Skip to main content
Cytotechnology logoLink to Cytotechnology
. 2025 Jan 5;77(1):37. doi: 10.1007/s10616-024-00698-z

Neurotrophomodulatory effect of TNF-α through NF-κB in rat cortical astrocytes

Jaldeep Langhnoja 1, Lipi Buch 1, Prakash Pillai 1,✉
PMCID: PMC11700960  PMID: 39776978

Abstract

Tumor necrosis factor alpha (TNF-α) is a well-known pro-inflammatory cytokine originally recognized for its ability to induce apoptosis and cell death. However, recent research has revealed that TNF-α also plays a crucial role as a mediator of cell survival, influencing a wide range of cellular functions. The signaling of TNF-α is mediated through two distinct receptors, TNFR1 and TNFR2, which trigger various intracellular pathways, including NF-κB, JNK, and caspase signaling cascades. Both TNFR1 and TNFR2 are expressed in astrocytes, which are specialized glial cells essential for maintaining the structural and functional integrity of the central nervous system (CNS). Astrocytes support neuronal function by regulating brain homeostasis, maintaining synaptic function, and supplying metabolic substrates. In addition, astrocytes are known to secrete a variety of growth factors and neurotrophins, such as nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and NT-4/5. These neurotrophins play a critical role in supporting neuronal survival, synaptic plasticity, and myelination within the brain. The present study focuses on the role of TNF-α in modulating neurotrophin expression and secretion in rat cortical astrocytes. We demonstrate that TNF-α induces the upregulation of neurotrophins, particularly NGF and BDNF, in cultured astrocytes. This effect is accompanied by an increase in the expression of their respective receptors (TrkA & TrkB), further suggesting a functional modulation of neurotrophic signaling pathways. Notably, we show that the modulation of neurotrophin expression by TNF-α is mediated via the NF-κB signaling pathway. Additionally, we observed that TNF-α also regulates the secretion levels of NGF and BDNF into the culture media of astrocytes in a dose-dependent manner, indicating that TNF-α can modulate both the production and release of these growth factors. Taken together, our findings highlight a previously underexplored neuroprotective role of TNF-α in astrocytes. Specifically, we propose that TNF-α, through the upregulation of neurotrophins, may contribute to maintaining neuronal health and supporting neuroprotection under disease conditions.

Keywords: Tumour Necrosis factor alpha [TNF-α], Brain-derived neurotrophic factor [BDNF], Nerve growth factor [NGF], Nuclear Factor –Kappa B [NF-κB], Cortical astrocytes

Introduction

Tumor necrosis factor (TNF) is a key member of the TNF superfamily of cytokines, known for its central role in promoting inflammatory responses and mediating a wide array of biological effects (Wajant et al. 2003; Shen and Pervaiz 2006; Wallach et al. 1999). TNF-α, the most studied isoform of TNF, is secreted not only by immune cells in response to inflammatory stimuli but also by non-immune cells such as glial cells and neurons (Sawada et al. 1989; Thomson and Lotze 2003). This cytokine exerts its diverse biological effects through the activation of two well-characterized transmembrane receptors, which were first identified approximately three decades ago. (Hohmann et al. 1989) The first receptor, TNF receptor 1 (TNFR1), is a 55 kDa protein that is widely expressed across virtually all cell types, including both immune and non-immune cells. TNFR1 mediates several important cellular processes, including cytotoxicity, antiviral responses, fibroblast proliferation, and the activation of the nuclear factor kappa B (NF-κB) signaling pathway, which plays a pivotal role in regulating immune and inflammatory responses. The second receptor, TNF receptor 2 (TNFR2), a 75 kDa protein, is expressed predominantly in immune cells, such as thymocytes, T cells, and monocytes, and is involved in signaling pathways that regulate the proliferation and activation of these cells. (Schall et al. 1990; Smith et al. 1990; Tartaglia and Goeddel 1992). Together, TNFR1 and TNFR2 orchestrate a complex array of cellular responses that contribute to inflammation, immune regulation, and tissue homeostasis.(Choi et al. 2005; Faustman and Davis 2010).

Astrocytes, the most abundant glial cells in the brain, are integral to numerous complex and vital functions within the central nervous system (CNS) (Lipi Buch 2018). These cells not only perform essential housekeeping tasks, such as maintaining the blood–brain barrier and regulating ion homeostasis, but also provide crucial nutrients to neurons, support synaptic function, and serve as key markers of pathological conditions. Astrocytes are involved in the development, maintenance, and repair of CNS myelin, contributing to neuronal health and proper neural signaling. In addition to their structural and metabolic roles, astrocytes are a major source of growth factors and neurotrophins (Jana and Pahan 2017; Sofroniew and Vinters 2010), including nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF), both of which are widely distributed and play pivotal roles in CNS function. NGF primarily binds to the TrkA receptor, while BDNF binds to the TrkB receptor and, in some contexts, the p75 neurotrophin receptor (p75NTR), initiating signaling cascades that regulate various critical processes. These include, neuronal survival (Cheng et al. 1994; Allen et al. 2013), axonal outgrowth (Labelle and Leclerc 2000; Hannan et al. 2015), glial cell proliferation (Douglas-Escobar et al. 2012; Tsiperson et al. 2015) and myelination (Chan et al. 2004; Xiao et al. 2010) all of which are essential for brain development, function, and repair.

