Abstract
Background
We standardized two recombinase polymerase amplification (RPA) assays coupled with lateral flow (LF) strips for the detection of Leishmania braziliensis and Leishmania infantum kinetoplast DNA (kDNA).
Methods
The RPA-LF assays were tested at different temperatures and reaction times, using DNA from cultured L. braziliensis and L. infantum. The L. infantum RPA-LF was also tested using clinical samples (bone marrow and skin) from infected and uninfected dogs.
Results
The detection limits (analytical sensitivity) of the assays were 0.04 pg/μl and 0.04 ng/μl for L. braziliensis and L. infantum kDNA, respectively. Using clinical samples, the L. infantum RPA-LF successfully detected the parasite kDNA in bone marrow (21/30; 70.0%) and skin samples (23/30, 76.6%) from naturally infected dogs. We found an almost perfect agreement (kappa = 0.807) between RPA-LF for L. infantum and our reference quantitative real-time polymerase chain reaction (qPCR), considering clinical samples with a quantification cycle (Cq) < 30, whereas the agreement with samples with a Cq > 30 (lower parasite loads) was moderate (kappa = 0.440).
Conclusions
The RPA-LF assays developed here may be promising diagnostic tools for point-of-care diagnosis of L. infantum and L. braziliensis infection in dogs, particularly in remote rural areas lacking laboratory infrastructure.
Graphical Abstract
Keywords: Isothermal amplification, Leishmaniasis, Molecular diagnosis, Point-of-care, Recombinase
Background
Canine leishmaniasis is a parasitic disease caused by various species of protozoa belonging to the genus Leishmania [1, 2]. In the American continent, Leishmania braziliensis and Leishmania infantum are among the most common and widespread agents of canine leishmaniasis [3]. In areas where different Leishmania spp. co-exist, co-infections may occur and pose an additional challenge for the etiological diagnosis of leishmaniasis in dogs [4–6].
From a clinical perspective, the disease produced by various Leishmania spp. in dogs may vary widely [3, 7], with localized ulcers being the main clinical hallmark of the disease caused by L. braziliensis [8, 9], sometimes associated to secondary mucocutaneous lesions [10], just as in humans [11, 12]. However, L. infantum may also cause a wide range of clinical signs and clinicopathological abnormalities, varying from mild skin lesions to systemic signs, being potentially life-threatening [3, 7]. Despite the apparently distinct clinical expression of the diseases caused by L. braziliensis and L. infantum, the diagnosis of canine leishmaniasis in areas where these agents co-occur remains challenging. Indeed, dogs infected by L. braziliensis are often from remote rural areas, where the access to veterinary healthcare is limited and malnutrition associated to other conditions is common [13, 14]. Consequently, L. braziliensis-infected dogs may present clinical signs and clinicopathological abnormalities (e.g., weight loss, anemia, and thrombocytopenia) [8] that are not primarily caused by L. braziliensis but may contribute to the general clinical picture, thus further confounding the diagnosis.
To complicate matters, serological assays are widely used as diagnostic tools, by both veterinary practitioners and public health workers. Although these assays may present high sensitivity and specificity, they are prone to cross-reactivity, and the consequences may be severe [5, 15–19]. For instance, a study conducted in Rio de Janeiro, Brazil, evaluated whether dogs euthanized based on serological results were, in fact, infected by L. infantum [5]. This study proved that many culled dogs were infected by L. braziliensis or even Trypanosoma caninum (unknown pathogenicity), highlighting that serological cross-reactivity resulted in the unnecessary death of dogs that were, in fact, not infected by L. infantum. This exemplifies the importance of using molecular tools that can properly identify the species of Leishmania, before deciding the fate of an infected dog.
The search for point-of-care molecular tests has intensified in recent years, with promising results [20, 21]. One of the alternative methods that has been explored in the past for the point-of-care detection of Leishmania DNA is recombinase polymerase amplification (RPA) [20, 22, 23]. Originally developed in 2006, RPA is an isothermal amplification using proteins involved in cellular DNA synthesis, recombination, and repair [24, 25]. RPA does not require an initial denaturation step to generate single-stranded DNA from target double-stranded DNA, in contrast to polymerase chain reaction (PCR)-based molecular techniques, which highlights its suitability for field use [26, 27]. Various studies have investigated the use of RPA-based assays for the detection of Leishmania spp., with encouraging results in terms of sensitivity and specificity [20, 22, 23].
