Five new species of endophytic Penicillium from rubber trees in the Brazilian Amazon

Abstract

The Amazon rainforest is the world’s most diverse ecosystem, full of fauna and flora. Among the trees that make up the forest are the rubber trees of the genus Hevea (H. brasiliensis and H. guianensis), which stand out for the industrial use of latex. It was previously shown that endophytic fungi colonize the leaves, stems, and roots of Hevea spp. In this study, 47 Penicillium spp. and three Talaromyces spp. isolates were analyzed using specific DNA barcodes: internal transcribed spacers region (ITS), β-tubulin (BenA), calmodulin (CaM), and the DNA-dependent RNA polymerase II second largest subunit (RPB2) genes and additionally, for species delimitation, the genealogical concordance phylogenetic species recognition (GCPSR) criteria were applied. The phylogenetic analyses placed the Penicillium isolates into four sections Lanata-Divaricata, Sclerotiora, Citrina, and Fasciculata. The morphological and molecular characteristics resulted in the discovery of five new species (P. heveae sp. nov., P. acrean sp. nov., P. aquiri sp. nov., P. amazonense sp. nov., and P. pseudomellis sp. nov.). The five new species were also compared to closely related species, with observations on morphologically distinguishing features and colony appearances. Bayesian inference and maximum likelihood analysis have supported the placement of P. heveae sp. nov. as a sister group to P. globosum; P. acrean sp. nov. and P. aquiri sp. nov. as sister groups to P. sumatrense; P. amazonense sp. nov. closely related to isolates of P. rolfsii, and P. pseudomellis sp. nov. closely related to P. mellis. The study of endophytic Penicillium species of rubber trees and the description of five new taxa of Penicillium sect. Citrina, Lanata-Divaricata, and Sclerotiora as endophytes add to the fungal biodiversity knowledge in native rubber trees. Reports of fungi in native tropical plants may reveal taxonomic novelties, potential pathogen control agents, and producers of molecular bioactive compounds of medical and agronomic interest.

Introduction

The Amazon rainforest is the largest center of biodiversity in the world. Rubber trees (Hevea brasiliensis and Hevea guianensis) are endemic to the Brazilian Amazon Forest and are commercially exploited in other regions of Brazil and in Asian countries [1]. The rubber trees are of great economic importance because they are producers of natural latex [1, 2]. In addition, they are host to various microorganisms, including endophytic species [2–6].

Endophytic fungi have been isolated from various plant species and are studied because of their wide taxonomic and functional diversity. They produce bioactive compounds (secondary metabolites) that are involved in a variety of applications, including biocontrol of plant pathogens and insects, promotion of plant growth, and reduction of pollution from chemical pesticides in agricultural farms [7, 8]. They are also involved in important beneficial human activities and diverse biotechnological processes. Furthermore, they produce antioxidant and anticancer compounds [9].

Previous studies on the diversity of endophytic fungi in rubber trees from the Brazilian Amazon Forest showed a great abundance of isolates of the genus Penicillium in their leaves, stems, and roots [3, 4]. Penicillium is one of the most common fungal genera, inhabiting diverse habitats and commonly found inside plants and animals, in soil, in the air, and in food products. It has a worldwide distribution and a large economic impact on human life, where it is applied in several areas, including pharmaceuticals, agronomy, and biotechnology [7, 10–17].

The genus Penicillium (Ascomycota, Pezizomycotina, Sordariomycetes, Eurotiales, Aspergillaceae) was first described by Link (1809), based on morphological traits [18–21].

In the major Penicillium monographs published later, a polyphasic approach for species recognition was applied [22]. Phenotypic, physiological characters combined with DNA sequences were used for species delimitation, following this sectional classification. The most recent list included 354 Penicillium and 88 Talaromyces species [23]. According to current estimates, the genus has over 480 Penicillium spp. [24, 25]. Houbraken et al. [24] reestablished the classification series in a phylogenetic re-evaluation of numerous taxa in the order Eurotiales, with smaller sections. Several sections and new species were described and approached with the exact set of genes used for multi-locus sequence type, namely: internal transcribed spacers region (ITS), β-tubulin (BenA), calmodulin (CaM), and the DNA-dependent RNA polymerase II second largest subunit (RPB2). Visagie et al. [23], [26], [27] suggested a Genealogical Concordance Phylogenetic Species Recognition (GCPSR) criteria based on the sequence dataset of these four loci. The GCPSR concept [28, 29] has been used for species delimitation in several fungal groups like Trichoderma and Penicillium [30, 31]. Additional, phenotype features, such as standard conidiophore branching, culture appearance, conidia features, soluble pigments, or exudates, can be interpreted as informative characters and added to their correlation with robustly analyzed DNA sequence data [23].

Because of the importance of knowing the species of endophytic microorganisms that colonize rubber trees in the Brazilian Amazon Forest, and the potential that isolates of the genus Penicillium may have as agents of biological control, growth promotors, and producers of secondary metabolites of industrial, medical and agricultural interest, this study aims to identify endophytic Penicillium species from rubber trees of the Brazilian Amazon rainforest using morphological, cultural and phylogenies (single-loci and multi-locus) approaches.

Materials and methods

Sample collection

The collection and fungal isolation were performed in Brazil in 2014 in the Brazilian Amazon Forest, Acre (AC), and Amazonas (AM) states. Endophytic Penicillium spp. and Talaromyces spp. were isolated from the leaves, stems, and roots of Hevea brasiliensis [4] and Hevea guianensis [3]. The methodology for collection and fungal isolation was done following [32], [33], and [34] and has been detailed and reported by Araújo et al. [3, 4]. After obtaining pure cultures, these were preserved in silica gel [35]; all the isolates are kept in the collection of Fungi at the Laboratory of Molecular Genetics and Microorganisms, Bioagro (Instituto de Biotecnologia Aplicado à Agropecuária), Universidade Federal de Viçosa, MG, Brazil. A total of 50 isolates from the Penicillium and Talaromyces genera were used in this study (Table 1). Representative specimens of new taxa were deposited in the Herbarium of the Universidade Federal de Viçosa (Herbarium VIC), and the respective isolates deposited in the culture collection Coleção Octávio de Almeida Drumond (COAD) hosted in Universidade Federal de Viçosa. The dried cultures of the endophytic fungus growing on potato dextrose agar (PDA) are deposited as holotypes.

Table 1.

Endophytes isolated from leaves, stems, and roots of Hevea spp. in the Amazon Forest

Species	Isolates	Plant tissues	State	Host	Reference
Penicillium section Fasciculata
Penicillium crustosum	37F27C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium crustosum	314F2C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium section Lavanata-Divaricata
Penicillium amazonense sp. nov.	COAD3477	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium amazonense sp. nov.	COAD3476	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium heveaesp. nov	COAD3468	Leaf	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium heveaesp. nov	COAD3467	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium cataractum	507F5R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicilliumsection Sclerotiora
Penicillium sp.	213F5C-AC	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium sp.	728F5C-AC	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium pseudomellis sp. nov.	COAD3475	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium pseudomellis sp. nov.	COAD3474	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium section Citrina
Penicillium shearii	637F5R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium paxilli	7F5R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium aquiri sp. nov	COAD3464	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium aquiri sp. nov	COAD3465	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium aquiri sp. nov	COAD3466	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium sp.	197F3C-AC	Stem	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium acrean sp. nov	COAD3462	Stem	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium acrean sp. nov	COAD3463	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium steckii	667F7R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	294F7F-AC	Leaf	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	211F7F-AC	Leaf	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	212F14F-AC	Leaf	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	564F2R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	360F5R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	202F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	694F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	752F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	753F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	755F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	756F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	798F8R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	171F9R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	689F9R-AC	Root	Acre	Hevea guianensis	Araújo et al. [3]
Penicillium citrinum	198F11R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	524F11R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	562F11R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	624F12R-AC	Root	Acre	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	629F14F-AM	Leaf	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	287F18F-AM	Leaf	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	684F9C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	174F20C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	634F20C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	767F20C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	652F22C-AM	Stem	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	298F4R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Penicillium citrinum	477F10R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Talaromyces
Talaromyces siamensis	86F10R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Talaromyces thailandensis	623F7R-AM	Root	Amazonas	Hevea brasiliensis	Araújo et al. [4]
Talaromyces amestolkiae	705F18F-AC	Leaf	Acre	Hevea brasiliensis	Araújo et al. [4]

Morphological observations

The new species of endophytic Penicillium were identified based on morphological characteristics and culture appearance. For fungal growth rate assays, the medium and conditions described in [23] were used: Czapek yeast autolysate agar (CYA), malt extract agar (MEA), yeast extract sucrose agar (YES), CYA supplemented with 5% NaCl (CYAS), oatmeal agar (OA), and creatine sucrose agar (CREA). The mycelial disks were placed in 90 mm Petri dishes containing 20 mL of each medium and incubated for seven days at 25 °C in darkness. However, the fungal growth rate in the CYA medium was evaluated at three different temperatures. Isolates were grown on OA to examine sexual reproductive states, and Petri dishes were incubated for 21 days; on CREA to examine acid production, where the color reaction was observed; and on CYAS to examine the effect of low water activity. The plates were cultured as described above, and the mycelial diameter was measured using a caliper. Each culture medium was tested in triplicate. The microcultures were performed on MEA for observations of the reproductive structures of the isolates. Microscopic examinations were performed using Olympus BX50 and BX53 microscopes equipped with a Q-Color 5 digital camera. Reproductive structures were measured, and photomicrographs were obtained using cellSens dimension 1.9 software (Olympus Corporation, Shinjuku, Tokyo, Japan).