Notably, the expression of BDNF and NGF in the CNS increases in response to various insults, underscoring their neuroprotective and neurorestorative roles. BDNF, in particular, has been shown to rescue degenerating neurons, promote axonal outgrowth, support remyelination, and facilitate neuronal regeneration (Murer et al. 2001; Park and Poo 2013; Jaldeep Langhnoja and Pillai 2021; Ouaamari 2023; McGregor 2019; Alhadidi 2023). In addition to their direct effects on neurons, NGF and BDNF contribute to the complex interplay between glial cells and neurons, particularly in response to inflammation. TNF-α, a pro-inflammatory cytokine, has been shown to upregulate BDNF expression in trigeminal ganglion neurons and in astrocytes through the activation of specific signaling pathways (Kuzawińska et al. 2014; Saha et al. 2006). This suggests a dynamic relationship between TNF-α and neurotrophins, where cytokine-neurotrophin crosstalk may promote neuronal survival during inflammatory responses. The bidirectional regulation of TNF-α and NGF expression between glial cells and neurons further supports the hypothesis that TNF-α, while primarily inflammatory, may also contribute to neuroprotection under certain conditions (Takei and Laskey 2008; Takei and L.R., 2008; Allan and Rothwell 2001; Salvo et al. 2021). Recent studies have indicated that astrocyte-conditioned media can exert protective effects by modulating TNF-α levels, highlighting the potential for astrocytes to mitigate inflammatory damage (Song et al. 2019). Furthermore, astrocytes themselves release TNF-α upon stimulation with lipopolysaccharide (LPS), which, in turn, enhances the production of neurotrophins, thereby reinforcing the neuroprotective functions of TNF-α during inflammatory processes.

In the present study, we investigated the transcriptional regulation of key neurotrophins, namely nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF), as well as their respective receptors, TrkA and TrkB, in primary rat astrocytes upon stimulation with tumor necrosis factor alpha (TNF-α). Our results demonstrate that TNF-α signaling leads to the upregulation of both NGF and BDNF, along with an increase in the expression of their receptors, TrkA and TrkB. This modulation occurs through the activation of the IκB-NF-κB signaling pathway, rather than the JNK pathway, highlighting a distinct molecular mechanism underlying TNF-α-induced neurotrophin regulation. Additionally, we observed that TNF-α enhances the secretion of NGF and BDNF in astrocyte-conditioned media, suggesting a functional role for TNF-α in modulating neurotrophin release. These findings underscore the complex interplay between cytokines and neurotrophins in astrocytes and provide valuable insights into the potential neuroprotective effects of TNF-α. This cytokine-neurotrophin crosstalk could be leveraged in the development of therapeutic strategies aimed at modulating neurotrophin levels, offering a potential approach to treating neurodegenerative and other brain-related disorders.

Materials and methods

Primary culture of astrocytes

Primary astrocyte cultures were prepared from postnatal day 0 to 2 (P0–P2) rat cortices, following a well-established protocol (Chen et al. 2007; Langhnoja et al. 2018a; Lipi et al. 2018). Briefly, mixed glial cultures were generated by enzymatically dissociating cortical tissues using papain and mechanical trituration. The resultant cell suspension was plated onto Poly-L-lysine (PLL; Sigma-Aldrich) coated T75 flasks in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco) supplemented with 10% Fetal Bovine Serum (FBS; Gibco) and 1% penicillin–streptomycin (1X; Invitrogen). Cultures were maintained in a humidified incubator at 37 °C with 5% CO₂. The medium was replaced every third day for 10–12 days to allow for the growth and expansion of glial cells.

To purify astrocytes, flasks were sealed and subjected to orbital shaking at 37 °C for 1 h to remove microglia. Following this, cultures were shaken at 37 °C for 18–20 h to selectively remove oligodendrocyte precursor cells (OPCs), resulting in enriched astrocytic cultures (> 95% GFAP-positive cells). These purified astrocytes were subsequently dissociated using 0.1% trypsin (Invitrogen) and passaged for further experimentation.

Experimental protocol

For experimentation, astrocytes were cultured in DMEM supplemented with 10% FBS and 1% penicillin–streptomycin on PLL-coated culture plates. Once cultures reached approximately 80% confluence, astrocytes were treated with varying concentrations of recombinant TNF-α (Cat no. 580102; R&D Systems) at 1 ng/ml, 10 ng/ml, or 50 ng/ml for 24 h. Following treatment, cell lysates and conditioned media were collected for downstream analyses.

RNA isolation and quantitative real-time PCR (RT-PCR)

Total RNA was extracted from TNF-α-treated astrocytes using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. RNA concentrations were quantified using the Qubit RNA Assay Kit (Invitrogen) and the Qubit 2.0 Fluorometer (Invitrogen). cDNA synthesis was carried out using 1 μg of total RNA in a 20 μl reaction volume with the Verso cDNA Synthesis Kit (Thermo Scientific). Quantitative RT-PCR was performed using SYBR Select Master Mix (Applied Biosystems) and analyzed on a QuantStudio 12 K Flex system (Life Technologies). The amplification protocol included an initial denaturation step followed by 40 cycles of amplification and a final melt curve analysis to confirm the specificity of the PCR products. Gene expression levels were normalized to GAPDH as an internal control and analyzed using the 2 − ΔΔCT method (Livak and Schmittgen 2001). Primer sequences used for qPCR are listed in Table 1.

Table 1.