In this study, we standardized two new RPA assays coupled with lateral flow (LF) reading for detecting L. braziliensis and L. infantum in skin and bone marrow samples from naturally infected dogs in Brazil.
Methods
Strains and clinical samples
Reference strains of cultured L. braziliensis (MHOM/BR/1975/M2903) and L. infantum (MHOM/BR/1974/PP75) were used to obtain standard DNA. Clinical samples (n = 70) from dogs (34 skin and 36 bone marrow samples) were also used to validate the standardized RPA-LF assays. These samples were from a previous study conducted in Andradina, São Paulo, and were originally categorized as negative (n = 10) and positive (n = 60) based on results obtained by quantitative real-time PCR (qPCR) (unpublished data).
DNA extraction
Extraction of genomic DNA from Leishmania spp. strains and clinical samples from dogs were performed using the DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions. The quantity and purity (absorbance ratios at 260/280 nm and 260/230 nm, respectively) of the DNA extracted from the strains were evaluated using a spectrophotometer (NanoDrop Lite, Thermo Scientific, Waltham, MA, USA). The extracted genomic DNA was frozen at –20 °C until use.
qPCR and conventional PCR (cPCR)
The fast qPCR assay originally used to categorize samples as positive or negative targeted a 120-base-pair (bp) fragment of the kDNA minicircle of L. infantum, employing the primers LEISH-1 (5′-AACTTTTCTGGTCCTCCGGGTAG-3′) and LEISH-2 (5′-ACCCCCAGTTTCCCGCC-3′) and the TaqMan® probe FAM-5′-AAAAATGGGTGCAGAAAT-3′ non-fluorescent quencher minor groove binder (MGB) [28]. The reagent concentrations and thermal cycling conditions were as described elsewhere [29]. All samples were tested in duplicate.
A cPCR assay, employing the same primers as for qPCR, was used for comparison purposes, with the following thermal cycling conditions: 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s; with a final extension at 72 °C for 5 min. The cPCR was conducted in a 25 µl final reaction mixture containing 12.5 μl of GoTaq® Colorless Master Mix (Promega Corporation, Madison, WI, USA), 2.25 μl of each primer (900 nM final concentration), 6.0 μl of nuclease free water, and 2.0 µl of DNA template.
Primers and probes used in the RPA assays
Primers and probes used in the RPA for detecting L. braziliensis and L. infantum kinetoplast DNA (kDNA) were those described by Saldarriaga et al. [23] and Castellanos-Gonzalez et al. [22], respectively. These primers target a 120-bp and a 182-bp region of the kDNA minicircle of L. braziliensis and L. infantum, respectively. To enable detection of amplicons using LF strips, primers and probes were modified according to recommendations contained in the TwistAmp® Assay Design Manual (TwistDx, Cambridge, UK). The probe for each target was differentially labeled at the 5′ end with carboxyfluorescein (FAM) and digoxigenin (DIG) for detection of L. braziliensis and L. infantum, respectively. Additionally, an internal abasic nucleotide analogue (dSpacer) and a polymerase extension blocking group at the 3′ end (spacer C3) were added to the probes. The reverse primers for each target were also chemically modified with a biotin at the 5′ end. Primers and probes were synthesized by LGC Biosearch Technologies (Middlesex, UK). The sequences of the primers and probes used herein are shown in Table 1.
Table 1.
Primers and probes used in the recombinase polymerase amplification (RPA) assays
| Primer/probe | Sequence (5′ → 3′) | Amplicon size | Reference |
|---|---|---|---|
| LB-F | GATGAAAATGTACTCCCCGACATGCCTCTG | 120 bp | [23] |
| LB-R | Biotin-CTAATTGTGCACGGGGAGGCCAAAAATAGCGA | ||
| LB-P | FAM-GTAGGGGNGTTCTGCGAAAACCGAAAAATG-dSpacer-CATACAGAAACCCCG-Spacer C3 | ||
| LI-F | CCATAGCGCTTTAGAATAGTTCGACTCCGA | 182 bp | [22] |
| LI-R | Biotin-ATCGGTATAGATATTACTACTACACACAGC | ||
| LI-P | T(DIG)-ATAACTGACATTACTCGTACACTATAA-dSpacer-TATTATGTTTAATATAT-Spacer C3 |
LB-F, L. braziliensis forward primer; LB-R, L. braziliensis reverse primer; LB-P, L. braziliensis probe; LI-F, L. infantum forward primer; LI-R, L. infantum reverse primer; LI-P, L. infantum probe
Analytical sensitivity and specificity
Standard curves were prepared with five serial dilutions (5 ng/µl, 0.5 ng/µl, 50 pg/µl, 5 pg/µl, and 0.5 pg/µl) of DNA extracted from L. braziliensis and L. infantum reference strains. Standard curves were used to evaluate the analytical sensitivity (i.e., limit of detection) of the RPA assays. In turn, the analytical specificity of the RPA assays was evaluated using cross experiments, that is, adding L. braziliensis DNA in the RPA targeting L. infantum and vice versa. All experiments included a no-template control (i.e., all the reagents, except the DNA template).