DNA extraction, polymerase chain reaction (PCR), and sequencing

Isolates were grown on a YM (Yeast Malt Agar) culture medium (0.2% yeast extract, 1% malt extract, and 1.5% agar) to 25 °C ± 2 °C for ten days. About 50 mg of fungi mycelium was transferred to sterile microtubes with 0.2 mL of glass beads (425 to 600 μm), and DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions and the modifications proposed [36]. The DNA extracted was quantified and evaluated for purity by spectrophotometry (A260/A280 ratio) (Nanodrop 2000, Thermo Scientific). Four primer pairs ITS1/ITS4 [37], Bt2a/Bt2b [38], CMD5/CMD6 and CF1/CF4 [39, 40] and fRPB2-5 F/fRPB2-7R [41] were used to amplify four regions, ITS, BenA, CaM, and RPB2. The polymerase chain reaction (PCR) amplifcations were performed in a total reaction volume of 12.5 µl, including 0.25 µl of each primer, 1.25 µl of BSA, 6.25 of Taq polymerase [including dNTPs], 0.25 µl of genomic DNA [30 ng/µl]; 0.25 µl DMSO and 4 µl of sterile ultrapure water. The primers detailed and yours respectively conditions for amplifications are listed in the Table 2. The amplification products were separated using 1.2% agarose gel electrophoresis. Finally, the products were purified and sequenced by Macrogen Inc., South Korea (http://dna.macrogen.com).

Table 2.

PCR primers and conditions used for DNA amplification

Gene/locus	Primer	Sequence (5’ to 3’)	PCR	References
			conditions
ITS	ITS 1	TCCGTAGGTGAACCTGCGG	3 min at 95 °C; 36 cycles of 1 min at 95 °C, 1 min at 51 °C and 1 min at 72 °C; 7 min at 72 °C	White et al. [37]
	ITS 4	TCCTCCGCTTATTGATATGC		White et al. [37]
BenA	Bt2a	GGT AAC CAA ATC GGT GCT GCT TTC	3 min at 95 °C; 36 cycles of 1 min at 95 °C, 1 min at 55 °C and 1 min at 72 °C; 7 min at 72 °C	Glass and Donaldson [38]
	Bt2b	ACC CTC AGT GTA GTG ACC CTT GGC		Glass and Donaldson [38]
CaM	CMD5	CCG AGT ACA AGG ARG CCT TC	3 min at 95 °C; 36 cycles of 1 min at 95 °C, 1 min at 57 °C, 59–60 °C, and 1 min at 72 °C; 7 min at 72 °C	Hong et al. [39]
	CMD6	CCG ATR GAG GTC ATR ACG TGG		Hong et al. [39]
CaM	CF1	GCC GAC TCT TTG ACY GAR GAR	3 min at 95 °C; 36 cycles of 1 min at 95 °C, 1 min at 57 °C, 59–60 °C, and 1 min at 72 °C; 7 min at 72 °C	Peterson et al. [40]
	CF4	TTT YTG CAT CAT RAG YTG GAC		Peterson et al. [40]
RPB2	frpb2–5 F	GAYGAYMGWGATCAYTTYGG	3 min at 95 °C; 36 cycles of 1 min at 95 °C, 1 min at 55 °C to each second with increment of 0.2 °C and 1 min at 72 °C; 7 min at 72 °C	Liu et al. [41]
	frpb2–7R	CCCATRGCTTGYTTRCCCAT		Liu et al. [41]

Phylogenetic analysis

The DNA sequences obtained (sense and antisense) were assembled in contig sequences and manually corrected using the DNA BASER sequence assembly v3.x 2012 software system (Heracle BioSoft SRL Romania, http//www.DnaBaser.com). The sequence similarities were determined using a National Center for Biotechnology Information (NCBI) BLASTn search, which allowed the identification of isolates belonging to Penicillium and Talaromyces genera. The sequences of the ITS region (ITS1-5.8 S-ITS2) and each gene sequence (BenA, CaM, and RPB2) were deposited in the NCBI nucleotide database - GenBank. The MUSCLE was used to align 107 sequences (Table 3) using the Molecular Evolutionary Genetics Analysis (MEGA v.6) software [42]. The NEXUS file was interleaved using the Paup 4b10 software system [43] to verify whether it was possible to concatenate the data set. The single and multi-locus sequence datasets were analyzed using Bayesian inference (BI) and maximum likelihood (ML) analyses.

Table 3.