List of primers

Primers Forward Sequence Reverse Sequence References
GAPDH AGACAGCCGCATCTTCTTGT CTTGCCGTGGGTAGAGTCAT Swiss et al. (2011)
NGF TGCATAGCGTAATGTCCATGTTG CTGTGTCAAGGGAATGCTGAA Squillacioti et al. (2009)
BDNF CCATAAGGACGCGGACTTGT GAGGCTCCAAAGGCACTTGA Fuchikami et al. (2009)
TrkA ATGGAGAACCCACAGTACTTC CGTGCAGACTCCAAAGAAGC Vetter et al. (2010)
TrkB CACACACAGGGCTCCTTA AGTGGTGGTCTGAGGTTGG Kondo et al. (2010)

Immunocytochemistry

To characterize primary astrocyte cultures, immunocytochemistry was performed using a Rabbit anti-GFAP primary antibody (Abcam) and an anti-Rabbit FITC-conjugated secondary antibody (Abcam). Astrocytes cultured on coverslips were first rinsed with phosphate-buffered saline (PBS, pH 7.4), fixed in 4% paraformaldehyde (v/v) for 15 min, and then permeabilized with 0.25% Triton X-100 for 10 min. After blocking with 1% bovine serum albumin (BSA) in PBS containing 0.2% Tween 20 (PBST), the cells were incubated overnight at 4 °C with the primary antibody in blocking solution. Following primary antibody incubation, cultures were washed with PBST and incubated for 1 h with the corresponding FITC-conjugated secondary antibody (1:400 dilution in blocking solution). After additional washes with PBS, cells were mounted using anti-fade mounting medium (Invitrogen) and sealed with nail polish. Images were captured using a Carl Zeiss confocal microscope (LSM 510), and the expression of GFAP was assessed to confirm astrocyte purity. For the acquisition of images for GFAP (FITC) and DAPI, the following parameters were used: Excitation wavelengths: GFAP (FITC): 488 nm, DAPI: 358 nm Emission wavelengths: GFAP (FITC): 495–530 nm, DAPI: 461–490 nm; Laser Power: 3–5%; Pixel Size: 0.2 µm; Scanning Speed: 7.2 µs/pixel.

Western blotting

Astrocytes were lysed in a buffer containing 40 mM Tris (pH 7.4), 120 mM NaCl, 0.5% Triton X-100, 0.3% SDS, and protease inhibitors (Sigma-Aldrich). Total protein concentration was determined using the BCA assay. Equal amounts of protein (40 μg) were mixed with 2X loading buffer and subjected to electrophoresis on a 10% SDS-PAGE gel at 120 V for 90 min at room temperature. The proteins were then transferred to a nitrocellulose membrane using a semi-dry transfer system.

The membrane was blocked for 1 h at room temperature with 3% BSA in TBST, followed by overnight incubation at 4 °C with primary antibodies: mouse anti-IκBα (1:1000, Pierce), mouse anti-JNK (1:1000, Pierce), and mouse anti-β-actin (1:5000, Pierce). After washing in TBST, the membrane was incubated with HRP-conjugated secondary antibodies (Sigma-Aldrich) for 1 h. Specific protein bands were visualized using the ECL detection system (Invitrogen), and images were captured on X-ray film, scanned, and quantified using ImageJ software. β-actin was used as an internal control for normalization.

Enzyme-linked immunosorbent assay (ELISA)

Levels of secreted neurotrophins, including NGF and BDNF, were quantified in culture supernatants using high-sensitivity ELISA kits (Thermo Fisher) according to the manufacturer’s instructions. Standards and samples were diluted two-fold with assay buffer, and measurements were conducted in duplicate for each sample. The concentrations of NGF and BDNF were determined by comparing sample absorbance at 450 nm to standard curves generated from known concentrations of recombinant neurotrophins. The assays were performed in triplicate (n = 3), with two technical replicates per sample per assay.

Statistical analysis

Data are expressed as mean ± standard error of the mean (SEM). Differences between treatment groups were assessed using one-way analysis of variance (ANOVA) followed by Bonferroni’s post-hoc test for pairwise comparisons. Statistical significance was considered for p-values less than 0.05 (denoted as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001). All statistical analyses were conducted using Prism 6 software (GraphPad Software, Inc.).

Results

Isolation and characterization of rat cortical astrocytes

Primary cortical astrocytes were isolated from mixed glial cultures at Day in vitro 10 (DIV 10), as outlined in the Materials and Methods section (Chen et al. 2007; Langhnoja et al. 2018a; Lipi et al. 2018). Astrocytes were enriched by shaking the flasks, followed by immunocytochemical (ICC) analysis to assess purity. Microscopic examination of the cultures revealed that > 95% of the cells were positive for Glial Fibrillary Acidic Protein (GFAP), a specific marker for astrocytes, indicating successful astrocyte enrichment (Fig. 1). Additionally, DAPI staining was used to assess cell viability, confirming that the cultures contained predominantly viable cells. These results collectively suggest that the mixed glial cultures were effectively purified to > 95% astrocytes, suitable for subsequent experimental use.

Fig. 1.

