Bioefficacy and molecular characterization of Bacillus thuringiensis strain NBAIR BtGa against greater wax moth, Galleria mellonella L.

Abstract

Galleria mellonella, the greater wax moth has always been an important pest against honeybees and has remained a nightmare for beekeeping farmers. Management of G. mellonella in live honeybee colonies is very difficult because most current management practices can destroy whole honeybee colonies. In the present study, experiments were conducted to isolate and characterize Bacillus thuringiensis from infected greater wax moth cadavers and to evaluate their biocontrol ability against G. mellonella. The bioefficacy of these isolates has been evaluated against greater wax moth along with the standard strain HD-1. Among all the strains tested, NBAIR BtGa demonstrated higher efficacy compared to other strains, with an LC₅₀ value of 125.17 µg/ml, whereas HD-1 exhibited a significantly higher LC₅₀ value of 946.61 µg/ml. Considering the economic importance of NBAIR BtGa we performed whole genome sequencing of this strain resulting in the identification of a genome size of 5.96 Mb consisting of 6888 protein-coding genes. Gene ontology analysis categorized these genes into three groups based on their roles, i.e., biological functions (2169 genes), cellular components (1900 genes), and molecular functions (2774 genes). Through insecticidal toxicity-related genes (ITRG) profiling of our strain across the genome by Bt toxin scanner and cry processor resulted in the identification of several Cry proteins namely Cry1Ab11, Cry1Ia44, Cry1Aa2, Cry2Af1, Cry1Da2, Cry1Eb1, Cry1Ab5, Cry1Cb2, Cry1Ac2. Besides Cry proteins, other ITRG genes, viz. Vip3Bb2, Zwittermicin A resistance proteins, Chitinase C, Mpp46Ab1, immune inhibitor A, Bmp1, Vpb4Ca1, and Spp1Aa1 were also reported, which show toxicity against lepidopteran pests. The studies were also conducted to test the biosafety of Bt toxins against honeybee larvae and adults, which showed strain NBAIR BtGa was more than 99% safer for honeybee larvae as well as adults. Thus, the data generated ascertains its effectiveness as a biocontrol agent and it can be used further for the development of bio formulation for the management of G. mellonella in honeybee colonies.

Introduction

Beekeeping is a forest-based, agro-horticultural industry that is very important to farmers since it helps with pollination. Agricultural crop pollination is a crucial environmental service provided by bees. Major challenging pests in beekeeping are ants, termites, beetles, wasps, and moths. Among all pests, moths specifically the greater wax moth (GWM), Galleria mellonella L. (Pyralidae: Lepidoptera), is the most disastrous insect pest in beekeeping. It penetrates the midrib of the honeybee comb by tunneling into the edge of open cells with pollen, bee brood, and honey. Because of the bee brood disturbance and the rise in the temperature of the brood the colonies will eventually be deserted [1]. Chemical insecticides have provided good control of many insect pests in agriculture however the indiscriminate use of insecticides has made the environment unsound and led to several problems such as insect pest resistance, outbreak of secondary pests, adverse effects on non-target organisms, toxic insecticide residues, and direct hazards to the users [2]. In beekeeping pest control, using microbial pesticides has proven to be an available and effective alternative, Bacillus thuringiensis (Bt) stands out as the predominant and widely employed subcategory within the realm of biopesticides. Its remarkable efficacy and cost-effectiveness make it the preferred choice for combating wax moth through eco-friendly biological control strategies. Various formulations of Bt have proven to be exceptionally effective in managing wax moth infestations, offering a sustainable and environmentally friendly alternative to conventional chemical pesticides. [3]. The B. thuringiensis primarily exerts its insecticidal effects through Cry proteins, also known as delta endotoxins [4], additional compounds such as proteases, heat-sensitive and heat-tolerant exotoxins, phospholipases, lectinases, secreted vegetative insecticidal proteins (Vips), and chitinase also contribute to its insecticidal activity [5–6]. Given the broad susceptibility of many insects to these toxins, B. thuringiensis is a potent tool for pest control. Therefore, the present study aimed to isolate and characterize B. thuringiensis from GWM cadavers, evaluate its efficacy against wax moth, and understand the molecular mechanisms underlying the effectiveness of strain NBAIR BtGa in GWM management.