Isolates and NCBI GenBank accession numbers used in this study

Species	Isolate	ITS	BenA	CaM	RPB2
Penicillium section Fasciculata		Accession Number
Penicillium crustosum	37F27C-AM	MT140340	MW820826	MW928613	MW820828
Penicillium crustosum	314F2C-AM	MG751235	MW820827	MW928614	MW820829
Isolates GenBank		GenBank Accession Number
Penicillium crustosum	CBS 115,503T	MH862985	MN969379	–	MN969114
Penicillium crustosum	CV0241	–	JX091536	JX141576	MN149972
Penicillium crustosum	CV0251	–	JX091530	JX141577	MN149969
Penicillium commune	NRRL35686	EF200099	EF198566	EF198594	EF198602
Penicillium commune	CBS 311.48T	NR111143	–	KU896829	–
Penicillium section Lanata-Divaricata		Accession Number
Penicillium amazonensesp. nov.	COAD3477	MG751238	MW820832	MW820830	–
Penicillium amazonensesp. nov.	COAD3476 T	MT140343	MW820833	MW820831	OK087392
Penicillium cataractum	507F5R-AM	MT140320	MW928620	MW928615	MW820839
Penicillium heveae sp. nov.	COAD3468	MT140319	MW928621	MW928616	OK087393
Penicillium heveae sp. nov	COAD3467 T	MG751217	MW928622	MW928617	OK087394
Isolates GenBank		GenBank Accession Number
Penicillium rolfsii	CBS 368.48T	NR111669	GU981667	MN969294	KC346314
Penicillium rolfsii	A1S3-D87	KJ767061	KJ767045	–	–
Penicillium rolfsii	DI16-115	LT558937	LT559054	–	–
Penicillium flaviroseum	NN072393	KY495020	KY495129	KY494960	KY495073
Penicillium flaviroseum	NN072483T	KY495032	KY495141	KY494972	KY495083
Penicillium camponotum	NN072444	KY494996	KY495105	KY494936	KY495054
Penicillium camponotum	NN058252	KY495026	KY495135	KY494966	KY495077
Penicillium piscarium	CBS220030	KC346342	KC346319	KC346333	KC346309
Penicillium piscarium	CBS 362.48T	NR111507	GU981668	MN969288	KF296451
Penicillium cataractum	KAS2271	KT887865	KT887826	KT887787	–
Penicillium cataractum	KAS2270	KT887864	KT887825	KT887786	–
Penicillium cataractum	KAS2145T	KT887847	KT887808	KT887769	MN969180
Penicillium globosum	NN072354T	KY495014	KY495123	MN969330	KY495067
Penicillium globosum	NN072461	KY495014	KY495127	KY494958	KY495067
Penicillium globosum	NN072506	KY495018	KY495123	KY494954	KY495071
Penicillium guangxiense	NN044175T	KY494985	KY495094	KY494925	KY495045
Penicillium guangxiense	NN044180	KY494986	KY495095	KY494926	–
Penicillium griseoflavum	NN072331T	KY495011	KY495120	KY494951	KY495064
Penicillium mariae-crucis	CBS 271.83T	NR111506	GU981630	MN969275S	SKF296439
Penicillium section Sclerotiora		Accession Number
Penicillium meliponae	213F5C-AC	MG751229	MW928623	MW928618	MW928611
Penicillium sp.	728F5C-AC	MT140334	MW928624	MW928619	MW928612
Penicillium pseudomellis sp. nov.	COAD3475	MT140342	MW820836	MW820834	OK087391
Penicillium pseudomellis sp. nov.	COAD3474 T	MG751237	MW820837	MW820835	MW820838
Isolates GenBank		GenBank Accession Number
Penicillium maximae	NRRL2060T
Penicillium austrosinicum	HMAS 248,734T	NR153272	KX885041	KX885051	KX885032
Penicillium guanacastense	DAOM239912	NR111673	JN625967	JN626010	KX961295
Penicillium adametzii	CBS 209.28T	NR103661	JN625957	KC773796	JN121455
Penicillium adametzii	KAS 3463	JN714930	JN625958	–	–
Penicillium adametzioides	CBS 313.59T	NR103660	JN799642	JN686387	JN406578
Penicillium adametzioides	DAOM 239,916	JN686434	JN799643	JN686388	–
Penicillium mellis	CBS 142,499	MN431398	MN969417	MN969327	–
Penicillium jacksonii	DAOM 239,937T	JN686437	JN686368	JN686391	–
Penicillium jacksonii	CN 014E8	MT949919	MT957426	MT957466	MT957492
Penicilliums sclerotiorum	CBS 287.36T	JN626132	JN626001	JN626044	JN406585
Penicilliums ulleungdoense	KACC 48,990T	MN640087	MN737487	MN745074	MN756007
Penicillium section Citrina		Accession Number
Penicillium shearii	637F5R-AM	MG751269	MZ369099	MW972083	OK087395
Penicillium paxilli	7F5R-AM	MG751275	MZ369092	MW972076	OK073978
Penicillium aquiri sp. nov	COAD3464 T	MT137536	MZ369093	MW972077	OK073979
Penicillium aquiri sp. nov	COAD3465	MT137537	MZ369094	MW972078	OK073980
Penicillium aquiri sp. nov	COAD3466	MT137539	MZ369095	MW972079	OK073981
Penicillium sp.	197F3C-AC	MK026989	MZ369097	MW972081	OK105118
Penicillium acrean sp. nov	COAD3462	MT137533	MZ369096	MW972080	OK105117
Penicillium acrean sp. nov	COAD3463 T	MT137535	MZ369098	MW972082	OK105119
Penicillium steckii	667F7R-AM	MG751263	MZ369100	MW972084	OK105120
Penicillium citrinum	171F9R-AC	MK026982	MZ369126	MW972085	MZ369101
Penicillium citrinum	174F20C-AM	MT137319	MZ369127	MW972086	MZ369102
Penicillium citrinum	198F11R-AC	MT137313	MZ369128	MW972087	MZ369103
Penicillium citrinum	202F8R-AC	MZ410306	MZ369129	MW972088	MZ369104
Penicillium citrinum	211F7F-AC	MT137316	MZ369130	MW972089	MZ369105
Penicillium citrinum	212F14F-AC	MT137317	MZ369131	MW972090	MZ369106
Penicillium citrinum	287F18F-AM	MT137314	MZ369132	MW972091	MZ369107
Penicillium citrinum	294F7F-AC	MT137328	MZ369133	MW972092	MZ369108
Penicillium citrinum	298F4R-AM	MT137321	MZ369134	MW972093	MZ369109
Penicillium citrinum	360F5R-AC	MT137327	MZ369135	MW972094	MZ369110
Penicillium citrinum	477F10R-AM	MT137320	MZ369136	MW972095	MZ369111
Penicillium citrinum	524F11R-AC	MT137329	MZ369137	MW972096	MZ369112
Penicillium citrinum	562F11R-AC	MT137326	MZ369138	MW972097	MZ369113
Penicillium citrinum	564F2R-AC	MT137322	MZ369139	MW972098	MZ369114
Penicillium citrinum	624F12R-AC	MT137324	MZ369140	MW972099	MZ369115
Penicillium citrinum	629F14F-AM	MT137323	MZ369141	–	MZ369116
Penicillium citrinum	634F20C-AM	MT137325	MZ369142	–	MZ369117
Penicillium citrinum	652F22C-AM	MT137318	MZ369143	MW972101	–
Penicillium citrinum	684F9C-AM	MT137315	MZ369144	MW972102	–
Penicillium citrinum	689F9R-AC	MZ410307	MZ369145	MW972103	MZ369118
Penicillium citrinum	694F8R-AC	MZ410308	MZ369146	MW972104	MZ369119
Penicillium citrinum	752F8R-AC	MZ410309	MZ369147	MW972105	MZ369120
Penicillium citrinum	753F8R-AC	MZ410310	MZ369148	MW972106	MZ369121
Penicillium citrinum	755F8R-AC	MZ410311	MZ369149	MW972107	MZ369122
Penicillium citrinum	756F8R-AC	MZ410312	MZ369150	–	MZ369123
Penicillium citrinum	767F20C-AM	MG751187	MZ369151	–	MZ369124
Penicillium citrinum	798F8R-AC	MZ410313		MW972108	MZ369125
Isolates GenBank		GenBank Accession Number
Penicillium shearii	CBS 290.48T	NR111495	JN606840	EU644068	JN121482
Penicillium shearii	CBS 578.70	MH859858	JN606852	JN606575	–
Penicillium shearii	CBS 343.54	MH857352	JN606843	JN606565	–
Penicillium paxilli	CBS 360.48T	NR111483	JN606844	MN969310	JN606610
Penicillium paxilli	CBS 162.96		JN606804	JN606545	–
Penicillium sumatrense	CBS 281.36T	NR119812	JN606639	MN969301	–
Penicillium sumatrense	NRRL 779	AF033424	EF198503	EF198522	EF198541
Penicillium christenseniae	CBS126236T	MH875447	JN606680	JN606373	JN606624
Penicillium cosmopolitanum	CBS126995T	MH864380	JN606733	JN606472	MH875822
Penicillium dokdoense	CNUFCDDS111	MG906868	MH243037	MH243031	–
Penicillium raphiae	CBS126234T	MH875446	JN606657	MN969292	JN606619
Penicillium westtingii	CBS231.28T	GU944601	–	MN969312	JN606625
Penicillium westtingii	CBS127006	–	JN606730	JN606498	–
Penicillium steckii	CBS 260.55T	NR111488	GU944522	MN969300	JN606602
Penicillium citrinum	CBS 139.45T	MH856132	GU944545	MN969245	JF417416
Penicillium citrinum	CBS 122,452	GU944576	GU944543	GU944630	–
Penicillium citrinum	CBS 232.38	MH855952	–	GU944633	JN121463
Talaromyces		Accession Number
Talaromyces siamensis	86F10R-AM	MT140331	MW820840	MW820841	MW820842
Talaromyces thailandensis	623F7R-AM	MG751282	MW820843	MW820844	MW928610
Talaromyces amestolkiae	705F18F-AC	MG751225	MW820845	MW820846	MW820847
Isolates GenBank		GenBank Accession Number
Talaromyces siamensis	CBS 475.88T	NR103683	JX091379	KF741960	KM023279
Talaromyces thailandensis	CBS 133,147T	NR147428	JX494294	KF741940	KM023307
Talaromyces amestolkiae	CBS 132,695T	JX965228	JX965338	JX965199	JX965297
Talaromyces amestolkiae	CBS 26,393	JN899315	JX315625	JX315653	JX315707

(–) DNA sequence not found in databases. The isolates proposed as new taxa are colored red

The most suitable substitution model selected for BI analyses was determined for each partition using the MrModeltest v2.3 software system [44] based on the lowest Akaike information criterion (AIC) value. Nucleotide substitution models in the trees were GTR (general time reversible model) + I (proportion of invariable sites) + G(gamma distribution) for ITS and CaM, SYM (symmetrical model) + I + G for RPB2, and HKY (Hasegawa-Kishino-Yano) + I + G for BenA. The alignment was phylogenetically analyzed for all trees on the CIPRES web portal using Mr.Bayes 3.2.6 [45]. Four MCMC chains were run simultaneously, starting from random trees for 50,000,000 generations. The first 2,500 trees were discarded as the burn-in phase of each analysis. Posterior probabilities [46] were determined from a majority-rule consensus tree with the remaining 7,500 trees. Convergence of the log-likelihoods was analyzed with TRACER v. 1.7 [47], and no lack of convergence was detected. For ML analyses, the tree was generated in Sequence matrix v1.8125 [48] and Aliview [49] and estimated in the CIPRES Science Gateway Platform using RaxML-HPC v.8. [50]. The phylogenetic tree’s chain stabilities were assessed using the bootstrap re-sampling strategy with 1,000 bootstrap test replicates.

The resulting tree topologies using the two methods (ML and BI) were visualized using FigTree [51]. BootstrapL values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a Bayesian analysis of the same dataset, are indicated at well-supported nodes together with thickened branches. The species Talaromyces spp. was used as an outgroup. The topologies obtained using the two methods were then compared, and the phylogram layout was exported and edited in CorelDraw20 graphic program.

Results

Identification, phylogeny analysis, and the GCPSR concept

Sequence similarity analyses of the ITS region and the BenA, CaM, and RPB2 genes using BLASTn confirmed that among 50 endophytic isolates of H. brasiliensis and H. guianensis, 47 isolates belong to the genus Penicillium and three isolates belong to the genus Talaromyces (Tables 1 and 3). Phylogenetic analyses were made for all isolates and the new taxa; in addition to molecular studies, its morphological and cultural features are described here.

Five isolates belonging to the Penicillium section Lanata-Divaricata were isolated from leaves, stems, and roots of H. brasiliensis samples. Four isolates belonging to section Sclerotiora were isolated from stem samples. The section Citrina was represented by 36 isolates from leaves, stems, and roots samples in Hevea spp. In addition, two isolates belonging to section Fasciculata were isolated from stems. Three Talaromyces isolates were obtained from the leaves and roots of H. brasiliensis.

