4]. Surprisingly, Indonesia ranked fifth globally regarding new NPC cases in 2020, with 19,943 new cases reported. NPC prevalence in Indonesia was approximately 28.35% (948 of 3344), followed by a prevalence of 14.35% for skin cancer and 12.3% for lymphoid malignancies, resulting in 13,399 deaths in the same year [4, 5]. Mortality and year-life rates for NPC showed an increase with age and were higher in males than females [6, 7]. Managing NPC poses significant challenges due to recognizing its signs and symptoms. Delays in seeking medical advice, misleading symptoms, and challenges inclinical examinations of the nasopharynx result in late- stage diagnoses [8]. Distinguishing early-stage NPC from nasopharyngeal lymphoma using imaging-based methods is challenging, as NPC tumors near the skull base exhibit irregular shapes. These challenges often rely on clinicians’ subjective interpretations. Hence, developing alternative laboratory methods to assist with NPC diagnosis is necessary.

Early and effective diagnosis and treatment are crucial to prevent NPC progression, recurrence, or metastasis. The gold standard for diagnosing primary NPCs involves pathological assessment of postnatal space biopsies. However, tissue biopsy procedures are invasive and painful, leading to lower patient compliance and delayed diagnosis until the disease has advanced [9]. While tissue biopsy remains the preferred diagnostic method in a clinical setting, liquid biopsy of cancer-related materials in the bloodstream offers a promising alternative [10]. Liquid biopsy utilizes circulating tumor cells, tumor cell fragments, nucleic acids, and proteins to improve cancer diagnosis and enable early detection. One such molecule in tumor cells is messenger RNA (mRNA) [11].

mRNA (messenger RNA) is a large family of RNA molecules that carry genetic information of DNA and serve as templates for protein synthesis by ribosomes [12]. Circulating RNA, including tumor-associated cell- free mRNA, has been detected in the plasma/ serum of cancer patients and healthy individuals. Detecting tumor-associated cell-free mRNA opens new avenues for cancer screening and monitoring [13]. Accumulating evidence suggests that dysregulated mRNA expression, particularly abnormal expression of tumor-associated mRNA, is closely linked to the development of various diseases, including NPC [14]. Studies have shown that cell-free mRNA from cancer patients can be utilized as an early detection and diagnosis tool for various types of cancers [15]. Additionally, elevated mRNA expression has been associated with poor prognosis and clinical status in patients.

In this study, we aimed to quantify circulating VEGF, PTEN, and SOCS1 mRNA expression in NPC patients compared to healthy controls. Correlations between mRNA levels and salient clinical and pathological features were evaluated. We further sought to assess the feasibility of plasma VEGF, PTEN, and SOCS1 mRNA quantification for non-invasive diagnosis and prognostication in NPC. Our overarching goal was to evaluate these mRNA biomarkers to improve NPC detection and clinical management in high-risk groups such as Indonesian populations.

Materials and Methods

Ethical statement

This study was approved by the Ethical Committee Jenderal Soedirman University, Indonesia (Number: 016/KEPK/PE/IV/2022), and the research followed the Helsinki Declaration. All participants provided informed consent prior to enrollment.

Study Participants

The study comprised peripheral blood patients with NPC (N = 160) and non–tumor patients [80]. Peripheral blood was collected in the EDTA-contained tubes, and plasma isolation was conducted by centrifuge at 1500 rpm for 10 minutes at 4ºC. Long-term storage was saved at a temperature of -80 °C. NPC diagnosis was confirmed by histopathology and elevated EBV serological markers (EBV-EA, EBV-EBNA, EBV-VCA). Clinical data,

including tumor stage, nodal status, and histological grade, were obtained from medical records. Demographic and clinical characteristics of the study cohort are summarized in Table 1.

Table 1.

Clinical Pathology Data of the Subject Involved in This Study

Characteristic	N=240	Percent (%)
Nasopharyngeal Carcinoma	160	33
Non-tumor	80	67
Age
Median	47
Range	14-68
Sex
Male	106	59
Female	74	41
Histology
WHO I	0	0
WHO II	24	15
WHO III	49	31
WHO IV	87	54
N Lymph Node
N0	10	6
N1	43	27
N2	58	36
N3	49	31
T Classification
T1	6	4
T2	71	44
T3	37	23
T4	46	29
Clinical Stages
I	0	0
II	25	16
III	49	31
IV	86	54
Pathology Anatomy
Undifferentiated	31	19
Non-Keratin, Undif Sub Type	117	73
Non-Keratin, Differentiated	9	6
Keratin	3	2
EBV - EA
Positive	132	83
Negative	28	18
EBV - EBNA
Positive	111	69
Negative	49	31
EBV - VCA
Positive	145	91
Negative	15	9