Materials and methods

Isolation and characterization of B. thuringiensis

A total of ten B. thuringiensis isolates were isolated from cadavers of G. mellonella using the modified method of Travers et al. [7]. Larvae were surface sterilized using 70% ethanol, followed by transferring into a 1.5 ml Eppendorf tube, subsequently, 100 µl of phosphate-buffered saline was added, and each larva was crushed using a micropestle. The resulting suspension was incubated at 80 °C for 3 h to eliminate vegetative cells and non-spore forming bacteria. After serial dilution, the suspensions were spread onto Luria Bertini agar Petri plates. These plates were then incubated at 32 °C for 24 h in a B.O.D. incubator (Scientek India Private Limited, Bengaluru, India) to promote the growth of bacterial cultures.

Furthermore, Gram and endospore staining was done for morphological characterization. The presence of parasporal crystals was observed using a light microscope (Olympus BX41, Microscope Central, Pennsylvania, USA) at 100X with oil immersion. Molecular confirmation was achieved through validating 16 S rRNA amplification via PCR, followed by Sanger sequencing which after confirmation by BLASTn, were subsequently submitted in the NCBI GenBank for obtaining accession numbers. The standard B. thuringiensis var. kurstaki HD-1 was obtained from Bacillus Genetic Stock Centre (Columbus, Ohio) in lyophilized form, and the same has been sub-cultured using LB broth using standard procedure as described earlier.

Bioassay of B. thuringiensis isolates against G. mellonella

A total of ten B. thuringiensis isolates viz., NBAIR BtGa, BtHGa1a, BtHGa1c, BtHGa1d, BtHGa1e, BtHGa1f, BtHGa2a, BtHGa2b, BtHGa2c, BtHGa2d, and standard HD-1 were screened against GWM. The amount of crude protein present in B. thuringiensis isolates was estimated by Lowry’s standard protocol [8]. To test the efficacy of these isolates, the spore-crystal mixtures of all the isolates were prepared as described by Nayimabhanu (2010) [9]. One ml of a spore-crystal mixture (containing 1 × 10⁹ viable spores/ml) of each isolate was mixed thoroughly with four grams of artificial diet [10]. Each treatment, consisting of twenty-five larvae, was replicated five times. One ml of distilled water mixed with 4 g of artificial diet was used as the control. Mortality data was recorded for nine days (same as the time for assessing the mortality of GWM), and the efficacy of bacterial isolates was measured in terms of percentage mortality. Additionally, symptoms observed on larvae fed with an artificial diet containing toxins were verified by Koch’s postulates to confirm that mortality resulted from the B. thuringiensis toxin. The corrected percent mortality was calculated by using Abbot’s formula [11], which is as follows: Corrected mortality (%) =[(X-Y)/X]x100, where X = percent of live insects in control and Y = percent of live insects in treatment.

Whole genome sequencing of B. thuringiensis NBAIR BtGa

Based on the bioassay, the most effective strain i.e., NBAIR-Bt Ga was taken for whole genome sequencing (WGS) to study its genome composition. For this DNA was isolated using DNeasy Blood and Tissue Kit following the manufacturer’s protocol (Qiagen, Austin, Texas, USA), and WGS using the Illumina TruSeq method was performed using the facilities of Eurofins India Pvt. Limited, Bengaluru. DNA library preparation involved a 2 × 150 NextSeq500 prep kit. To ensure high-quality data, Trimmomatic v0.38 [12] was used for clean reads, followed by de novo genome assembly using SPAdes assembler (v-3.13.0) [13], and GFinisher for refining the genome. Gene annotation was performed with Prokka (version 1.12) [14] while the Diamond tool [15] facilitated functional annotation of genes. Gene ontology analysis was conducted via the Blast2GO platform and pathway analysis was carried out using the KEGG automatic annotation server (http://www.genome.jp/kegg/ko.html).