Fig. 1

Characterization of Rat Neonatal Astrocytes Primary cultures of astrocytes were derived from the cortices of neonatal rats (0–2 days old) by dissociating the tissue and selectively isolating astrocytes, which constitute more than 95% of the cell population after the removal of oligodendrocytes and microglial cells. Astrocyte purity was confirmed by immunofluorescent staining using a Rabbit Anti-GFAP monoclonal antibody (green), which specifically labels astrocytes, visualized with an anti-rabbit FITC-conjugated secondary antibody. Nuclei were counterstained with DAPI to allow for clear identification and localization. Imaging was performed using a confocal microscope at 63 × magnification. Scale bar = 20 μm

TNF-α upregulates neurotrophin and neurotrophin receptor expression in cortical astrocytes

To investigate the effect of TNF-α on neurotrophin expression, cortical astrocytes were treated with increasing concentrations of TNF-α (1 ng/ml, 10 ng/ml, and 50 ng/ml) for 24 h (Ding et al. 2014; Bałkowiec-Iskra and Balkowiec 2011). The expression of Nerve Growth Factor (NGF) and Brain-Derived Neurotrophic Factor (BDNF), as well as their respective receptors TrkA and TrkB, was analyzed by quantitative real-time PCR. The results demonstrated a dose-dependent increase in the mRNA levels of both NGF and BDNF following TNF-α treatment (Fig. 2). Furthermore, the transcript levels of the corresponding neurotrophin receptors, TrkA and TrkB, were also significantly elevated in all TNF-α treatment groups. These findings suggest that TNF-α induces a neurotrophin-modulatory effect, enhancing the expression of both neurotrophins and their receptors. This upregulation may suggesting that TNF-α, while primarily associated with neuroinflammation, indirectly promotes neuroprotection by modulating the expression of neurotrophins, which in turn support neuronal survival during neurodegenerative disorders.

Fig. 2.

Fig. 2

TNF-α Mediates Upregulation of NGF, BDNF, and Their Receptors (TrkA and TrkB) Real-time PCR analysis was conducted to quantify changes in the transcript levels of the neurotrophins NGF and BDNF, as well as their corresponding receptors, TrkA and TrkB, following treatment with TNF-α in cultured astrocytes. The data presented are the mean ± SEM of three independent biological replicates (n = 3). Statistical significance was determined by One-Way ANOVA, followed by Bonferroni’s post-hoc test. Asterisks denote the following levels of significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

TNF-α induces secretion of NGF and BDNF in cortical astrocytes

To assess whether TNF-α treatment influences the secretion of neurotrophins, astrocytes were exposed to the same doses of TNF-α (1 ng/ml, 10 ng/ml, and 50 ng/ml) for 24 h. Following treatment, the levels of NGF and BDNF in the conditioned media were quantified using ELISA. The data revealed a significant increase in the secreted levels of both NGF and BDNF in the TNF-α-treated groups compared to control (Fig. 3). Notably, the 10 ng/ml TNF-α dose resulted in a pronounced increase in NGF secretion, while the 50 ng/ml TNF-α dose was most effective in stimulating BDNF secretion. These results further support the hypothesis that TNF-α has a neuroprotective role by promoting the secretion of neurotrophins, which may contribute to cellular survival and neuronal protection in inflammatory conditions.

Fig. 3.

Fig. 3

Secreted NGF and BDNF Protein Levels in Astrocyte Conditioned Media The levels of NGF and BDNF secreted into the conditioned media of TNF-α-treated astrocytes were quantified using an enzyme-linked immunosorbent assay (ELISA). The experiments were performed in triplicate (n = 3), with samples assayed in three independent ELISA runs, each containing two technical replicates. The results are expressed as mean ± SEM. Statistical analysis was performed using One-Way ANOVA, followed by Bonferroni’s post-test to assess significant differences. Asterisks represent the following levels of significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

TNF-α stimulates NGF and BDNF expression through the NF-κB signaling pathway

To determine the underlying signaling mechanisms involved in TNF-α-induced neurotrophin regulation, we investigated the activation of key signaling pathways. Previous studies have implicated NF-κB, JNK, and the caspase pathway as potential mediators of TNF-α signaling (You et al. 2021; Wang et al. 2014; Park and B.W., 2010). However, the caspase pathway is primarily activated during apoptosis, and therefore was not considered in this analysis. We focused on the NF-κB and JNK pathways by assessing the expression levels of IκBα (an inhibitor of NF-κB) and phosphorylated JNK (p-JNK) in astrocytes treated with TNF-α. Western blot analysis revealed a significant downregulation of IκBα expression in astrocytes treated with 10 ng/ml and 50 ng/ml TNF-α (Fig. 4a). This decrease in IκBα indicates the activation of the NF-κB pathway, as IκBα degradation is a hallmark of NF-κB signaling. In contrast, there was no significant change in p-JNK levels in response to TNF-α treatment, suggesting that the JNK pathway was not significantly involved in TNF-α-mediated neurotrophin modulation (Fig. 4b). These findings provide strong evidence that TNF-α promotes neurotrophin secretion and expression primarily through the activation of the NF-κB signaling pathway, rather than the JNK pathway, suggesting a neuroprotective mechanism of action for TNF-α in cortical astrocytes.

Fig. 4.

Fig. 4

Signaling Mechanisms of TNF-α in the Upregulation of Neurotrophins Western blot analysis was performed to investigate the signaling mechanisms involved in the TNF-α-induced upregulation of neurotrophins in astrocytes. Cultured astrocytes were treated with TNF-α for 24 h, and protein levels of IκB (Fig. 4a) and p-JNK (Fig. 4b) were assessed. Protein levels were normalized to β-actin and expressed relative to untreated control samples. The data are presented as mean ± SEM of three independent experiments (n = 3). Statistical significance was determined using One-Way ANOVA, followed by Bonferroni’s post-test. Asterisks denote significance at the following levels: ***P < 0.001, **P < 0.01, *P < 0.05

Discussion

Tumor necrosis factor alpha (TNF-α) has traditionally been regarded as a key mediator of neurotoxicity, contributing to neurodegenerative processes such as demyelination and neuronal degeneration through the induction of other pro-inflammatory cytokines (Selmaj et al. 1991; Clark 2007; Olmos and Lladó 2014). In astrocytes, TNF-α has predominantly been thought to promote neuroinflammation and astrogliosis, both of which are associated with neurotoxic effects. However, recent research has revealed that TNF-α can also exhibit neuroprotective properties under certain conditions. For instance, when administered at low to moderate doses, TNF-α has been shown to precondition neurons, protecting them from metabolic excitotoxicity and enhancing cellular resilience (Cheng et al. 1994; Marchetti et al. 2004; Carlson et al. 1999; Figiel 2008). Furthermore, the activation of CREB-binding protein (CBP) by TNF-α in neurons has gained attention for its potential therapeutic implications in neurodegenerative diseases (Saha et al. 2009).