RNA Extraction and cDNA Synthesis

The total plasma extraction volume was 200 µl utilizing miRCURY-Biofluids, Exiqon Denmark (Cat no. 30112). Plasma was combined with lysis buffer and protein precipitation solution before being centrifuged at 12,000 revolutions per minute (rpm). Total RNA was eluted with 25 µl of RNAse-free water, and internal control was conducted by adding sp6. 8–64 rxns cDNA synthesis using universal cDNA synthesis kit II (Cat No. 203301, Exiqon). The cDNA synthesis utilized a Bio-Rad C1000 thermal cycle with conditions of 42°C for 60 minutes, 95°C for 5 minutes, and 4°C. Every condition and technique followed the manufacturer’s recommendations.

qPCR Analysis of mRNA Expression

The procedure of quantifying mRNA using SYBR Green master mix 2,5 mL (Catalog No. 203402, Exiqon) and sequencing primer is detailed in Table 2. cDNA was diluted with a ratio of 1:80 by adding nuclease-free water to 5 µl of cDNA. The primer sequence for this study is shown in Table 2. Quantification was performed using real-time PCR on Biorad CFX 96 with the following conditions: 95°C for 10 minutes, 95°C for 10 seconds, and 58°C, with a 1-minute ramp rate of 1.6°C/s. Every procedure followed the manufacturer’s instructions.

Table 2.

Relative Expression of Circulating mRNA VEGF, PTEN, and SOCS1 Correlated with Clinical Status in Nasopharyngeal Carcinoma.

Variable		Fold Change
	mRNA VEGF	mRNA PTEN	mRNA SOCS1
Cases
NPC vs Healthy Control	1.02	1	20.0*
N- Regional Lymph Nodes
N1 and N2 vs N3 and N4	1.66*	1.53	1.89
T- Primary Tumor
T1 and T2 vs T3 and T4	1.5	1.51	1.11
Stage
Early Stage vs Late Stage	1.28	1.8	4.26*

*, differences in significance P Value

Construction of PPI and Enrichment Analysis

An online server that explores the interconnection between proteins regarding physical interaction, co- expression, predicted, co-localized, common pathway, genetic interaction, and shared protein domain.

Functional enrichment and construction of a regulatory network

Functional enrichment analysis was conducted using the online software databases Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). Oncology-related mRNA VEGF, PTEN, and SOCS1 were analyzed to determine their biological processes. In addition, the regulatory network was constructed using the internet application STRING (https://string-db.org/). Interaction score >0.7 (high confidence) was selected as the cutoff criterion; proteins with high scores were deemed hub factors in the network and may be significant candidate genes for disease development.

Data Analysis

Cycle quantification (cq) was accomplished via Genex Pro with Exiqon qPCR wizard, qPCR analysis software, and a perpetual academic license (Cat No. 207006, Exiqon). Livak’s methods were used to show the data [16]. The Software GenEx-6 Multid analysis and comparative expression data were used. Statistical analysis was also used to determine how the two groups’ expressions and clinical status differed. All two-sided statistical tests with a p-value of 0.05 indicated statistical significance. GraphPad Prism 6 generated the graphical evaluation (La Jolla, CA, USA).

Results

Patient Characteristics

Participants’ demographic and clinical characteristics in this research can be seen in Table 1. Peripheral blood was drawn from 240 tubes, including 80 non-control and 160 nasopharyngeal carcinoma (NPC) cases. More men were diagnosed than women. Between 14 to 68 years of age, 59% of males and 41% of women were diagnosed. Patients with NPC were grouped based on histology and pathology, a standard by the World Health Organization (WHO). Histologically, it has been known that >50% of NPC patients are WHO type IV, followed by types III and II. Histopathology related to EBV virus infection was found in the patients. The EA, EBNA, and VCA assays were used to measure and confirm the amount of EBV-encoding protein. Demographic and clinical characteristics of the study cohort are summarized in Table 1.

Protein Expression Status of EBV Infection

Validation of protein expression in 160 plasma samples from NPC patients was performed to assess the association between protein expression and the occurrence of NPC. The protein expression of EA, EBNA, and VCA has been assessed using an Elisa reader. EBV-EA was identified in the plasma of 43 (83%) of 132 patients, EBV-EBNA in 111 (69%) patients, and EBV-VCA in 145 (91%) patients. All subjects were verified to be infected with EBV using one or more protein EBV markers.

Circulating level expression mRNA PTEN, VEGF, and SOCS1 across all clinical data

To perform alterations in circulating expression, we utilized qRT-PCR methods, whose primer sequence can be seen in Table 3. A primer sequence detects and quantifies mRNA targets using SYBR fluorescence. With a fold change value, relative quantification analysis determines the expression’s difference [16]. The results showed what kind of cycle quantification (CQ) was found in NPC and control samples. Analysis of the data showed that mRNA is linked to the growth of tumors.