Insecticidal toxicity related genes (ITRG) profiling and their validation by PCR

The ITRG present in B. thuringiensis strain NBAIR BtGa were identified by using a Bt Toxin scanner [16] and were validated using PCR. Primers were designed using primer3plus and PCR protocol was standardized for selected ITRG (Table 4). A PCR reaction mixture of volume 25 µl was made which included 12.5 µl of 2x EmeraldAmp PCR master mix (Emerald Amp GT PCR master mix, TakaRa, Japan), 1 µl of forward primer, 1 µl of reverse primer, 5.5 µl of molecular biology grade water and 5 µl of template DNA. The PCR protocol was standardized using a thermal cycler (T100, Bio-Rad, California, U.S.A) and the standardized conditions are as follows: initial denaturation at 95º C for 3 min; 35 cycles of denaturation at 95º C for 30 s, annealing at different temperatures, extension at 72º C for 45 s; and final extension at 72º C for 5 min and hold at 4ºC. The PCR products were resolved in 1.5% agarose gel and documented in the gel documentation system (DNR, MiniLumi, Israel) followed by Sanger sequencing, a consensus sequence was made in BioEdit software, and its matching with original sequences was tested to confirm the presence of ITRG in NBAIR BtGa. Furthermore, the protein structure of selected ITRGs was predicted using the Phyre2 software [17].

Table 4.

Details of insecticidal toxicity related genes (ITRGs) validated in NBAIR BtGa strain along with PCR primers and amplicon size

Sl. No.	Genes	Sequence of Primers	Tm	Amplified product length
1	Bmp1	F-GGCGAAAGCTCAACAAGAAC	60.0 °C	1079 bp
		R- AATCCGCTAATCCCTCGTTT
2	Chitinase C	F- ATTTCCATCAGGAGGTGTCG	59.9 °C	1153 bp
		R- TATCCTGGCTCAGGGACAAC
3	cry1Cb2	F- CATTCCAATTTTTCGCGTTT	59.9 °C	1095 bp
		R- TGCTGCTTCTCAAACAATGG
4	Vpb4Ca1	F-TATCCGCTAGGAGGACCTGA	59.8 °C	1097 bp
		R-CGACATGACTGGGAACACAC
5	Zwa6A	F- TATCCGCTAGGAGGACCTGA	59.8 °C	902 bp
		R- CGACATGACTGGGAACACAC
6	cry1Eb1	F- AAAATAGCCGCATTGACACC	60.0 °C	1236 bp
		R- TAATCAGGCGGATTTTCCAG
7	InhA1	F- GCATTAAAAGCAGCGGTAGC	60.0 °C	1179 bp
		R-GCCACGTGCATATTGTAACG
8	Enhancin	F- ATCGCTCATGGATACCAAGC	60.1 °C	1068 bp
		R-TGTTCCTTCCATTTCCTTCG
9	Spp1Aa1	F-TGTCTTTTCCGCTACCATCC	60.1 °C	1349 bp
		R- GAACGGGGTGATTTTTCTGA
10	Zwa5A	F- GGGGATGCACTATGAAATTATG	58.3 °C	919 bp
		R- AACCCCATGCTCAAATAACG

Biosafety analysis of NBAIR BtGa on honeybee larvae and adults

The B. thuringiensis strain NBAIR BtGa which is active against G. mellonella was further tested on honeybee larvae and adults to check their safety level based on EPPO guidelines (2010) [18]. Biosafety evaluation was done by treating the two-day-old larval cell with five microlitres of spore-crystal mixture (1 × 10⁹ viable spores/ml) of NBAIR BtGa and 1:1 sugar syrup (as a control). Graph sheet print taken on the transparent film A4 (210 × 297 mm) was used for marking the larval cell and a bright-colored bee marker (Benefitbee, QB08) was used to mark bees which are waterproof, quick-drying, non-toxic, permanent, and harmless to bees. Considering the typical 6 to 8-day larval period, observations were conducted over 4 days after treatment, during which the larvae remained healthy and viable, leading to capping by adult bees. Mortality was assessed by observing unsealed brood cells. Similarly, adult bees were subjected to a spore-crystal mixture of NBAIR BtGa and a 1:1 sugar syrup (control) by spraying directly onto the bees within the hive. Ten bees were marked with bee markers for each replication and were monitored for mortality over nine days, both on the bottom board and near the hives [9], but since no deaths occurred after 4 days the data was limited to this period.