Phylogenetic analyses (Figs. 1, 2, 3 and 4) were inferred using single-locus (ITS, BenA, CaM, or RPB2) as well as concatenated sequence datasets (Fig. 5). The isolates including five new taxa were recognized in their respective clades based on the previously accepted GCPSR concept. Thus, the clade was present in all the single-locus topologies (ITS, BenA, CaM, and RPB2) and concatenated sequence datasets by applying genealogical concordance. In contrast, genealogical non-discordance (or discordance) was not observed as a clade must be well supported, as judged by BI and ML, by at least one single-locus genealogy and not contradicted in any other single-locus topology (Figs. 1, 2, 3, 4 and 5). Phylogenetic trees and DNA sequence alignment data were deposited in the TreeBASE repository and can be viewed in Study 29,646.

Fig. 1.

Phylogeny based on the ITS sequences for species classified in Penicillium spp. and Talaromyces spp. Bootstrap values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a BI of the same dataset, are indicated at well-supported nodes together with thickened branches. The scale bar represents the expected substitutions per site (0.03). Isolates belonging to the known species obtained in this study are in bold. Isolates of the new species described in this study are shown in bold red. Holotype labeled with an asterisk. The tree was rooted in three species of Talaromyces.“–” indicates a lack of support

Fig. 2.

Phylogeny based on the CaM sequences for species classified in Penicillium spp. and Talaromyces spp. Bootstrap values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a BI of the same dataset, are indicated at well-supported nodes together with thickened branches. The scale bar represents the expected substitutions per site (0.02). Isolates belonging to the known species obtained in this study are in bold. Isolates of the new species described in this study are shown in bold red. Holotype labeled with an asterisk. The tree was rooted in three species of Talaromyces.“–” indicates a lack of support

Fig. 3.

Phylogeny based on the BenA sequences for species classified in Penicillium spp. and Talaromyces spp. Bootstrap values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a BI of the same dataset, are indicated at well-supported nodes together with thickened branches. The scale bar represents the expected substitutions per site (0.03). Isolates belonging to the known species obtained in this study are in bold. Isolates of the new species described in this study are shown in bold red. Holotype labeled with an asterisk. The tree was rooted in three species of Talaromyces.“–” indicates a lack of support

Fig. 4.

Phylogeny based on the RPB2 sequences for species classified in Penicillium spp. and Talaromyces spp. Bootstrap values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a BI of the same dataset, are indicated at well-supported nodes together with thickened branches. The scale bar represents the expected substitutions per site (0.06). Isolates belonging to the known species obtained in this study are in bold. Isolates of the new species described in this study are shown in bold red. Holotype labeled with an asterisk. The tree was rooted in three species of Talaromyces.“–” indicates a lack of support

Fig. 5.

Phylogeny based on the combined CaM, BenA, and RPB2 data set for species classified in Penicillium spp. and Talaromyces spp. Bootstrap values (≥ 70%) of the ML analyses, as well as posterior probability scores (≥ 0.95) from a BI of the same dataset, are indicated at well-supported nodes together with thickened branches. The scale bar represents the expected substitutions per site (0.02). The isolates from known species obtained in this study are in bold. The new species’ isolates described in this study are in bold red. Holotype labeled with an asterisk. The Talaromyces spp. was chosen as an outgroup.“–” indicates a lack of support

The phylogenetic trees revealed the presence of 13 different Penicillium species, including the new taxa of Penicillium belonging to sections Citrina, Lanata-Divaricata, and Sclerotiora, and three different Talaromyces species endophytes of Hevea spp. All phylograms showed the biggest number of endophytic isolates phylogenetically close to Penicillium citrinum in section Citrina. Of the total number of endophytic fungi investigated (Figs. 1, 2, 3, 4 and 5), P. citrinum isolates were more abundant in the roots of H. guianensis and H. brasiliensis (202F8R–AC, 694F8R–AC, 752F8R–AC, 753F8R–AC, 755F8R–AC, 756F8R–AC, 798F8R–AC, 171F9R–AC, 689F9R–AC, 564F2R–AC, 360F5R–AC, 198F11R–AC, 524F11R–AC, 562F11R–AC, 624F12R–AC) and the roots of H. brasiliensis (298F4R–AM, 477F10R–AM). Penicillium citrinum is present, but in less abundance, in the leaves of H. brasiliensis (629F14F–AM, 287F18F–AM, 294F7F–AC, 211F7F–AC, 212F14F–AC) and the stems of H. brasiliensis (684F9C–AM, 174F20C–AM, 634F20C–AM, 767F20C–AM, 652F22C–AM) (Figs. 1, 2, 3, 4 and 5; Table 1).

Additionally, isolates from several closely related species from the Citrina section have been found. Three isolates (7F5R–AM, 637F5R–AM, and 667F7R–AM) from roots were phylogenetically close to Penicillium paxilli, Penicillium shearii and Penicillium steckii, respectively. The 197F3C-AC isolate (stems of H. guianensis) was phylogenetically close to P. sumatrense. Penicillium aquiri sp. nov. of the stems of H. brasiliensis and Penicillium acrean sp. nov., of the stems and roots of H. brasiliensis (Figs. 1, 2, 3, 4 and 5; Table 1).

The individual phylogenetic tree for the BenA, CaM, and RPB2 genes showed that isolates of Penicillium acrean sp. nov. and isolates of Penicillium aquiri sp. nov. are closely related to isolates of P. sumatrense; however, different clades, with high posterior probability value (> 0.95), high bootstrap percentage (> 70%) (Figs. 2, 3 and 4), and concatenated sequence datasets (Fig. 5), with the posterior probability and bootstrap values equal to 1 and 100, respectively, are proposed as new taxa. The isolate 197F3C–AC establishes phylogenetic relationships with Penicillium aquiri sp. nov. in a tree based on ITS, BenA, and CaM (Figs. 1, 2 and 3). It has formed an independent clade in the phylogenetic tree of the RPB2 (Fig. 4) and concatenated sequence datasets (Fig. 5), with the posterior probability and bootstrap values equal to 1 and 97, respectively. This isolate was kept as Penicillium sp. for a better future evaluation with the collection of more isolates.

In the section Lanata-Divaricata, has been grouped five endophytic isolates of H. brasiliensis, three of which, 507F5R-AM, Penicillium heveae sp. nov. and Penicillium amazoense sp. nov. are obtained from the roots, and one isolate of Penicillium amazonense sp. nov. from the stems. The isolate of Penicillium heveae sp. nov. was obtained from the stems of H. brasiliensis from Acre (Table 1). In the BI and ML trees, the Penicillium amazonense sp. nov. isolates established phylogenetic relationships with P. rolfsii, a relative to this species. However, the isolates Penicillium amazonense sp. nov., an independent clade formed in the individual phylogenetic tree for ITS, BenA, and CaM (Figs. 1, 2 and 3) and concatenated sequence datasets (Fig. 5), are proposed as a new taxon named here as Penicillium amazonense sp. nov.

Penicillium heveae sp. nov. isolates were grouped in a distinct clade and related to Penicillium globosum and Penicillium cataractum. The clade containing the new taxa was consistent and well-defined in the phylogenetic tree using ITS, BenA, CaM, and RPB2 sequences (Figs. 1, 2, 3 and 4) and concatenated sequence datasets (Fig. 5) clustered into one distinct clade that received high support within the section Lanata-Divaricata and named here as Penicillium heveae sp. nov. The isolate 507F5R–AM demonstrated a close relationship between isolates of Penicillium cataractum in the phylogenetic tree of the ITS, BenA, CaM, and RPB2 (Figs. 1, 2, 3 and 4) and concatenated sequence datasets (Fig. 5) and demonstrated high support. Thus, we chose to keep as Penicillium sp. for future morphological characterization of more isolates.

Four isolates were classified in the section Sclerotiora, all obtained from stems of H. brasiliensis. Two isolates, 213F5C–AC and 728F5C–AC, were closely related to Penicillium austrosinicum and Penicillium maximae determined by analysis of single-locus and concatenated sequence datasets. And, others two isolates of Penicillium pseudomellis sp. nov. establishes phylogenetic relationships with Penicillium mellis in all datasets analyzed (Figs. 1, 2, 3, 4 and 5; Table 1).

In the section Fasciculata, the isolates 37F27C–AM and 314F2C–AM, endophytic of H. brasiliensis, were closely related to Penicillium crustosum. As an outgroup, the isolates 86F10R–AM, 623F7R–AM, and 705F18F–AC were closely related to species Talaromyces siamensis, Talaromyces thailandensis, and Talaromyces amestolkiae, respectively, with a well-supported branch distinct from species already described (Figs. 1, 2, 3, 4 and 5). The T. siamensis and T. thailandensis isolates are endophytic to the root of H. brasiliensis, and the isolate T. amestolkiae is endophytic to the leaf of H. brasiliensis (Figs. 1, 2, 3, 4 and 5; Table 1).

The ITS region has poor discriminatory power in the sections described here. The sequences BenA, CaM, and RPB2 easily distinguish the new species, and the multi-locus analysis was robust and valuable for distinguishing among closely related species. We decided to retain some isolates, such as Penicillium sp., which could be the topic of future research to confirm species-level classification.