Astrocytes, the most abundant glial cells in the central nervous system (CNS), are central to numerous processes that regulate neuronal function and maintain CNS homeostasis. These cells play a critical role in initiating immune and inflammatory responses in the brain, and at sites of neuroinflammation, astrocytes release a variety of cytokines and chemokines that can have both pro-inflammatory (neurotoxic) and anti-inflammatory (neuroprotective) effects depending on the context (Sofroniew and Vinters 2010; Bylicky et al. 2018). Recent studies have also highlighted that TNF-α can stimulate astrocyte proliferation in vitro (Selmaj, et al. 1990), further implicating TNF-α in the regulation of glial cell dynamics. Beyond their role in inflammation, astrocytes are key producers of several growth factors, including platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), ciliary neurotrophic factor (CNTF), and extracellular matrix (ECM) proteins, which are essential for neuronal survival, oligodendrocyte function, and the repair processes following injury (Raff et al. 1988; Delgado-Rivera et al. 2009) Among these factors, neurotrophins such as nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) are of particular importance in regulating neuronal survival, axonal growth, and myelination (Xiao et al. 2010; Saha et al. 2006; Kuno et al. 2006; Yin et al. 2012). Both the neurotrophins, NGF and BDNF, are the most widely distributed and engaged in many of the essential functions of the brain (Kowiański et al. 2018; Langhnoja et al. 2018b) by binding with their specific receptors- TrkA for NGF and TrkB for BDNF-and further activate the downstream signaling which are responsible for many crucial tasks such as neural protection, neuron outgrowth, and myelination.We sought to understand the effect of TNF-α on these two major neurotrophins- NGF and BDNF.

In the present study, we sought to investigate the effects of TNF-α on the expression of NGF and BDNF, two key neurotrophins that are involved in the protection and repair of the nervous system. Our results demonstrate that TNF-α significantly upregulates the mRNA expression of both BDNF and NGF, as well as their respective receptors, TrkB and TrkA, in a dose-dependent manner. Furthermore, TNF-α stimulation also leads to increased secretion of both neurotrophins into the extracellular medium. These findings are consistent with those reported by Saha et al. (Saha et al. 2006), but extend the current knowledge by including the full-length BDNF isoform, rather than just exon IV, and by investigating the effects of TNF-α on both neurotrophins and their receptors. Interestingly, TNF-α also increased the gene expression of NGF and its receptor, TrkA, again in a dose-dependent manner. Although previous studies have demonstrated that TNF-α can stimulate NGF production in astrocytes (Kuno et al. 2006) our work is the first to report on the impact of TNF-α on the neurotrophin receptors and the underlying signaling mechanisms, particularly in the case of NGF.

We further investigated the signaling pathways involved in TNF-α-mediated neuroprotection and found that the NF-κB pathway plays a central role. Upon TNF-α stimulation, the IκB-NF-κB pathway was activated through the canonical signaling cascade, involving the IKK complex (Li and Verma 2002). We observed a significant reduction in IκB levels at both 10 ng/mL and 50 ng/mL TNF-α concentrations, indicating the active phosphorylation of IκB and its dissociation from NF-κB dimers, which subsequently translocate to the nucleus to initiate the transcription of neuroprotective genes. In contrast, TNF-α had no significant effect on the p-JNK pathway, suggesting that the IκB-NF-κB axis is the primary mediator of TNF-α’s neuroprotective effects in astrocytes. This is consistent with previous studies that have documented the involvement of NF-κB in promoting neuroprotection, particularly in hippocampal neurons (Mattson et al. 1997; Tamatani et al. 1999). NF-κB, as a transcription factor, is known to regulate the expression of various neurotrophic factors and genes involved in neuronal development and survival (Tanaka et al. 2000) additionally, the elevated expression of TNFR1 in astrocytes correlates with increased production of BDNF, further supporting the role of TNFR1 in mediating TNF-α’s neuroprotective actions during neurotoxic injury (Figiel and Dzwonek 2007).

In summary, our findings provide compelling evidence that TNF-α, in contrast to its traditional role as a pro-inflammatory cytokine, can exert a neuroprotective effect in astrocytes. By upregulating the expression and secretion of key neurotrophins, including BDNF and NGF, TNF-α may enhance neuronal survival, facilitate axonal outgrowth, and support myelination under conditions of neuroinflammation. This study underscores the complex, dual nature of TNF-α in the CNS, where it can both promote inflammation and support tissue repair. Given its ability to stimulate neurotrophin production, TNF-α holds promise as a therapeutic target for modulating neuroinflammatory responses in neurodegenerative diseases and other brain disorders, where maintaining a balance between neuroinflammation and neuroprotection is critical for long-term neuronal health.