Statistical analysis

The mortality data obtained from bioassay and biosafety analysis was corrected according to Abbott (1925) [11]. The concentration-response relationships for mortality of GWM larvae were analyzed by subjecting data to probit analysis (PROC PROBIT) using SAS software (version 9.3, 2011; SAS Institute, Cary, NC, USA). Results from the concentration-response bioassays were used to estimate LC₅₀ values and their associated 95% fiducial limit (95% FL).

Results

Isolation and characterization of B. thuringiensis

The colonies of B. thuringiensis isolates observed on LB agar plates exhibited circular morphology with smooth opaque margins and displayed a chalky white pigmentation, as depicted in Fig. 1a. Upon subjecting B. thuringiensis isolates to Gram, endospore, and crystal staining, the bacteria appeared to be Gram-positive, producing endospores and crystals, as illustrated in Fig. 1b, c and d respectively. This confirmation was further validated through the amplification, sequencing, and BLAST analysis of the 16 S rRNA gene, and the resulting data were submitted to the NCBI database. The NCBI accession number for NBAIR Bt Ga is OP326148.

Fig. 1.

a) Bacillus thuringiensis NBAIR BtGa colonies obtained from Galleria mellonella cadaver, b) Gram staining, c) Endospore staining, d) Crystal staining of NBAIR-BtGa under a light microscope (Olympus BX41, Microscope Central, Pennsylvania, USA) at 100X oil immersion

Bioassay of B. thuringiensis isolates against G. mellonella

The evaluation of B. thuringiensis isolates was conducted to assess their bioefficacy against GWM. The LC₅₀ value was determined as 125.17 µg/ml and 946.61 µg/ml for NBAIR BtGa and HD-1 respectively. Considering the overlap of the 95% fiducial limits for the LC₅₀ value of NBAIR BtGa to HD1, it was apparent that NBAIR BtGa was as effective as HD-1 against GWM, as depicted in Fig. 2 and detailed in Table 1.

Fig. 2.

Dead larvae of Galleria mellonella following treatment with NBAIR BtGa

Table 1.

Bioefficacy of Bacillus thuringiensis strain NBAIR BtGa against Greater wax moth

B. thuringiensis strains	LC50 (µg/ml)	95%FL	Slope± SE	Chi-Square value	P-value**
NBAIR BtGa	125.17	20.99-393.81	0.53±0.10	1.72	0.63
HD-1	946.61	125.7-4683	0.34±0.08	0.83	0.84
NBAIR BtHGa1a	492.21	91.93-2733	0.35±0.08	0.03	0.99
NBAIR BtHGa1c	457.52	94.30-2168	0.37±0.08	0.16	0.98
NBAIR BtHGa1d	6743	1072-542495	0.31±0.08	0.44	0.93
NBAIR BtHGa1e	458.3	73.70-2247	0.35±0.08	0.35	0.94
NBAIR BtHGa1f	378.23	52.7-1410	0.41±0.09	0.40	0.93
NBAIR BtHGa2a	684.38	173.97-3895	0.39±0.08	0.44	0.93
NBAIR BtHGa2b	267.43	48.91-1069	0.39±0.08	0.25	0.96
NBAIR BtHGa2c	1143	266.75-11669	0.37±0.08	0.10	0.99
NBAI BtHGa2d	210.62	43.38-998.78	0.37±0.08	0.16	0.98

*FL: fiducial limits; SE: standard error

**P value for the χ2 value. A nonsignificant χ2 indicates a good fit of the line to the data

Whole genome sequencing of B. thuringiensis NBAIR BtGa

Whole genome sequencing of B. thuringiensis NBAIR BtGa was performed using Illumina platform with 2 × 150 bp chemistry and genome assembly was carried out using SPAdes assembler of which the detailed analysis report has been illustrated in Table 2. The complete assembly of B.thuringiensis NBAIR BtGa has a genome size of 5.96 Mb with an average GC content of 35.53%. The genome of B. thuringiensis NBAIR BtGa produced 452 scaffolds totaling 6,209,778 bp with the N₅₀ value at 109,322 bp. Further analysis of genomic sequences identified 7122 genes of which 6888 are coding DNA sequences (CDS), 68 tRNAs, and 8 rRNAs.