Taxonomy

Penicillium acrean K. S. Araujo, J. L. Alves & M. V. Queiroz, sp. nov. Figure 6.

Fig. 6.

Penicillium acrean sp. nov. from Hevea brasiliensis (VIC47584). a – d Seven-day-old cultures, 25 °C, left to right; first row, all obverse, CYA, MEA, YES, CREA; second row CYA reverse, MEA reverse, YES reverse, CREA reverse. e – f Colony appearances: YES: seven days, 25 ºC; and MEA: seven days, 25 ºC. g – i Conidiophores and phialides (MEA). j – k Conidia. Scale bars: a – d = 20 mm; e – f = 5 mm; g – i = 20 μm; j – k = 10 μm

MycoBank: MB845368.

Type: Brazil, Acre state, Chico Mendes reserve, coordinates 10°50'4" S / 68°23'12.7" W, isolated from H. brasiliensis on 26 July 2014 K.S. Araujo (holotype VIC47585, preserved as metabolically inactive culture; ex-type living culture COAD3463). Barcode sequences are deposited at GenBank under accession number: ITS = MT137535, BenA = MZ369096, CaM = MW972080, RPB2 = OK105117.

Etymology: Named after Acre, the state where the holotype was collected. The specific epithet “acrean” refers to the state of Acre, Brazil.

Description: Conidiophores monoverticillate; stipes smooth walled, 32–63 × 2.5–3 μm; phialides ampulliform, 3–7 per stipe, 8–11 × 2.5–3 μm; conidia smooth, globose to subglobose, 2–3 × 2.5–3 μm.

Culture characteristics: colony diameter after seven days (mm) at 25 °C: CYA 30–32; MEA 31–33; YES 35–37; OA 30–35; CREA 30–35; CYAS 38–40. CYA 30 °C 37–47. CYA 37 °C no growth. CYA, 25 °C: Colonies centrally circular, moderately deep; radially and concentric sulcate, dull green and in some sections red, velvety texture; margins entire, thin, sparse, and white; sporulation dense; soluble pigments absent; reverse lightly sulcate and radial, orange to red centrally, around pure yellow and in the edge a very thin, transparent and amber halo. CYA, 30 °C: Colonieslightly sulcate, glaucous blue-green to greenish grey; margins entire, dense, white; cottony texture; sporulation dense; soluble pigments absent; reverse pure yellow centrally and straw around. CYA, 37 °C, no growth. YES, 25 °C: Colonies centrally sunken, mycelia white to straw, radial and concentric sulcate, mixed mycelia dull green to olivaceous grey with straw; margin narrow and entire mycelia white; floccose texture; sporulation moderately dense; soluble pigments absent; reverse scarlet to red centrally, orange around and straw in the ends. OA, 25 °C: Colonies dull green; margins low, wide, and entire; cottony texture; sporulation dense; soluble pigments absent; reverse the entire buff. CREA, 25 °C: Colonies strong to moderate acid production. MEA, 25 °C: Colonies raised with aerial mycelia of velvety texture; radially sulcate, dull green; margins low, narrow, whole, white, in edge a very thin and transparent mycelia halo; sporulation dense; soluble pigments absent; reverse slight crimped, orange to scarlet centrally and margins straw to pure yellow.

Other materials examined: Brazil, Acre state, Rio Branco, a native reserve of Embrapa, coordinates 10°02’21.9” S / 67°40’46.2” W, isolated on 26 July 2014 K.S. Araujo (VIC47584, COAD3462).

Habitat and host range: endophytes in the stems (COAD3462) and roots (COAD3463) of living wild Hevea brasiliensis trees.

Notes: Penicillium acrean sp. nov. are closely related to isolates of Penicillium sumatrense, belonging to section Citrina, whose fungi are characterized by shared symmetrically biverticillate conidiophores, flask-shaped phialides, and conidial size and ornamentation. However, Penicillium acrean sp. nov. differs morphologically from the related species P. sumatrense by the majority of monoverticillate conidiophores (low proportion biverticillate), the smaller size of stipes; conidia smaller, smooth-walled, globose to subglobose while P. sumatrense showed stipes up to 200 μm long; conidia finely roughened walled, subglobose to broadly ellipsoidal (Table 4). Differences can also be verified in phenotypic characters, such as the colonies’ diameters, appearance, and color in different conditions and culture media. For example: On CREA at 25 °C, the new taxa showed a moderate growth rate (27–32 mm) and a moderate to strong production of acid compared, while the related species, P. sumatrense, was described with a slower growth rate (15–23 mm) and acid production absent (Fig. 6; Table 4).

Table 4.

Morphological differences of new taxa of Penicillium described as endophytes from Hevea spp. and closely related species

Features		Species
	P. acrean sp. nov. – VIC47584	P. aquiri sp. nov. – VIC47586	P. sumatrense – CBS281.36	P. heveae sp. nov. – VIC47589	P. globosum – CBS 144,639	P. pseudomellis sp. nov. – VIC49378	P. mellis – CBS 142,499	P. amazonense sp. nov. – VIC49381	P. rolfsii – CBS 368.48
Conidiophore (arranged)	monoverticillate with a low proportion biverticillate	biverticillate	biverticillate	majority divaricate with a low proportion biverticillate	mono- and biverticillate with a low proportion divaricate	Monoverticillate	Strictly Monoverticillate	Divaricate	Biverticillate
Stipes (length–width–µm)	32 – 63 × 2.5–3 μm	13 – 51 × 2–3 μm	up to 200 × 2–3 μm	127 – 355 × 2–3 μm	50 – 160 × 3–4 μm	117–163 × 2–3 μm	25 – 40 × 2–3.5 μm	72 – 247 × 2–3 μm	36 – 510 × 2.4–3.2 μm
Metulae per stipe/branch		2 – 3	3 – 6	3 – 5	3 – 4			2 – 5	2 – 5
Metulae (length–width–µm)		12 – 15 × 2.5–3 μm	10 – 16 × 2–3 μm	10 – 12 × 2–3 μm	7 – 20 × 3–4 μm			12 – 15 × 2.5–3 μm	8.8 – 12.8 × 2.4– 3.8
Phialide (shape)	ampulliform	ampulliform	ampulliform	ampulliform with short neck	ampulliform with short neck	ampulliform	ampulliform	ampulliform	ampulliform
Phialide per Stipe	3 – 7	4 – 8		4 – 8	3 – 19			3 – 8	3 – 9
Phialide (length–width–µm)	8 – 11 × 2.5–3 μm	9 – 11 × 2.5–3 μm	8 – 10 × 3–3.5 μm	7 – 11 × 2–3 μm	7 – 13 × 2–4 μm	6–10 × 2.5–3 μm	6.5 – 9 × 2–3 μm	8 – 11 × 2.5–3 μm	7.2 – 11.2 × 2.4– 3.8
Conidia (wall)	smooth	smooth	finelly roughened	smooth	smooth	rough-walled	smooth	smooth	smooth
Conidia (shape)	globose to subglobose	globose to subglobose	subglobose to broadly ellipsoidal	globose	globose to subglobose	subglobose	globose to subglobose	fusiform to ellipsoid	fusiform to ellipsoid
Conidia (length–width–µm)	2–3 × 2.5–3 μm	2–3 × 2.5–3 μm	3–4 × 2–4 μm	2–3 × 2.5–3 μm	3–4 × 2–4 μm	2–4 × 2.5–3 μm	2–3 μm (width)	2 – 4 × 2.5–3 μm	2.4 – 5.6 × 2–4 μm
Conditions	Colony on OA after 21 days (mm)
25 °C	30 – 35	30 – 36		26 – 28		35 – 38	24 – 25	50 – 55	45 – 50
	Colony on MEA after one week (mm)
25 °C	31 – 33	31 – 33	27 – 36	30 – 33	21 – 24	32 – 34	28 – 30	50 – 60	56 – 60
	Colony on CREA after 7 days (mm)
25 °C	30 – 34.5	25.5 – 29	15 – 23	23 – 36	17 – 20	13 – 15	10 – 11	27 – 32	30 – 31
	Colony on YES after 7 days (mm)
25 °C	35 – 37	31 – 33	26 – 47	38.5 – 42.5	17 – 19	32 – 34	34 –36	55 – 60	65 – 70
	Colony on CYAs after 7 days (mm)
25 °C	38 – 40	37.5 – 39.5	0.9 – 1.1	29.5 – 35	14 – 15	30 – 32	26 – 27	43.5 – 53	40 – 41
	Colony on CYA after 7 days (mm)
25 °C	30 – 32	23 – 25	33 – 42	30 – 33	21 – 22	28 – 30	29 – 30	52 – 56	52 – 60
30 °C	37 – 46.5	27 – 27.5	10 – 25	33 – 41	27 – 37	29 – 31	33 – 35	38 – 42	65 – 70
37 °C	no growth	no growth	no growth	no growth	3 – 7	no growth	2 – 4	20 – 29	43 – 45

Penicillium aquiri K. S. Araujo, J. L. Alves & M. V. Queiroz, sp. nov. Figure 7.