RPA reaction and LF reading
RPA reactions were performed using the commercial TwistAmp Basic kit (TwistDx, Cambridge, UK). The protocol suggested by the manufacturer was adapted to enable the visualization of amplicons on the LF strips. For this purpose, we added the reaction mixture, exogenous NFo (Intact Genomics, St. Louis, MO, USA), which typically provides the generation of a double-labeled product, which can then be detected in the LF strips. Furthermore, during the standardization process, other modifications in the concentration of reagents, temperature, and reaction time were made to the standard protocol to optimize the assays.
To select the optimal incubation conditions, the RPA assays were performed at different temperatures (20, 25, 30, 35, 40, 45 and 50 °C) in a previously established amplification time (40 min). Also, the tests were carried out at different time periods (5, 10, 15, 20, 25, 30, 35 and 40 min). RPA assays were performed in a dry bath incubator (DB – Heat & Cool, Loccus, São Paulo, SP, Brazil). Immediately after isothermal amplification, the amplicons were visualized using PCRD FLEX LF strips (Abingdon Health, York, UK), following the manufacturer’s instructions (Abingdon Health, York, UK). PCRD FLEX LF strips detect up to two differently labeled amplicons. Thus, test line 1 (T1) detects DIG/biotin-labeled amplicons, whereas test line 2 (T2) detects FAM/biotin-labeled amplicons (Fig. 1). Test line 3 (T3) is the control line.
Fig. 1.
Schematic illustrations of the PCRD FLEX lateral flow (LF) strips (Abingdon Health, York, UK) (A): a, positive result for test line 1 (T1); b, positive result for test line (T2); c, negative result showing control line (C); d, an illustration of all lines (T1 detects DIG/biotin-labeled amplicons; T2 detects FAM/biotin- or FICT/biotin-labeled amplicons; C is the control line). Actual examples of a T1-positive (left) and a T1-negative (right) result with the recombinase polymerase amplification-LF assay (RPA-LF) for L. infantum (B)
Data analysis
The sensitivity, specificity, accuracy, and positive and negative predictive values for the L. infantum RPA-LF assay were calculated as described elsewhere [30], using either qPCR or cPCR as a reference test. The strength of agreement between the PCR assays (both qPCR and cPCR) and RPA-LF assay for L. infantum was assessed using kappa statistics and categorized as follows: slight (0–0.20), fair (0.21–0.40), moderate (0.41–0.60), substantial (0.61–0.80), and almost perfect agreement (0.81–1.00) [31]. Data were analyzed using QuickCalcs of GraphPad Software (https://www.graphpad.com/quickcalcs/).
Results
Standardization of RPA-LF assays
The concentrations of the reagents of the RPA-LF assays for detecting L. braziliensis and L. infantum are described in Tables 2 and 3. These concentrations were established adjusting the concentrations suggested by the manufacturer of the TwistDx master mix, based on results obtained in terms of analytical sensitivity. In the RPA-LF assay for L. braziliensis, the primers and probe were used at a concentration of 5 µM (Table 2), allowing the detection of all DNA concentrations used in the standard curve. In terms of incubation temperature and time, the initial conditions tested, that is, 45 °C for 40 min, were maintained, as we obtained good performance at all concentrations of the standard curve (Fig. 2A).
Table 2.
Recombinase polymerase amplification assay conditions for the detection of Leishmania braziliensis
| Components | Initial concentration | Volume per reaction (µl) | Final concentration |
|---|---|---|---|
| TwistDx master mix | n/a | 29.0 | n/a |
| Nuclease-free water | n/a | 6.6 | n/a |
| LB-F | 5 μM | 4.8 | 410 nM |
| LB-R | 5 μM | 4.8 | 410 nM |
| LB-P | 5 μM | 0.6 | 50 nM |
| Endonuclease IV (Nfo) | 10 units/µl | 5.86 | 1 unit/µl |
| MgOAc | 280 mM | 2.5 | 11.83 mM |
| Template DNA | 5 ng/µl to 0.5 pg/µl | 5.0 | 0.4 ng/µl to 0.04 pg/µl |
n/a: not applicable
Table 3.