Table 2.

Genome features and summary of NBAIR BtGa

Genome size (bp)	NBAIR BtGa genome
No. of CDS	5.96 Mb
No. of genes	6888
No. of tRNAs	7122
No. of rRNAs	68
GC (%)	8
No of Scaffolds	35.53
N50value	452
Biosample	SAMN36766633
Bioproject	PRJNA1000284
SRA	SRS18458677

Functional annotation

Gene ontogeny study was done using Blast2Go software, among 3,688 genes of the genome, 2169 genes possess biological functions which mainly include metabolic processes, biological regulation, and detoxification. The cellular process like the building of cell parts and proteins was exhibited by 1900 genes and molecular functions like antioxidant activity, catalytic activity, and toxin activity were done by 2774 genes.

KEGG pathway analysis

The KEGG pathway analysis was used to predict the biological functions of genes. Among 7122 genes, 1941 genes from NBAIR BtGa are KEGG annotated genes and categorized into 5 main categories: metabolism, genetic information processing, environmental information processing, cell processes, and organism systems. The NBAIR BtGa exhibited a high abundance of genes associated with carbohydrate and amino acid metabolism, alongside enriched pathways involving nucleotide metabolism, energy metabolism, cofactor and vitamin metabolism, and lipid metabolism. It was also found to contain genes involved in many metabolic processes involved in important life pathways such as glucose and lipid metabolism. The abundance of genes such as biosynthesis of secondary metabolites, microbial metabolism in different environments, and biosynthesis of amino acids were at the forefront.

Insecticidal toxicity-related genes (ITRG) profiling and their validation by PCR

The twenty-one ITRGs family constituted in NBAIR BtGa were identified by the Bt toxin scanner (Table 3), including 9 cry genes viz., cry1Ab11, cry1Ia44, cry1Aa2, cry2Af1, cry1Da2, cry1Eb1, cry1Ab5, cry1Cb2, cry1Ac2 and one vip gene (vip3b2). Selected genes were further validated by PCR amplification, and the amplicon size of each gene along with their corresponding T_m are shown in Table 4 and depicted in Fig. 3. The protein structures of some insecticidal proteins presented by Phyre2 software are represented in Fig. 4.

Table 3.

List of insecticidal proteins identified in NBAIR BtGa

Category	No. of insecticidal proteins	Insecticidal proteins
Cry	9	Cry1Ab11, Cry1Ia44, Cry1Aa2, Cry2Af1, Cry1Da2, Cry1Eb1, Cry1Ab5, Cry1Cb2, Cry1Ac2
Vip	1	Vip3Bb2
ZwittermicinA resistance protein	8	Zwa5A (4), Zwa5B, Zwa6 (3)

Fig. 3.

Validation of insecticidal toxicity related genes of NBAIR BtGa. M- 1 kb ladder, (A) Lane 1-Bmp1, Lane 2- cry1Eb1, Lane 3- InhA1, Lane 4- Vpb4Ca1, Lane 5- Spp1Aa1, Lane 6- Enhancin, (B) Lane 7- zwa 6 A, Lane 8- zwa 5 A, Lane 9- ChitinaseC, Lane 10- cry1Cb 2

Fig. 4.

Protein homology modelling of identified insecticidal toxicity related genes of NBAIR BtGa predicted using Phyre2 software (a) Cry1Ab11, (b) Cry2Af1, (c) Vip3Bb2, (d) Immuno inhibitor A, (e) Vpb4Ca1, (f) Bmp-1

Biosafety test of NBAIR BtGa against honeybee larvae and adults

Analysis of variance (ANOVA) revealed that treatment with NBAIR BtGa did not have a significant effect on honeybee larvae and adults. The mortality rate of honeybee larvae when sprayed with the spore-crystal mixture was 0.06%, while the mortality rate for adults was 0.04%, as shown in Table 5; Fig. 5.

Table 5.