Table 3.

Sequence Primer for Quantification mRNA for This Study

Genes	Target sequence
VEGF A
Forward	5’- GCACCCATGGCAGAAGG -3’
Reverse	5’- CTCGATGGATGGCAGTAGCT -3’
PTEN
Forward	5’-GGGTCTGAGTCGCCTGTC-3’
Reverse	5’-CCGTGTAGGCAGTAGAAG-3’
SOCS1
Forward	5’- GACGCCTGCGGATTCTACTG-3’
Reverse	5’- AGGCCATCTTCACGCTAAGG-3’,
GAPDH
Forward	5’- AAGACGGGCGGAGAGAAACC-3’
Reverse	5’- GTTGACTCCGACCTTCACCTT-3'

Relative expression analysis was conducted based on clinical data using GenEx 6 MultiD. Statistical analysis used a T-test to compare differential groups. Table 3 and Figure 1 present the results of the differential expression of mRNA VEGF, PTEN, and SOCS1 based on the clinical data of the participants. There are four groups, with the clinical status used as a basis for grouping: health and NPC, N-regional lymph nodes, T-primary tumor, and stage. Statistical analysis revealed significant expression of mRNA VEGF in N-regional lymph node status with a fold change of 1.66 [p-value <0.05]. Moreover, mRNA SOCS1 indicated the alteration was associated with NPC status with a fold change of 20 [p-value <0.05] and stage status with a fold change of 4.26 (p-value <0.05).

Figure 1.

Shows the Correlation of mRNA VEGF, PTEN, and SOCS1 Circulation with Clinical Status in Nasopharyngeal Carcinoma. a. mRNA VEGF; b. mRNA PTEN; c. mRNA SOCS 1, * indicated significant results based on statistical analysis.

Construction of PPI and Enrichment Analysis

To explore the potential PPI network, mechanism, function, and biological process of three genes, VEGF, PTEN, and SOCS1, we performed an analysis applying GeneMANIA. The relative findings are represented in Figure 2. Furthermore, we present the results of biological processes, interactions, and molecular mechanisms in Tables 2, 3. These indicated the potential mechanisms of three genes in NPC progression, which provide additional insights for further study.

Figure 2.

GeneMania Constructed the PPI Network of Three Genes. PPI networks are protein connections investigated in physical interactions, co-expressions, predicted co-localization, genetic interactions, pathways, and shared protein domains.

Gene Ontology and Kyoto Encyclopedia of Genes and Genome Analysis

The annotation, visualization, and integrated discovery database have been analyzed using ShinyGo 0.77 (http:// bioinformatics.sdstate.edu/go/). David KEGG Pathways (https://www.genome.jp/kegg/brite.html) were applied to perform genome ontology [GO] and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to perform three hub genes and their most relevant conditions occurring in cancer. When the FDR was less than 0.05, enrichment terms were considered statistically significant, and the top 10 terms from each analysis were kept in a bubble chart (Figure 3).

Figure 3.

GO and KEGG Pathway Enrichment Analyses were Performed to Explain the Potential Mechanisms and Their Co-Operators: a. biological process, b. cellular component, c. molecular function, and d. KEGG pathway analysis. The size of each circle indicates the counting number on each part, while the color represents the FDR of the enrichment analysis.

Discussion

NPC is a unique epithelial malignancy distributed in China, Southeast Asia, and Northern Africa. Its pathogenesis is correlated with EBV infection, genetics, diet (such as saltfish consumption), and environment. Chemotherapy and radiotherapy are often used to treat people with NPC, and it is hoped that this will increase the number of people who will live after being diagnosed [17,18]. In this study, we analyze the circulating differential expression of mRNA (VEGF, PTEN, and SOCS) from Nasopharyngeal Carcinoma (NPC) and examine its association with clinical outcomes. Moreover, co-expression analysis was conducted to recognize module and clinical traits.

On the other hand, individualized development, early diagnosis, and treatment at the molecular level required further development. Consequently, delays in diagnosis and treatment made improving the patient’s condition challenging. Molecular biology could become a potential approach to eliminating the problem in the cancer field. Molecular biology has aggressively moved toward a simple phase that supports advanced technology, and bioinformatics is approaching a novel stage in data extraction and analysis. It became one of the best approaches for researchers to find out the problem and effectively find disease treatment through reading the nucleotide sequence, the exact location of all genes, genomic information, and alterations of genomes that have a role in diseases, including cancer. Identifying a gene, protein, cellular mechanisms, and profile expression could become more effective in finding biomarkers and therapeutic drug candidates for cancer.