Recombinase polymerase amplification assay conditions for the detection of Leishmania infantum
| Components | Initial concentration | Volume per reaction (µl) | Final concentration |
|---|---|---|---|
| TwistDx master mix | n/a | 29.0 | n/a |
| Betaine | 0.8 M | 6.6 | 0.09 M |
| LI-F | 10 μM | 4.8 | 810 nM |
| LI-R | 10 μM | 4.8 | 810 nM |
| LI-P | 10 μM | 0.6 | 100 nM |
| Endonuclease IV (Nfo) | 10 units/µl | 5.86 | 1 unit/µl |
| MgOAc | 280 mM | 2.5 | 11.83 mM |
| Template DNA | 5 ng/µl to 0.5 pg/µl | 5.0 | 0.4 ng/µl to 0.04 pg/µl |
n/a: not applicable
Fig. 2.
Representative examples of the recombinase polymerase amplification–lateral flow assays (RPA-LF) for L. braziliensis (A) and L. infantum (B). Standard DNA was obtained from cultured promastigotes of reference strains (see Methods for details), and a master mix without DNA template was used as no-template control (NTC). The assays for L. braziliensis and L. infantum were performed at 45 °C and 40 °C, respectively, for 40 min
In the RPA-LF assay for L. infantum, the primers and probe were used at 10 μM (the maximum concentration recommended by the manufacturer) (Table 3), to achieve better performance in terms of analytical sensitivity. To further optimize the visualization of the assay, we tested different incubation temperatures and times. The specific test line for L. infantum was observed at all temperatures and incubation times tested, but with the best resolution at 40 °C for 40 min (Fig. 2B). Due to the appearance of non-specific bands in the NTC, we added 0.8 M betaine solution to the RPA-LF reaction for L. infantum.
Analytical sensitivity and specificity of RPA-LF assays
In the RPA-LF assay for L. braziliensis, an amplicon dually labeled with carboxyfluorescein and biotin was visualized as expected in the test line 2 of the lateral flow strip. The analytical sensitivity of the assay was 0.04 pg/µl. In the RPA-LF assay for L. infantum, an amplicon dually labeled with digoxigenin and biotin was visualized as expected in the test line 1. This assay had a detection limit of 0.04 ng/µl (Fig. 2B). The cross-test experiments did not reveal non-specific amplifications with the standardized assays; that is, the assays detected only the target species.
Sensitivity, specificity, accuracy, positive and negative predictive values, and diagnostic agreement
The standardized L. infantum RPA-LF assay was tested with different types of dog samples (i.e., 34 skin and 36 bone marrow) from an area of active transmission in Brazil. A representative experiment is shown in Fig. 3.
Fig. 3.
Results of the recombinase polymerase amplification lateral flow assay (RPA-LF) for L. infantum on DNA extracted from skin samples from naturally infected dogs (numbers 1–5)
The sensitivity, specificity, accuracy, and positive and negative predictive values of the standardized L. infantum RPA-LF assay in bone marrow and skin samples are shown in Tables 4 and 5. Overall, the L. infantum RPA-LF presented high sensitivity, specificity, and accuracy using skin samples. This assay presented a higher positive predictive value in skin and a higher negative predictive value in bone marrow (Table 4).
Table 4.
Sensitivity, specificity, and predictive values of the recombinase polymerase amplification lateral flow assay (RPA-LF) for the detection of Leishmania infantum compared with conventional PCR (cPCR), using skin and bone marrow samples from dogs; all values are expressed as percentages (%)
| Samples | L. infantum RPA-LF | cPCR | Se | Sp | Acu | PPV | NPV | |
|---|---|---|---|---|---|---|---|---|
| + | − | |||||||
| Skin (n = 34) | + | 23 | 0 | 92.0 | 100 | 94.1 | 100 | 81.8 |
| − | 2 | 9 | ||||||
| Bone marrow (n = 36) | + | 19 | 2 | 90.5 | 86.7 | 88.9 | 90.5 | 86.7 |
| − | 2 | 13 | ||||||
+ positive, − negative, Se sensitivity; Sp specificity, Acu accuracy, PPV positive predictive value, NPV negative predictive value
Table 5.