Fig. 7.

Penicillium aquiri sp. nov. from Hevea brasiliensis (VIC47586). a – d Seven-day- old cultures, 25 °C, left to right; first row, all obverse, CYA, MEA, YES, CREA; second row CYA reverse, MEA reverse, YES reverse, CREA reverse. e – f colony appearances: YES: seven days, 25 ºC; and MEA: seven days, 25 ºC. g – i Conidiophores and phialides (MEA). j Conidia. K Cluster of conidia. Scale bars: a – d = 20 mm; e – f = 10 mm; g – i = 20 μm; j – k = 10 μm

MycoBank: MB845369.

Type: Brazil. Acre state, Chico Mendes reserve, coordinates 10°50'00.7" S / 68°23'12.7" W, isolated on July 2014 K.S. Araujo (holotype VIC47586, preserved as metabolically inactive culture; ex-type living culture COAD3464). Barcode sequences are deposited at GenBank under accession numbers: ITS = MT137536, BenA = MZ369093, CaM = MW972077, RPB2 = OK073979.

Etymology: Named after Acre, the state where the holotype was collected. The name Acre originated from the word “Aquiri”, present in the native language of the Apurinã Indians, the region’s original inhabitants.

Description: Conidiophores biverticillate; stipes smooth walls, 13–51 × 2–3 μm; metulae 2–3 per stipe, 12–15 × 2.5–3 μm; phialides ampuliform, 4 – 8 per stipe, 9–11 × 2.5–3 μm; conidia smooth walled, globose to subglobose, 2–3 × 2.5–3 μm.

Culture characteristics in culture: colony diameter, after seven days, in mm at 25 °C: CYA 23–25; MEA 31–33; YES 31–33; OA 30–36; CREA 26–29; CYAS 38–40. CYA 30 °C 27–28. CYA 37 °C no growth. CYA, 25 °C: Colonies centrally raised and velvety greyish blue-green to olivaceous grey, followed by few sulcate radiations dull green; margins flat, entire, olivaceous grey and velvety texture; halo flat and white; sporulation dense; soluble pigments absent; reverse centrally slightly crimped and with well-marked halo and irregular radiations, straw to sulfur yellow and pale-yellow edges. CYA, 30 °C: Colonies sulcate centrally, greenish grey; margins low and sparse; mycelia white; velvety texture; sporulation dense; soluble pigments absent; reverse slightly crimped, straw to sulfur yellow and white in the ends. YES, 25 °C: Colonies with a cavity in the center, crimped sulcate, olivaceous grey to greenish grey, floccose texture; margins flat and thin, white; sporulation dense; soluble pigments absent; reverse straw, and the center is sulfur yellow. CREA, 25 °C: Colonies no acid produced. MEA, 25 °C: Colonies moderately deep at center, raised aerial mycelia around this central cavity, radially sulcate, mycelia in the center and intermediate zone grayish green; margins low, whole, white, velvety texture; sporulation dense; soluble pigments absent; reverse radially and concentric rings, the center raised, beige to yellow.

Other materials examined: Brazil, Acre state, Cruzeiro do Sul, coordinates: 7°44'04.7" S / 72°49'43.7" W, isolated on 26 July 2014 K.S. Araujo (VIC47587, COAD3465). Brazil. State of Acre, Sena Madureira, coordinates: 9°08'01.7" S/68°57'04.7"W, isolated on 26 July 2014 K.S. Araujo (VIC47588, COAD3466).

Habitat and host range: endophytes in the stems of living wild Hevea brasiliensis trees.

Notes: Penicillium aquiri sp. nov. showed a moderate to dense sporulation at all culturable media. The radial growth rate on CYA was 23–25 mm at 25 °C and soluble pigments absent, while Penicillium sumatrense showed a fast growth rate (33–34 mm), soluble pigments in most isolates; however, in some isolates, weakly produced and light brown colored. On CYA at 30 °C, P. aquiri sp. nov. showed a larger growth (27–28 mm) than P. sumatrense (10–25 mm). The colonies of P. sumatrense on CYA 30 °C reverse show beige to beige brown compared to new taxa, whose reverse is straw to sulfur yellow and has a brown center halo [52]. Penicillium aquiri sp. nov. colony showed a fast growth rate (44–53 mm) on CYAS at 25 °C while P. sumatrense showed a limited growth rate (0.9–1.1 mm). On CREA at 25 °C, the new taxa have moderate growth (27–32 mm) and moderate to strong acid production compared to related species, P. sumatrense, with slow growth (15–23 mm) and acid production absent. On YES at 25 °C, Penicillium aquiri sp. nov. has fast growth (55–60 mm). The related species already mentioned also has fast growth (26–47 mm); however, it is different in appearance and color of the colony, with radially sulcate mycelium inconspicuous and dull green. Reverse sulcate, yellow. Penicillium aquiri sp. nov. on MEA at 25 °C showed a fast growth rate (45–50 mm) compared to P. sumatrense, which had a slower growth rate (27–36 mm), and is different in appearance and color to the new taxa [53]. Micromorphological characters: P. aquiri sp. nov. showed smaller stipes; conidia smaller, smooth-walled, globose to subglobose, while P. sumatrense showed stipes up to 200 μm long; conidia finely roughened walled, subglobose to broadly ellipsoidal (Fig. 7; Table 4).

Penicillium amazonense K. S. Araujo, J. L. Alves & M. V. Queiroz, sp. nov. Figure 8.

Fig. 8.

Penicillium amazonense sp. nov. from Hevea brasiliensis (VIC 49381). a – d Seven-day-old cultures, 25 °C, left to right; first row, all obverse, CYA, MEA, YES, CREA; second row CYA reverse, MEA reverse, YES reverse, CREA reverse. e – f Colony appearances: MEA: seven days, 25 ºC; and YES: seven days, 25 ºC. In MEA: g – h Stipes. i Hyphae anastomosis. j A cluster of stipes. K Conidia. l A cluster of conidia. Scale bars: a – d = 20 mm; e – f = 10 mm; g – i = 20 μm; j – l = 10 μm

MycoBank: MB845612.

Type: Brazil. Amazonas state, Itacoatiara, coordinates 03°02'37.6" S / 058°30'11.8" W, isolated on 26 July 2014 K.S. Araujo (holotype: VIC49381, preserved as metabolically inactive culture; ex-type living culture COAD3476). Barcode sequences are deposited at GenBank under accession number: ITS = MT140343, BenA = MW820833, CaM = MW820831, RPB2 = OK087392.

Etymology: Named after Amazonas, the state where the holotype was collected. The specific epithet “amazonense” refers to the state of Amazonas, Brazil.

Description: Conidiophores divaricate; stipes lightly roughed walls, 72–247 × 2–3 μm; metulae 2–5 per stipe, 12–15 × 2.5–3 μm; phialides ampulliform with short neck, 4–8 per stipe, 8–11 × 2.5–3 μm; conidia smooth walled, fusiform to ellipsoidal, 2–4 × 2.5–3 μm.

Culture characteristics: colony diameter, after seven days, in mm at 25 °C: CYA 52–56; MEA 50–60; YES 55–60; OA 50–55; CREA 27–32; CYAS 44–53. CYA 30 °C 38–42. CYA 37 °C 20–29. CYA, 25 °C: Colonies centrally olivaceous grey, pulvinate texture; around mycelia mixed sulfur yellow and olivaceous grey, radiate and sulcate; margins with mycelia white, flat, cottony texture; sporulation dense; soluble pigments absent; reverse slightly crimped, light orange to pure yellow. CYA, 30 °C: Colonies sulcate centrally, olivaceous buff to smoke grey, texture pulvinate; margins low and sparse; sporulation dense; soluble pigments absent. YES, 25 °C: Colonies growing crateriform, mycelia glaucous blue-green to greenish grey; texture velvety; sporulation dense; soluble pigments absent; reverse crateriform, light orange to pure yellow in the ends. CREA, 25 °C: Colonies no acid produced. MEA, 25 °C: Colonies mixed sulcate and concentric areas, mycelia greenish yellow-green with glaucous blue-green; texture velvety; sporulation dense; soluble pigments absent; the reverse is slightly crimped, orange centrally and pure yellow in ends.

Other materials examined: Brazil, Amazonas state, Itacoatiara, coordinates 03°08'58.9" S / 058°26'16.8" W, isolated on 26 July 2014 K.S. Araujo (VIC49382, COAD3477).

Habitat and host range: endophytes in the stems (COAD3476) and roots (COAD3477) of living wild Hevea brasiliensis trees.

Notes: Penicillium rolfsii is a closely related species to the new taxa proposed here. Penicillium rolfsii produce terminal biverticillate conidiophores with rough-walled stipes. Colony growth rates and conidial shapes are most useful for distinguishing among the species in this clade and grow well on CYA at 37 °C, compared to the generally poor growth observed for other species in the clade, such as Penicillium amazonense sp. nov. [26]. Additionally, the new taxa differ by majority production of conidiophore divaricate (Fig. 8; Table 4).