Acknowledgements

The authors are highly thankful to Department of Biotechnology for funding support (BT/PR5027/MED/30/779/2012). We also acknowledge Prof. Sarita Gupta, Coordinator of DBT-ILSPARE, MSU Baroda, Vadodara and DBT-ILSPARE Programme, for confocal microscopy, and Real-Time PCR facility at Dr. Vikram Sarabhai Science Block, Faculty of Science, MSU Baroda, Vadodara. We also thankful to the Animal House Facility, Department of Biochemistry, MSU Baroda and Sun Pharma Pvt. Ltd, Vadodara.

Author Contribution

Jaldeep Langhnoja and Prakash Pillai conceptualized the experiments; Jaldeep Langhnoja and Lipi Buch wrote the main manuscript; Jaldeep Langhnoja and Lipi performed experiments; Jaldeep Langhnoja prepared figures, All the authors reviewed and approved the final draft of the manuscript.

Funding

This work was funded by Department of Biotechnology, Ministry of Science and Technology, India, BT/PR5027/MED/30/779/2012

Data Availability

Data available on request from the authors.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

All animal protocols were in compliance and approved by the Institutional Animal Ethical Committee, The Maharaja Sayajirao University of Baroda; ZD/02/2015, 2016, 2017).

Footnotes

The original online version of this article was revised: In the original version of this article, the given and family names of the authors were incorrectly structured. The correct names should be ‘Jaldeep Langhnoja, Lipi Buch and Prakash Pillai’ instead of ‘Langhnoja Jaldeep, Buch Lipi and Pillai Prakash’.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

3/27/2025

The original online version of this article was revised: In the original version of this article, the given and family names of the authors were incorrectly structured. The correct names should be ‘Jaldeep Langhnoja, Lipi Buch and Prakash Pillai’ instead of ‘Langhnoja Jaldeep, Buch Lipi and Pillai Prakash’.