Sensitivity, specificity and predictive values of the recombinase polymerase amplification lateral flow assay (RPA-LF) for the detection of Leishmania infantum compared with real-time PCR (qPCR), using skin and bone marrow samples from dogs; all values are expressed as percentages (%)
| Samples | L. infantum RPA-LF | qPCR | Se | Sp | Acu | PPV | NPV | |
|---|---|---|---|---|---|---|---|---|
| + | − | |||||||
| Skin (n = 34) | + | 23 | 0 | 76.7 | 100 | 79.4 | 100 | 36.4 |
| − | 7 | 4 | ||||||
| Bone marrow (n = 36) | + | 21 | 0 | 70.0 | 100 | 75 | 100 | 40.0 |
| − | 9 | 6 | ||||||
+, positive, − negative, Se sensitivity, Sp specificity, Acu accuracy, PPV positive predictive value, NPV negative predictive value
The agreement between the L. infantum RPA-LF assay and the cPCR was almost perfect using skin samples and substantial using bone marrow samples (Table 6). The overall agreement with qPCR was moderate, but considering samples with Cq < 30 (moderate to high parasite load), the agreement was almost perfect (kappa = 0.807) (Table 7).
Table 6.
Agreement between the recombinase polymerase amplification lateral flow assay (RPA-LF) for the detection of Leishmania infantum and conventional PCR (cPCR), using skin and bone marrow samples from dogs
| Parameter | RPA-LF vs. cPCR, skin (n = 34) | RPA-LF vs. cPCR, bone marrow (n = 36) | RPA-LF vs. cPCR, all samples (n = 70) |
|---|---|---|---|
| Observed agreements | 32 (94.1%) | 32 (88.9%) | 64 (91.4%) |
| Agreements expected by chance | 19.8 (58.3%) | 18.5 (51.4%) | 37.8 (54.0%) |
| Kappa coefficient | 0.859 | 0.771 | 0.813 |
| Standard error of kappa | 0.096 | 0.108 | 0.073 |
| 95% confidence interval | 0.671–1.000 | 0.560–0.982 | 0.671–0.956 |
| Classification | Almost perfect | Substantial | Almost perfect |
Table 7.
Agreement between the recombinase polymerase amplification lateral flow assay (RPA-LF) for the detection of Leishmania infantum and real-time PCR (qPCR), using skin and bone marrow samples from dogs
| Parameter | RPA-LF vs. qPCR, skin (n = 34) | RPA-LF vs. qPCR, bone marrow (n = 36) | RPA-LF vs. qPCR, all samples (n = 70) | RPA-LF vs. qPCR, Cq < 30a (n = 35) |
|---|---|---|---|---|
| Observed agreements | 27 (79.4%) | 27 (75.0%) | 54 (77.1%) | 32 (91.4%) |
| Agreements expected by chance | 21.6 (63.5%) | 20 (55.6%) | 41.4 (59.2%) | 19.4 (55.5%) |
| Kappa coefficient | 0.436 | 0.437 | 0.440 | 0.807 |
| Standard error of kappa | 0.157 | 0.134 | 0.102 | 0.104 |
| 95% confidence interval | 0.129–0.743 | 0.174–0.701 | 0.240–0.840 | 0.603–1.000 |
| Classification | Moderate | Moderate | Moderate | Almost perfect |
aIn this analysis, all skin and bone marrow samples with a quantification cycle (Cq) < 30 (moderate to high parasite load) and negative samples were included. Samples with a Cq > 30 were excluded
Discussion
We successfully standardized two new RPA-LF assays for the detection of L. braziliensis and L. infantum in dogs. There was substantial agreement between the L. infantum RPA-LF assay and cPCR. Comparing to a highly sensitive qPCR assay [29], there was almost perfect agreement between the L. infantum RPA-LF and the qPCR results in samples with a Cq < 30. For samples with Cq > 30 (i.e., lower parasite load), the agreement was only moderate. This means that for dogs with a moderate to high parasite load, the RPA-LF would detect the parasite, whereas false negative results can occur in dogs with low parasite loads.
The superior analytical sensitivity of the qPCR as compared to RPA is acknowledged [20]. Therefore, the higher sensitivity of our qPCR as compared to the newly developed L. infantum RPA-LF assay was expected and may partly explain the moderate agreement between these assays, when also considering samples with a lower parasite load. Indeed, qPCR assays are known for their higher sensitivity, even compared to cPCR [28, 32]. In this regard, the L. infantum RPA-LF assay presented high sensitivity (> 90%) on both skin and bone marrow samples, using cPCR as a reference test. In particular, the L. infantum RPA-LF assay presented 92% sensitivity and 100% specificity on skin samples, with almost perfect agreement with cPCR. These data suggest that the L. infantum RPA-LF assay on skin samples could be an alternative for cPCR in remote areas lacking laboratory infrastructure for performing cPCR assays and gel electrophoresis.