Penicillium heveae K. S. Araujo, J. L. Alves & M. V. Queiroz, sp. nov. Figure 9.

Fig. 9.

Penicillium heveae sp. nov. from Hevea brasiliensis (VIC47589). a – d Seven-day-old cultures, 25 °C, left to right; first row, all obverse, CYA, MEA, YES, CREA; second row CYA reverse, MEA reverse, YES reverse, CREA reverse. e – d Colony appearances: YES: seven days, 25 ºC; and MEA: seven days, 25 ºC. g – i Conidiophores and phialides (MEA). j Conidia. K Cluster of conidia. Scale bars: a – d = 20 mm; e – f = 10 mm; g – i = 20 μm; j = 10 μm; k = 5 μm

MycoBank: MB845367.

Type: Brazil. Amazonas state, Itacoatiara, hydrographic basin, coordinates 03°24'34.00" S / 058°29'18.3" W, isolated on 26 July 2014 K.S. Araujo (holotype VIC47589, preserved as metabolically inactive culture; ex-type culture COAD3467). Barcode sequences are deposited at GenBank under accession number: ITS = MG751217, BenA = MW928622, CaM = MW928617, RPB2 = OK087394.

Etymology: Named after Heveae, the host where the holotype was collected.

Description: Conidiophores majority divaricate and occasionally biverticillate; stipes smooth walled, 127–355 × 2–3 μm; metulae, 3–5 per verticil, 10–12 × 2–3 μm; phialides ampulliform with a short neck, 4–8 per stipe, 7–11 × 2–3 μm; conidia smooth walled, globose, 2–3 × 2.5–3 μm.

Culture characteristics: colony diameter, after seven days, in mm at 25 °C: CYA 30–33; MEA 30–33; YES 39–43; OA 35–40; CREA 23–36; CYAS 30–35. CYA 30 °C 33–41. CYA 37 °C no growth. CYA, 25 °C: Colonies centrally deep and around it an elevated ring, and in the intermediate zone, moderately furrowed growth, glaucous grey to greenish grey and some areas of elevated mycelium white to grayish; velvety texture; margins low, wide, whole, white; sporulation dense; soluble pigments absent; reverse sulfur yellow. CYA 30 °C: Colonies deep, and crater sulcate, greenish grey to olivaceous grey centrally and white around; margin low, narrow and sparse, mycelia white; sporulation dense; velvety texture in the center and floccose at margins; reverse sulfur yellow and buff in the ends. CYA 37 °C: no growth. YES, 25 °C: Colonies crimped sulcate, pistachio green to glaucous with some stretches of white mycelium; velvety texture; sporulation moderately dense; soluble pigments absent; sporulation dense; irregular margins, flat and white; reverse crimped, sulfur yellow, margins with flat and white mycelium. CREA, 25 °C: little to moderate acid produced. MEA 25 °C: Colonies mixed highly convex–flat in centers, mixed mycelia olivaceous grey–white; cottony texture; sporulation dense; soluble pigments absent; margins low, wide, and entire, mixed pale olivaceous grey–white; reverse radial mixed convex–flat, sulfur yellow and a very thin and transparent mycelium halo in the edge.

Other materials examined: Brazil, Acre state, Sena Madureira, hydrographic basin, coordinates 9°08'01.7" S / 68°57'04.7" W, isolated on 26 July 2014 K.S. Araujo (COAD 3468, VIC 47590).

Habitat and host range: endophytes in the leaves (COAD3468) and roots (COAD3467) of living wild Hevea brasiliensis trees.

Notes: Penicillium heveae sp. nov. are closely related to isolates of Penicillium globosum and Penicillium cataractum. In this section, the isolates are marked by producing terminally biverticillate conidiophores with rough walls [27]. The new taxa produce mostly divaricate conidiophores on MEA. Conidiophores of P. heveae are larger in length, and smaller in width in contrast to the conidiophores of P. globosum. Penicillium heveae showed the faster colony growth rate on both media: MEA at 25 °C (30–33 mm vs. 21–24 mm), YES at 25 °C (39–43 mm vs. 17–19 mm), CREA at 25 °C (23–36 mm vs. 17–20 mm), CYA at 25 °C (30–33 mm vs. 21–22 mm), CYA at 30 °C (33–41 mm vs. 27–37 mm), CYAs at 25 °C (30–35 mm vs. 14–15 mm), than P. globosum. CYA at 37 °C showed no growth while P. globosum was 3–7 mm (Fig. 9; Table 4).

Penicillium pseudomellis K. S. Araujo, J. L. Alves & M. V. Queiroz, sp. nov. Figure 10.

Fig. 10.

Penicillium pseudomellis sp. nov. from Hevea brasiliensis (VIC49378). a – d Seven-day-old cultures, 25 °C, left to right; first row, all obverse, CYA, MEA, YES, CREA; second row CYA reverse, MEA reverse, YES reverse, CREA reverse. e – f colony appearances: MEA: seven days, 25 ºC; and YES: seven days, 25 ºC. g – i Conidiophores and phialides (MEA). j The apex of stipes and conidia. K Cluster of conidia. Scale bars: a – d = 20 mm; e – f = 10 mm; g – i = 20 μm; j – k = 10 μm

MycoBank MB845726.

Type: Brazil. Amazonas state, Itacoatiara, coordinates 03°02'40.4" S / 058°30'09.7" W, isolated on 26 July K.S. Araujo (holotype: VIC49381). Ex-type living culture COAD3474. Barcode sequences are deposited at GenBank under accession number: ITS = MT751237, BenA = MW820837, CaM = MW820835, RPB2 = MW820838.

Etymology: indicating its phylogenetic proximity to P. mellis.

Description: Conidiophores divaricate; stipes smooth walls, 117–163 × 2–3 μm; metulae 2–5 per stipe, 15–27 × 5–8 μm; phialides navicular to ampulliform with a short neck, 4–6 per stipe, 6–10 × 2.5–3 μm; conidia smooth, globose, 2–4 × 2.5–3 μm.

Culture characteristics: colony diameter, after seven days, in mm at 25 °C: CYA 28–30; MEA 32–34; YES 32–34; OA 35–38; CREA 13–15; CYAS 33–36. CYA 30 °C 29–31. CYA 37 °C 5–7. CYA, 25 °C: Colonies centrally raised, irregular, velvety texture; around lightly sulcate, radial mixed pale olivaceous grey–white; margins flat, entire, white; sporulation dense; soluble pigments absent; reverse centrally slightly convex, concentric, straw, around sulfur yellow to pale yellow edges. CYA, 30 °C: Colonies sulcate centrally, around radial sulcate, glaucous blue–green to greenish grey; sporulation dense; soluble pigments absent; margins flat and sparse, mycelia white, velvety texture; reverse slightly radial crimped, straw to sulfur yellow and white in the ends. YES, 25 °C: Colonies raised in the center, crimped sulcate, pale olivaceous grey to greenish grey, velvety texture; margins flat and thin, lightly sulcate white; sporulation dense; soluble pigments absent; reverse irregularly sulcate, sulfur yellow to pure yellow. CREA, 25 °C: little acid produced. MEA, 25 ° C: Colonies lightly raised, with several small holes, grayish white, low, narrow, whole, white at the center, radially and concentrically sulcate and cottony texture, abundant sporulation, in the ends a very thin halo, transparent; reverse, concentric and radiate growth, pale yellow and yellowish to orangish brown at the border.

Other materials examined: Brazil, Amazonas state, Itacoatiara, coordinates 03°02'40.4" S / 058°30'09.7" W, isolated on 26 July by K.S. Araujo (VIC49382, COAD3477).

Habitat and host range: endophytes in the stems of living wild Hevea brasiliensis trees.

Notes: Penicillium pseudomellis sp. nov. is a phylogenetically distinct species. It is distinguished from other members of the section Sclerotiora, such as Penicillium mellis [54] by not observing to produce sclerotia on CYA, MEA, and OA. Regarding micromorphology, the new taxa had larger stipes, whereas P. mellis had smaller stipes [55] (Fig. 10; Table 4).

Discussion

Penicillium and Taloromyces are well-known cosmopolitan filamentous genera found in food, air, soil, and other substrates. Most play various roles in natural ecosystems, agriculture, and biotechnology, and reporting novel occurrences and new endophytic species may be crucial. Penicillium species, particularly endophytes, have been the subject of numerous studies to describe new antimicrobial compounds and other biological functions for agricultural, biotechnological, and pharmaceutical applications [14].

In [56], Pitt and Samson published a list of names in use for the Trichocomaceae family. Later, the list was updated, and this version contained all recognized species and their synonyms [57]; most listed species belonged to the Penicillium and Aspergillus genera. Updating these lists would be needed because there have been several modifications since the list is from the 2000s. The primary reason for changes was the transition from a dual to a single-name naming system, which resulted in changes to several teleomorph genera. In the twenty-first century, new perspectives for the taxonomy of Penicillium and Talaromyces have been described. The sections accepted in Penicillium were studied using a polyphasic approach or multigene phylogenies [24, 58–60]; and species classified in the Talaromyces section were described [60, 61].