Co-expression analysis is an efficient and effective strategy for gene or disease prediction. In this study, we looked at circulating messenger RNA [mRNA], which represents tumor cell condition and could be used as a support marker to detect and predict NPC prognosis. Moreover, an analysis of bioinformatics is needed to evaluate the correlation between gene expression and clinical outcome relating to the mechanism and high connecting activity for three genes (VEGF, PTEN, and SOCS1) related to cancer. We found that the expression of mRNA VEGF, PTEN, and SOCS was significantly correlated with the status of malignancy (fold change of 20; p <0.05), lymph nodes (fold change of 1.66; p <0.05), and stage (fold change of 4.26; p <0.05).

VEGF is a platelet-derived growth factor family member contributing to vascular endothelial cells, mitogenesis, and angiogenesis. VEGF contributes to the suppression of maturing dendritic cells and the facilitation of the leakage of vascular matter, thus providing an extracellular matrix for the formation of vascularization [19]. Its expression was found in various circulating samples, indicating a prognostic indicator of lymph node, angiogenesis, metastases, recurrence, and decreased survival, including head and neck cancer [20, 9, 21]. Furthermore, alterations in the expression of VEGF were reported to be associated with advanced tumor stage and consistently with poor overall survival (OS) and disease-free survival (DFS) [22, 23]. Therefore, VEGF is a significant target for inhibiting tumor angiogenesis.

On the other hand, PTEN is located on chromosome 10q23, a tumor suppressor that correlates with initiation and progression in NPC. Alterations in the expression of PTEN would impact cellular processes, including senescence, angiogenesis, apoptosis, cell cycle progression, cell proliferation, chemotaxis, muscle contraction, and the DNA damage response [24]. Inactivated PTEN in somatic cancer is associated with the second most frequently mutated gene after p53 [25].

Cytokines in cancer cause SOCS-1 dysregulation, which provides negative feedback on cytokine expression and inhibits macrophage response to IFN-. Negatively regulates JAK/STAT signaling through binding crucial phosphotyrosine residues in cytokine receptor cytoplasmic domains and the kinase inhibitory region pathway. It fits a previous study that showed that SOCS1 mRNA expression was 200 times higher in people with NPC. These consistent findings revealed that SOCS1 mRNA expression increased in NPC patients and more in early- stage NPC patients than in late-stage NPC patients. SOCS1 can be used not only as a biomarker of NPC but SOCS1 can also as an assessor of whether the NPC is in an early or advanced stage. Further research is needed to prove this.

PTEN is usually inactivated in somatic cancer and is the second most frequently mutated tumor suppressor gene after p53. The role of PTEN in cancer is known widely as a tumor suppressor [26]. It has a function for cell growth, proliferation, and differentiation [27]. Some previous studies show that loss of PTEN is associated with gastric, colorectal, and breast cancer [28–30]. Identifying PTEN in NPC is essential, whether it can be a marker for tracing the disease. We found a decreased amount of PTEN in nasopharyngeal carcinoma, which has the same result as the findings of Li et al. [7]. The average expression levels of PTEN in a patient with NPC significantly declined compared to the control group. PTEN loss is also associated with poor prognostic tumors, but our study did not differentiate the clinical outcome of NPC between samples.

Our research further validated the role and function of the three mRNA for cancer. Furthermore, we employed GeneMANIA to construct a PPI network and GoShine to apply GO and KEGG analysis to identify the functional enrichment of three hub genes and the interaction that potential mechanism represents the condition in NPC progression. Analyses performed the alterations expressions significantly related to endothelial cell proliferation and cellular response to vascular endothelial growth factor stimulus. Our findings provided novel insight for hub three genes mediating endothelial cell proliferation and vascularization associated with NPC oncogenesis and development.

In conclusion, our study reveals significant alterations in VEGF, PTEN, and SOCS1 mRNA expression in Nasopharyngeal Carcinoma [NPC], which are associated with poor prognosis. These findings suggest the potential of using these molecular signatures as biomarkers to track the progression of NPC and predict clinical outcomes. The comprehensive analysis of gene networks and pathways provides valuable insights into the underlying mechanisms of NPC progression. Further research and validation studies are needed to explore the clinical implications of these biomarkers and their potential for personalized treatment approaches in NPC.

Author Contribution Statement

TW, HS, SJSI, and ABD: Conceptualization, Supervision, writing, review, and editing; APN, MAPDP, FMLR, RR, TAP, ANA, RRA, MMH, TW, HS:

Investigation; RRA, MMH, TW, HS, SJSI, and ABD: Data Curation; TW: Funding acquisition; APN, MAPDP, FMLR, RR, TAP, ANA, RRA, MMH, TW: writing

original draft. .