In recent decades, molecular assays based on PCR have become more accessible and popular [2, 17]. PCR-based assays generally present good sensitivity in detecting Leishmania DNA in a wide range of samples, including from bone marrow, lymph node, skin, ocular swab, and even blood [2, 28, 29, 32]. However, molecular methods are still far from the reality of many veterinary practitioners working in areas where proper laboratory infrastructure is limited or lacking. Thus, the development of point-of-care molecular tools that could detect Leishmania DNA with good sensitivity and specificity would be a great advancement for the diagnosis of canine leishmaniasis in those areas.
In this sense, one of the main advantages of the RPA is its simplicity. The amplification process in RPA assays can occur at 30–42 °C [25, 33] and within 5–40 min [26, 34–38]. In fact, we obtained positive results at a wide range of temperatures and reaction times, with little variation in terms of band intensity. Again, this may be an important feature for an assay to be used under field conditions.
The present study has some limitations. Because of funding constraints, we tested a relatively limited number (n = 70) of samples from dogs. Similarly, we did not test the RPA-LF assay using samples from L. braziliensis-infected dogs. The next steps would be to test these assays on a larger number of samples from dogs infected by L. infantum and L. braziliensis. It would also be interesting to test the performance of the RPA-LF assay for L. infantum using less invasive samples, such as blood and conjunctival swab.
Finally, as RPA assays also have the potential to be applied for the point-of-care diagnosis of human leishmaniasis [20], this should be investigated using the assays developed in the present study.
Conclusions
The RPA-LF assays developed herein may be promising molecular tools for the point-of-care diagnosis of L. braziliensis and L. infantum infections in dogs, particularly in remote areas lacking laboratory infrastructure. RPA-LF is a valid alternative to the more laborious and expensive qPCR and cPCR assays. Further research is needed to validate these assays on a larger number of samples and to confirm their applicability under field conditions.
Acknowledgements
Thanks to Dr. Bruno L. Travi for his valuable input on this project and manuscript.
Author contributions
Conceptualization: FDT, RLNL, KGSS; Methodology: FDT, RLNL, TRS, KGSS; Formal analysis and investigation: FDT, RLNL, LLNB, KGSS; Writing—original draft preparation: RLNL, FDT; Writing—review and editing: FDT, RLNL, TRS, KGSS, LAF, FSN, DO, LLNB; Funding acquisition: FDT, FSN, LAF; Resources: FDT, FSN; Supervision: FDT.
Funding
This research was supported by Fundação de Amparo à Pesquisa de Pernambuco (FACEPE), APQ-0548- 2.13/19.
Availability of data and materials
No datasets were generated or analyzed during the current study.
Declarations
Ethics approval and consent to participate
This study used samples obtained from dogs during a previous study, whose procedures were approved by the Ethics Committee on Animal Use of Andradina Educational Foundation (CEUA/FEA nº 0010). The procedures of the current study were also assessed and authorized by the Ethics Committee on Animal Use of Aggeu Magalhães Institute (CEUA nº 153/19).
Consent for publication
Not applicable.