Change history

4/3/2025

A Correction to this paper has been published: 10.1007/s10616-025-00743-5

References

  1. Alhadidi, Q.M., Astrocytes in functional recovery following central nervous system injuries. 2023. [DOI] [PMC free article] [PubMed]
  2. Allan, S., Rothwell, N, Cytokines and acute neurodegeneration. 2001. [DOI] [PubMed]
  3. Allen SJ et al (2013) GDNF, NGF and BDNF as therapeutic options for neurodegeneration. Pharmacol Ther 138:155–175 [DOI] [PubMed] [Google Scholar]
  4. Bałkowiec-Iskra E, V.-S.A., Balkowiec A, Tumor necrosis factor-α increases brain-derived neurotrophic factor expression in trigeminal ganglion neurons in an activity-dependent manner. 2011. [DOI] [PMC free article] [PubMed]
  5. Bylicky, M.A., G.P. Mueller, and R.M. Day, Mechanisms of endogenous neuroprotective effects of astrocytes in brain injury. Oxidative medicine and cellular longevity, 2018. 2018. [DOI] [PMC free article] [PubMed]
  6. Carlson NG et al (1999) Inflammatory cytokines IL-1α, IL-1β, IL-6, and TNF-α impart neuroprotection to an excitotoxin through distinct pathways. J Immunol 163:3963–3968 [PubMed] [Google Scholar]
  7. Chan JR et al (2004) NGF controls axonal receptivity to myelination by Schwann cells or oligodendrocytes. Neuron 43:183–191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen Y et al (2007) Isolation and culture of rat and mouse oligodendrocyte precursor cells. Nat Protoc 2:1044 [DOI] [PubMed] [Google Scholar]
  9. Cheng B, Christakos S, Mattson MP (1994) Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance of calcium homeostasis. Neuron 12:139–153 [DOI] [PubMed] [Google Scholar]
  10. Choi SJ et al (2005) Differential expression, shedding, cytokine regulation and function of TNFR1 and TNFR2 in human fetal astrocytes. Yonsei Med J 46:818–826 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Clark IA (2007) How TNF was recognized as a key mechanism of disease. Cytokine Growth Factor Rev 18:335–343 [DOI] [PubMed] [Google Scholar]
  12. Delgado-Rivera R et al (2009) Increased FGF-2 secretion and ability to support neurite outgrowth by astrocytes cultured on polyamide nanofibrillar matrices. Matrix Biol 28:137–147 [DOI] [PubMed] [Google Scholar]
  13. Ding Y, Z.K., Liu S, Zhang Q, Ma C, Bruce IC, Zhang X, Tumor necrosis factor-α promotes the expression of excitatory amino-acid transporter 2 in astrocytes: Optimal concentration and incubation time. 2014. [DOI] [PMC free article] [PubMed]
  14. Douglas-Escobar M et al (2012) Neurotrophin-induced migration and neuronal differentiation of multipotent astrocytic stem cells in vitro. PLoS ONE 7:e51706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Faustman D, Davis M (2010) TNF receptor 2 pathway: drug target for autoimmune diseases. Nat Rev Drug Discovery 9:482 [DOI] [PubMed] [Google Scholar]
  16. Figiel I (2008) Pro-inflammatory cytokine TNF-alpha as a neuroprotective agent in the brain. Acta Neurobiol Exp (Wars) 68:526–534 [DOI] [PubMed] [Google Scholar]
  17. Figiel I, Dzwonek K (2007) TNFα and TNF receptor 1 expression in the mixed neuronal–glial cultures of hippocampal dentate gyrus exposed to glutamate or trimethyltin. Brain Res 1131:17–28 [DOI] [PubMed] [Google Scholar]
  18. Fuchikami M et al (2009) Single immobilization stress differentially alters the expression profile of transcripts of the brain-derived neurotrophic factor (BDNF) gene and histone acetylation at its promoters in the rat hippocampus. Int J Neuropsychopharmacol 12:73–82 [DOI] [PubMed] [Google Scholar]
  19. Hannan JL et al (2015) Temporal changes in neurotrophic factors and neurite outgrowth in the major pelvic ganglion following cavernous nerve injury. J Neurosci Res 93:954–963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hohmann H-P et al (1989) Two different cell types have different major receptors for human tumor necrosis factor (TNF alpha). J Biol Chem 264:14927–14934 [PubMed] [Google Scholar]
  21. Jaldeep Langhnoja, L.B., Prakash Pillai, Potential role of NGF, BDNF, and their receptors in oligodendrocytes differentiation from neural stem cell: An in vitro study. 2021. [DOI] [PubMed]
  22. Jana M, Pahan K (2017) Astrocytes, Oligodendrocytes and Schwann Cells. Neuroimmune Pharmacology. Springer, pp 117–140 [Google Scholar]
  23. Kondo Y et al (2010) Expression and role of the BDNF receptor-TrkB in rat adrenal gland under acute immobilization stress. Acta Histochem Cytochem 43:139–147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kowiański P et al (2018) BDNF: a key factor with multipotent impact on brain signaling and synaptic plasticity. Cell Mol Neurobiol 38:579–593 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kuno R et al (2006) The role of TNF-alpha and its receptors in the production of NGF and GDNF by astrocytes. Brain Res 1116:12–18 [DOI] [PubMed] [Google Scholar]
  26. Kuzawińska O et al (2014) Gender differences in the neurochemical response of trigeminal ganglion neurons to peripheral inflammation in mice. Acta Neurobiol Exp 74:227–232 [DOI] [PubMed] [Google Scholar]
  27. Labelle C, Leclerc N (2000) Exogenous BDNF, NT-3 and NT-4 differentially regulate neurite outgrowth in cultured hippocampal neurons. Dev Brain Res 123:1–11 [DOI] [PubMed] [Google Scholar]
  28. Langhnoja JM, Buch LK, Pillai PP (2018a) 17β-estradiol modulates NGF and BDNF expression through ERβ mediated ERK signaling in cortical astrocytes. Biologia 73:907–915 [Google Scholar]
  29. Langhnoja, J.M.B., Lipi K. ; Pillai, Prakash P., 17b-estradiol modualtes NGF ad=nd BDNF expression through ERb mediated ERK signaling in cortical astrocytes. 2018.
  30. Li Q, Verma IM (2002) NF-κB regulation in the immune system. Nat Rev Immunol 2:725 [DOI] [PubMed] [Google Scholar]
  31. Lipi B, Jaldeep L, Prakash P (2018) Role of astrocytic MeCP2 in regulation of CNS myelination by affecting oligodendrocyte and neuronal physiology and axo–glial interactions. Exp Brain Res 236:3015–3027 [DOI] [PubMed] [Google Scholar]
  32. Lipi Buch, L.J., Pillai Prakash Role of astrocytic MeCP2 in regulation of CNS myelination by affecting oligodendrocyte and neuronal physiology and axo-glial interactions. 2018. [DOI] [PubMed]
  33. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods, 2001. 25(4): p. 402–408. [DOI] [PubMed]
  34. Marchetti L et al (2004) Tumor Necrosis Factor (TNF)-mediated Neuroprotection against Glutamate-induced Excitotoxicity Is Enhanced by N-Methyl-D-aspartate Receptor Activation Essential role of a tnf receptor 2-mediated phosphatidylinositol 3-kinase-dependent nf-κb pathway. J Biol Chem 279:32869–32881 [DOI] [PubMed] [Google Scholar]