This study’s 47 different isolates of Penicillium are endophytic of the rubber tree native to the Brazilian Amazon Forest (Table 1), isolated from leaves, stems, and roots. Like many other Eurotiales species, Penicillium can be distinguished based on morphological features and growth temperature [23]. The five new taxa were identified and characterized based on morphological and molecular analysis, and the other species depict new occurrences for Hevea spp. Although species of the genus Penicillium have clearly defined morphological traits, and their name derives from the fact that they resemble a “small paint-brush” [62], the molecular identification of species of the genus Penicillium has proven a useful tool and that is currently in widespread usage. Phylogenetic analyses were carried out using primer pair sequences (ITS, BenA, CaM, and RPB2) to investigate the relationships among the endophytic fungi of the genus Penicillium isolated from rubber trees, and Penicillium spp. were included in sections Lanata-Divaricata, Citrina, Fasciculata, and Sclerotiora.

The BenA gene is often used as a secondary barcode sequence to identify Penicillium at the species level since it is a region easily amplified and can distinguish closely related species [23, 63]. Other secondary barcodes that can be auxiliary in identifying Penicillium isolates at the species level are the CaM and RPB2 genes. Several researchers suggest using single and multilocus analysis with datasets including ITS, BenA, CaM, and RPB2 to identify new species [23, 24].

The isolates from the section Citrina were the most representative (72%), with 36 isolates, being P. citrinum (27), identified by single and multi-locus molecular datasets. Penicillium citrinum is frequently reported in the literature as an endophytic species [64–66]. Several applications of the endophytic P. citrinum have been extensively studied, such as plant growth promotion [67], the pharmacological activity of polyketides [68, 69] and the development of antibacterial and antiviral drugs [14, 70]. In studies performed by Gazis and Chaverri [5], 33 fungi belonging to the genus Penicillium were obtained. However, P. citrinum was not isolated from the leaves and stems of rubber trees in Peru. P. citrinum has been collected in studies of the diversity of endophytic fungi on Vellozia gigante, an endemic plant to rupestrian fields in Brazil [65]. The hosts’ geographic position and interspecific competition of fungi most likely contributed to identifying different Penicillium species amongst the rubber trees in Brazil and Peru; this indicates our contribution in describing new occurrences of this endophytic species in Hevea spp.

Penicillium acrean sp. nov. and Penicillium aquiri sp. nov. were described in section Citrina according to the results shown in the phylogenetics trees obtained by BI and ML analysis (Figs. 1, 2, 3, 4 and 5) along with morphological characterization shown in the Taxonomy section (Figs. 6 and 7, respectively). Houbraken et al. [53] used a combined dataset of BenA, CaM, RPB2, and ITS sequences to analyze more than 250 isolates in connection to the species of Penicillium section Citrina. They asserted that the species Penicillium of the section Citrina share the production of symmetrically biverticillate conidiophores, flask-shaped phialides, with 7–9 μm long and relatively small conidia (2–3 μm). They also mention that the phenotypic characteristics for differentiating species are relevant, such as growth rates, colors, and colony appearance on the agar media CYA, MEA, and YES. Penicillium aquiri sp. nov. and P. acrean share with P. sumatrense the inability to grow at 37 °C.

This new species in the section Citrina shares phenotypic characteristics of the species of the section Citrina. It is necessary to emphasize that they differ from P. sumatrense in the size of conidiophores, the conidia characteristics, and the appearance and color of the colonies of the culture media used for evaluation according to what is described in the section Taxonomy and Figs. 6 and 7. Penicillium sumatrense has a worldwide distribution, preferentially for subtropical regions. Its main habitat is soil, and it has also been isolated from marine environments [71]; besides being an endophyte of several hosts, such as Garcinia multiflora, where it produces metabolites with promising antioxidant, antimicrobial and anticancer biological activities [72]. Furthermore, Penicillium sumatrense was first reported in China as causing a serious Blue Mold on Sparasis crispa, and it is considered a commercial threat to mushrooms [73].

The genus Talaromyces was first described by Benjamin (1955) as a teleomorph known for producing soft, yellow ascomata made of intertwined hyphae [61]. Several species from Penicillium were transferred into Talaromyces following the single name nomenclature [74] and by recent studies on an overview of the order Eurotiales [24]. Talaromyces spp. were accommodated in a monophyletic clade and separated from the Penicillium spp. clades in all phylogenetic trees. Species of this genus possess a wide distribution and were recently reported as an endophyte endemic to the Brazilian tropical dry forest, with the potential to produce bioactive compounds [75]. In our study, three isolates (86F10R–AM; 623F7R–AM, and 705F18F–AC) obtained from roots and leaves on H. brasiliensis were phylogenetically close to T. siamensis, T. thailandensis, and T. amestolkiae, respectively. The ITS barcodes could reliably separate Penicillium and Talaromyces. The secondary genes (BenA, CaM, and RPB2) were complementary and important for taxon identification, clearly delineated the same topologies, and can be used for identifying species within these genera.

Section Lanata-Divaricata is a wide section in Penicillium and was described by numerous investigations [26, 27, 30, 52]. Penicillium rolfsii was already described as endophytic in several plants, such as papaya [76]. Interestingly, this study obtained two isolates of Penicillium amazonense close to P. rolfsii and are proposed here as new taxa. Curiously, all documented species of the Lanata-Divaricata section are either acid-preferential or acid-tolerant, including P. globosum, which was collected and first described by Diao et al. [30] from a diversity of acidic soils (pH 4–6.5) in China. Additional materials were obtained from different continents, most collected from soils, but the species P. globosum has not yet been described as endophytic. Most of the species in this section grow quickly and form widely spread colonies, with the production of strongly divaricate and monoverticilate conidiophores [52], or the isolates are marked by producing terminally biverticillate conidiophores which are rough walled [27, 30]. The new species related to this clade displayed similar characteristics, including the size and color of the conidia and conidiophore (Table 4). Penicillium heveae sp. nov. is distinguished from P. globosum by differences in the arrangement of conidiophores and the shape of conidia, and is thus, described as a new taxon.

The screening of several fungal endophytes from Ginkgo biloba, a native plant from China, showed Penicillium cataractum displaying strong activity with the isolation of four new compounds exhibiting potency against bacterial pathogens [77]. The isolate 507F5R-AM obtained in this study was phylogenetically close to P. cataractum, and it is the first report of an endophyte of H. brasiliensis in Brazil.

Endophytes of the genus Penicillium (section Fasciculata), for example, Penicillium chrysogenum and Penicillium crustosum, were assessed for biotechnological purposes and by their plant growth promotion capability [7]. The isolates 37F27C-AM and 314F2C-AM obtained in this study were phylogenetically close to P. crustosum. For the first time, P. crustosum is identified as an endophyte of H. brasiliensis, and further research into its secondary metabolites may be useful for science and biotechnological purpose.

Hevea brasiliensis and H. guianensis harbor a wide diversity of endophytic Penicillium and Talaromyces species in their tissues. Our results highlight the presence of miscellaneous endophytic species of the genus Penicillium (P. citrinum, P. cataractum, P. rolfsii, P. mellis, P. paxilli and P. shearii) as well as five new endophytic species (P. acrean sp. nov., P. aquiri sp. nov. P. amazonense sp. nov., P. heveae sp. nov., and P. pseudomellis sp. nov.) in H. brasiliensis, a native of the Amazon Forest. This description of five new taxa of Penicillium section Citrina, Lanata-Divaricata, and Sclerotiora as endophytes add to our fungal biodiversity knowledge in native rubber trees. Additional studies on the production of extracellular enzymes and antimicrobial compounds can be carried out since Penicillium spp. produces bioactive molecules for drug development against neglected tropical diseases. The isolation and identification of endophytic fungi in tropical plants have revealed species with potential for use in the biocontrol of these diseases in rubber trees, and the ability of the new Penicillium species identified in this study to promote the growth of plants and control phytopathogens are being investigated. In addition, transformants expressing fluorescent proteins are being using to monitor root colonization by new species. In the future, it will be determinate whether these new species benefit their host and whether they can be used as a bioproduct.

Author contributions

MVdQ supervised the execution, and reviewed and edited the manuscript; KSA collected the material, isolation, preservation of fungal isolates; DNA extraction, PCR, gene sequencing, phylogenetic analysis, contributed to morphological characterization and wrote the initial draft of the publication; JLA contributed to the holotype deposits in the herbarium (VIC) and culture (COAD) collections, editing of images and tables, sequence deposits in databases (Genbank and treebase), as well as contributed to morphological and molecular characterization (phylogenetic analysis) and written updates to the initial draft of the publication. KSA, OLP, and JLA analyzed the results of the bioinformatics analysis and general data analysis; All authors have given their approval to this version of the manuscript.

Funding

This research was supported by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) – Finance Code 001, the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and the Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG) for financing the project and granting the scholarships.

Data availability

The biological reference material was deposited and available in official collections and DNA sequences at GenBank. Code availability Not applicable.

Declarations

Ethical approval

Not applicable.

Consent to participate

Not applicable.

Competing interest

The authors declare that there are no conflicts of interest.