Competing interests
Filipe Dantas-Torres is the Editor-in-Chief of Parasites & Vectors.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Dantas-Torres F, Solano-Gallego L, Baneth G, Ribeiro VM, de Paiva-Cavalcanti M, Otranto D. Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences. Trends Parasitol. 2012;28:531–8. [DOI] [PubMed] [Google Scholar]
- 2.Travi BL, Cordeiro-da-Silva A, Dantas-Torres F, Miró G. Canine visceral leishmaniasis: Diagnosis and management of the reservoir living among us. PLoS Negl Trop Dis. 2018;12:e0006082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dantas-Torres F. Canine leishmaniasis in the Americas: etiology, distribution, and clinical and zoonotic importance. Parasit Vectors. 2024;17:198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dantas-Torres F, de Paiva-Cavalcanti M, Figueredo LA, Melo MF, da Silva FJ, da Silva AL, et al. Cutaneous and visceral leishmaniasis in dogs from a rural community in northeastern Brazil. Vet Parasitol. 2010;170:313–7. [DOI] [PubMed] [Google Scholar]
- 5.Silva DA, Madeira MF, Teixeira AC, de Souza CM, Figueiredo FB. Laboratory tests performed on Leishmania seroreactive dogs euthanized by the leishmaniasis control program. Vet Parasitol. 2011;179:257–61. [DOI] [PubMed] [Google Scholar]
- 6.Souza NA, Leite RS, Silva SO, Penna MG, Vilela LFF, Melo MN, et al. Detection of mixed Leishmania infections in dogs from an endemic area in southeastern Brazil. Acta Trop. 2019;193:12–7. [DOI] [PubMed] [Google Scholar]
- 7.Solano-Gallego L, Miró G, Koutinas A, Cardoso L, Pennisi MG, Ferrer L, et al. LeishVet guidelines for the practical management of canine leishmaniosis. Parasit Vectors. 2011;4:86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Figueredo LA, de Paiva-Cavalcanti M, Almeida EL, Brandão-Filho SP, Dantas-Torres F. Clinical and hematological findings in Leishmania braziliensis-infected dogs from Pernambuco. Brazil Rev Bras Parasitol Vet. 2012;21:418–20. [DOI] [PubMed] [Google Scholar]
- 9.Lago J, Silva JA, Borja L, Fraga DBM, Schriefer A, Arruda S, et al. Clinical and histopathologic features of canine tegumentary leishmaniasis and the molecular characterization of Leishmania braziliensis in dogs. PLoS Negl Trop Dis. 2019;13:e00075322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pirmez C, Marzochi MC, Coutinho SG. Experimental canine mucocutaneous leishmaniasis (Leishmania braziliensis braziliensis). Mem Inst Oswaldo Cruz. 1988;83:145–51. [DOI] [PubMed] [Google Scholar]
- 11.Brito ME, Andrade MS, Dantas-Torres F, Rodrigues EH, Cavalcanti MP, de Almeida AM, et al. Cutaneous leishmaniasis in northeastern Brazil: a critical appraisal of studies conducted in State of Pernambuco. Rev Soc Bras Med Trop. 2012;45:425–9. [DOI] [PubMed] [Google Scholar]
- 12.Muvdi-Arenas S, Ovalle-Bracho C. Mucosal leishmaniasis: a forgotten disease, description and identification of species in 50 Colombian cases. Biomedica. 2019;39:58–65. [DOI] [PubMed] [Google Scholar]
- 13.Sevá ADP, Pena HFJ, Nava A, Sousa AO, Holsback L, Soares RM. Endoparasites in domestic animals surrounding an Atlantic Forest remnant, in São Paulo State. Brazil Rev Bras Parasitol Vet. 2018;27:13–9. [DOI] [PubMed] [Google Scholar]
- 14.Arruda AA, Bresciani KDS, Werner SS, Silva BFD. Occurrence of gastrointestinal parasites in dogs in a rural area of Santa Catarina. Brazil Rev Bras Parasitol Vet. 2023;32:e005723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Alves WA, Bevilacqua PD. Reflexões sobre a qualidade do diagnóstico da leishmaniose visceral canina em inquéritos epidemiológicos: o caso da epidemia de Belo Horizonte, Minas Gerais, Brasil, 1993–1997. Cad Saude Publica. 2004;20:259–65. [DOI] [PubMed] [Google Scholar]
- 16.Otranto D, Paradies P, de Caprariis D, Stanneck D, Testini G, Grimm F, et al. Toward diagnosing Leishmania infantum infection in asymptomatic dogs in an area where leishmaniasis is endemic. Clin Vaccine Immunol. 2009;16:337–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Solano-Gallego L, Cardoso L, Pennisi MG, Petersen C, Bourdeau P, Oliva G, et al. Diagnostic challenges in the era of canine Leishmania infantum vaccines. Trends Parasitol. 2017;33:706–17. [DOI] [PubMed] [Google Scholar]