  35. Mattson MP et al (1997) Activation of NF-κB protects hippocampal neurons against oxidative stress-induced apoptosis: Evidence for induction of manganese superoxide dismutase and suppression of peroxynitrite production and protein tyrosine nitration. J Neurosci Res 49:681–697 [DOI] [PubMed] [Google Scholar]
  36. McGregor, C.E., The Role of BDNF in Peripheral Nerve Regeneration: Activity-Dependent Treatments and Val66Met. 2019. [DOI] [PMC free article] [PubMed]
  37. Murer M, Yan Q, Raisman-Vozari R (2001) Brain-derived neurotrophic factor in the control human brain, and in Alzheimer’s disease and Parkinson’s disease. Prog Neurobiol 63:71–124 [DOI] [PubMed] [Google Scholar]
  38. Olmos, G. and J. Lladó, Tumor necrosis factor alpha: a link between neuroinflammation and excitotoxicity. Mediators of inflammation, 2014. 2014. [DOI] [PMC free article] [PubMed]
  39. Ouaamari, Y.E., Neurotrophic Factors as Regenerative Therapy for Neurodegenerative Diseases: Current Status, Challenges and Future Perspectives. 2023. [DOI] [PMC free article] [PubMed]
  40. Park KM, B.W., Tumor necrosis factor-alpha mediated signaling in neuronal homeostasis and dysfunction. 2010. [DOI] [PMC free article] [PubMed]
  41. Park H, Poo M-M (2013) Neurotrophin regulation of neural circuit development and function. Nat Rev Neurosci 14:7 [DOI] [PubMed] [Google Scholar]
  42. Raff MC et al (1988) Platelet-derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333:6173–562 [DOI] [PubMed] [Google Scholar]
  43. Saha RN, Liu X, Pahan K (2006) Up-regulation of BDNF in astrocytes by TNF-α: a case for the neuroprotective role of cytokine. J Neuroimmune Pharmacol 1(3):212–222 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Saha RN et al (2009) TNF-α preconditioning protects neurons via neuron-specific up-regulation of CREB-binding protein. J Immunol 183:2068–2078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Salvo, E., Tu, N.H., Scheff, N.N, TNFα promotes oral cancer growth, pain, and Schwann cell activation. 2021. [DOI] [PMC free article] [PubMed]
  46. Sawada M et al (1989) Production of tumor necrosis factor-alpha by microglia and astrocytes in culture. Brain Res 491:394–397 [DOI] [PubMed] [Google Scholar]
  47. Schall TJ et al (1990) Molecular cloning and expression of a receptor for human tumor necrosis factor. Cell 61:361–370 [DOI] [PubMed] [Google Scholar]
  48. Selmaj K, Raine C, Cross A (1991) Anti—tumor necrosis factor therapy abrogates autoimmune demyelination. Annals of Neurology: Official Journal of the American Neurological Association and the Child Neurology Society 30(5):694–700 [DOI] [PubMed] [Google Scholar]
  49. Selmaj, K., et al., Proliferation of astrocytes in vitro in response to cytokines. A primary role for tumor necrosis factor. The Journal of Immunology, 1990. 144(1): p. 129–135. [PubMed]
  50. Shen H-M, Pervaiz S (2006) TNF receptor superfamily-induced cell death: redox-dependent execution. FASEB J 20(10):1589–1598 [DOI] [PubMed] [Google Scholar]
  51. Smith CA et al (1990) A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248:1019–1023 [DOI] [PubMed] [Google Scholar]
  52. Sofroniew MV, Vinters HV (2010) Astrocytes: biology and pathology. Acta Neuropathol 119:7–35 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Song C et al (2019) Astrocyte-conditioned medium protects prefrontal cortical neurons from glutamate-induced cell death by inhibiting TNF-α expression. NeuroImmunoModulation 26:33–42 [DOI] [PubMed] [Google Scholar]
  54. Squillacioti, C., et al., Effects of castration on the expression of the NGF and TrkA in the vas deferens and accessory male genital glands of the rat. European journal of histochemistry: EJH, 2009. 53(4). [DOI] [PMC free article] [PubMed]
  55. Swiss VA et al (2011) Identification of a gene regulatory network necessary for the initiation of oligodendrocyte differentiation. PLoS ONE 6:e18088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Takei Y, L.R., Interpreting crosstalk between TNF-alpha and NGF: potential implications for disease. 2008. [DOI] [PubMed]
  57. Takei Y, Laskey R (2008) Interpreting crosstalk between TNF-α and NGF: potential implications for disease. Trends Mol Med 14:381–388 [DOI] [PubMed] [Google Scholar]
  58. Tamatani M et al (1999) Tumor necrosis factor induces Bcl-2 and Bcl-x expression through NFκB activation in primary hippocampal neurons. J Biol Chem 274:8531–8538 [DOI] [PubMed] [Google Scholar]
  59. Tanaka, M., S. Ito, and K. Kiuchi, Novel alternative promoters of mouse glial cell line-derived neurotrophic factor gene. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression, 2000. 1494(1–2): p. 63–74. [DOI] [PubMed]
  60. Tartaglia LA, Goeddel DV (1992) Two TNF receptors. Immunol Today 13:151–153 [DOI] [PubMed] [Google Scholar]
  61. Thomson, A.W. and M.T. Lotze, The Cytokine Handbook, Two-Volume Set. 2003: Elsevier.
  62. Tsiperson V et al (2015) Brain-derived neurotrophic factor deficiency restricts proliferation of oligodendrocyte progenitors following cuprizone-induced demyelination. ASN Neuro 7:1759091414566878 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Vetter I, Pujic Z, Goodhill GJ (2010) The response of dorsal root ganglion axons to nerve growth factor gradients depends on spinal level. J Neurotrauma 27:1379–1386 [DOI] [PubMed] [Google Scholar]
  64. Wajant H, Pfizenmaier K, Scheurich P (2003) Tumor necrosis factor signaling. Cell Death Differ 10:45 [DOI] [PubMed] [Google Scholar]
  65. Wallach D et al (1999) Tumor necrosis factor receptor and Fas signaling mechanisms. Annu Rev Immunol 17:331–367 [DOI] [PubMed] [Google Scholar]
  66. Wang, L., Chang, YC., Chen, SJ. , TNFR1-JNK signaling is the shared pathway of neuroinflammation and neurovascular damage after LPS-sensitized hypoxic-ischemic injury in the immature brain. 2014. [DOI] [PMC free article] [PubMed]
  67. Xiao J et al (2010) Brain-derived neurotrophic factor promotes central nervous system myelination via a direct effect upon oligodendrocytes. Neurosignals 18:186–202 [DOI] [PubMed] [Google Scholar]
  68. Yin L-L et al (2012) Epimedium flavonoids ameliorate experimental autoimmune encephalomyelitis in rats by modulating neuroinflammatory and neurotrophic responses. Neuropharmacology 63:851–862 [DOI] [PubMed] [Google Scholar]
  69. You K, G.H., Yuan Z, Xu X, Tumor Necrosis Factor Alpha Signaling and Organogenesis. 2021. [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data available on request from the authors.


Articles from Cytotechnology are provided here courtesy of Springer Science+Business Media B.V.

RESOURCES