- 18.Iatta R, Carbonara M, Morea A, Trerotoli P, Benelli G, Nachum-Biala Y, et al. Assessment of the diagnostic performance of serological tests in areas where Leishmania infantum and Leishmania tarentolae occur in sympatry. Parasit Vectors. 2023;16:352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Maia C, Fraga DBM, Cristóvão J, Borja LS, da Silva SM, Campino L, et al. Leishmania exposure in dogs from two endemic countries from New and Old Worlds (Brazil and Portugal): evaluation of three serological tests using Bayesian Latent Class Models. Parasit Vectors. 2022;15:202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Travi BL, Delos Santos MB, Shelite TR, Santos RP, Rosales LA, Castellanos-Gonzalez A, et al. Diagnostic efficacy of recombinase-polymerase-amplification coupled with lateral flow strip reading in patients with cutaneous leishmaniasis from the Amazonas Rainforest of Perú. Vector Borne Zoonotic Dis. 2021;21:941–7. [DOI] [PubMed] [Google Scholar]
- 21.Latrofa MS, Cereda M, Louzada-Flores VN, Dantas-Torres F, Otranto D. Q3 lab-on-chip real-time PCR for the diagnosis of Leishmania infantum infection in dogs. J Clin Microbiol. 2024;62:e0010424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Castellanos-Gonzalez A, Saldarriaga OA, Tartaglino L, Gacek R, Temple E, Sparks H, et al. A Novel molecular test to diagnose canine visceral leishmaniasis at the point of care. Am J Trop Med Hyg. 2015;93:970–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Saldarriaga OA, Castellanos-Gonzalez A, Porrozzi R, Baldeviano GC, Lescano AG, de Los Santos MB, et al. An innovative field-applicable molecular test to diagnose cutaneous LeishmaniaViannia spp. infections. PLoS Negl Trop Dis. 2016;26:10:e0004638. 10.1371/journal.pntd.0004638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Piepenburg O, Williams CH, Stemple DL, Armes NA. DNA detection using recombination proteins. PLoS Biol. 2006;4:e204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang S, Duan M, Li S, Hou J, Qin T, Teng Z, et al. Current status of recombinase polymerase amplification technologies for the detection of pathogenic microorganisms. Diagn Microbiol Infect Dis. 2024;108:116097. [DOI] [PubMed] [Google Scholar]
- 26.Lobato IM, O’Sullivan CK. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Analyt Chem. 2018;98:19–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lv R, Lu N, Wang J, Li Y, Qi Y. Recombinase polymerase amplification for rapid detection of zoonotic pathogens: an overview. Zoonoses. 2022;2:1. [Google Scholar]
- 28.Francino O, Altet L, Sánchez-Robert E, Rodriguez A, Solano-Gallego L, Alberola J, et al. Advantages of real-time PCR assay for diagnosis and monitoring of canine leishmaniosis. Vet Parasitol. 2006;137:214–21. [DOI] [PubMed] [Google Scholar]
- 29.Dantas-Torres F, Sales KGS, Gomes da Silva L, Otranto D, Figueredo LA. Leishmania-FAST15: A rapid, sensitive and low-cost real-time PCR assay for the detection of Leishmania infantum and Leishmania braziliensis kinetoplast DNA in canine blood samples. Mol Cell Probes. 2017;31:65–9. [DOI] [PubMed] [Google Scholar]
- 30.Trevethan R. Sensitivity, specificity, and predictive values: foundations, pliabilities, and pitfalls in research and practice. Front Public Health. 2017;5:307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Landis JR, Koch GG. The measurement of observer agreement for categorical data. Biometrics. 1977;33:159–74. [PubMed] [Google Scholar]
- 32.Martínez V, Quilez J, Sanchez A, Roura X, Francino O, Altet L. Canine leishmaniasis: the key points for qPCR result interpretation. Parasit Vectors. 2011;4:57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chandu D, Paul S, Parker M, Dudin Y, King-Sitzes J, Perez T, et al. Development of a rapid point-of-use DNA test for the screening of Genuity® roundup ready 2 Yield® soybean in seed samples. Biomed Res Int. 2016;2016:3145921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Lillis L, Lehman D, Singhal MC, Cantera J, Singleton J, Labarre P, et al. Noninstrumented incubation of a recombinase polymerase amplification assay for the rapid and sensitive detection of proviral HIV-1 DNA. PLoS ONE. 2014;9:e108189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kersting S, Rausch V, Bier FF, von Nickisch-Rosenegk M. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis. Malar J. 2014;13:99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Munawar MA. Critical insight into recombinase polymerase amplification technology. Expert Rev Mol Diagn. 2022;22:725–37. [DOI] [PubMed] [Google Scholar]
- 37.Xia X, Yu Y, Weidmann M, Pan Y, Yan S, Wang Y. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay. PLoS ONE. 2014;9:e104667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Xu L, Duan J, Chen J, Ding S, Cheng W. Recent advances in rolling circle amplification-based biosensing strategies-a review. Anal Chim Acta. 2021;1148:238187. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analyzed during the current study.