Biosafety assessment of B. thuringiensis strains on larvae and adults of honeybee

Treatments	Cumulative per cent mortality of honeybee larvae and adults observed in an interval of 24 h up to four days after treatment with NBAIR BtGa
	1st day	2nd day	3rd day	4th day	F value	P value
Control	0	0	0.02	0.02	-	-
Larval mortality	0	0.02	0.04	0.06	1.60	<0.001
Adult mortality	0	0.02	0.04	0.04	2.00	<0.001

Fig. 5.

a) Larvae of honeybee treated with NBAIR BtGa strain, b) Honeybee adults sprayed with NBAIR BtGa strain

Discussion

Bee wax is one of the important products after honey produced by honeybees having diverse applications, including its use in candle making, skincare products, and as a material for food wrapping [19]. However, it also attracts the GWM, a common pest of honeybee hives that can lead to damage, abandonment, and colony loss. Due to the potential harm to honeybees from chemical pesticides, beekeepers face challenges in pest control. Therefore, employing biocontrol agents is a safe approach for managing such pests in agricultural settings [20–21]. Developing specific biological strategies for managing the GWM without harming honeybees is crucial. Bacterial biocontrol agents, particularly B. thuringiensis, are highly effective due to their ability to form endospores, enabling them to survive adverse conditions [22]. They are widely recognized for their effectiveness in reducing insect populations and are extensively used as a biopesticide in agriculture [2, 23]. Thus, in the present study, we identified an efficient B. thuringiensis strain for the management of GWM, which was characterized through WGS to know the molecular mechanism involved in its biocontrol efficacy and was also tested for any harmful effects against honeybees.

Initially, ten different B. thuringiensis isolates were tested against GWM of which the NBAIR BtGa strain showed a minimum LC₅₀ value of 125.17 µg/ml followed by 378.23 µg/ml in NBAIR BtHGa1f which is following the Jyoti et al. (2020) [10]. WGS of microbials has become an effective method in the identification of insecticidal genes [24]. So, in the current study, we performed WGS of B. thuringiensis strain NBAIR BtGa, which caused the highest mortality of the GWM. The specificity of NBAIR BtGa in terms of its effectiveness against GWM was correlated with the production of Cry1, Cry2, and Vip3 proteins, which specifically target lepidopteran insects [25]. Typically, these insecticidal genes are located on plasmids but have also been identified on chromosomes. The NBAIR BtGa genome contains nine different cry genes viz. cry1Ab11, cry1Ia44, cry1Aa2, cry2Af1, cry1Da2, cry1Eb1, cry1Ab5, cry1Cb2, and cry1Ac2, all encoding lepidopteran-specific Cry proteins [24] like the B. thuringiensis var. kurstaki HD-1 (Indian standard) which is also reported to have nine cry genes—cry1, cry2, cry2Aa, cry5, cry7, cry19, cry28, cry36, and cry47 capable of acting against lepidopteran pests [26]. Apart from cry genes, other ITRGs are also recognized for their insect pest toxicity [6, 27]. In NBAIR BtGa, many such ITRGs were found such as vip3Bb2 and vpb4 genes against lepidopteran [28], Mpp46 gene against dipteran [29], enhancin, which has lepidopteran activity [30], Bmp1 which in the combination of some cry genes show elevated toxicity against nematodes [31] and InhA, a zinc metalloprotease, which specifically hydrolyzes antibacterial peptides produced by insect hosts [32]. Other genes like Zwittermicin A (zwa5A, zwa5B, and zwa6) with antifungal activity as well as enhanced insecticidal activity [33] and Chitinase C, which serve various functions in B. thuringiensis, such as morphogenesis, nutrient cycling, and in defense against chitin-containing insect pests and parasites; were also reported [34–35]. It is now known that different B. thuringiensis strains harbor various ITRGs which may help them expand their host specificity and improve their toxic activity against different insect targets [36]. Thus, there is a synergistic effect of this plethora of virulence factors which leads to the high bioefficacy of NBAIR BtGa against GWM. Genes related to carbohydrates and amino acids were also found highly rich in NBAIR BtGa strain, which highlighted the biological significance of functions such as metabolism and rapid growth of microorganisms. The decomposition of carbohydrates usually acts as an energy source for the growth and development of microorganisms and amino acid catabolism is the core function of bacteria.

Even though B. thuringiensis strain is effective against GWM, it should also be safe for bees before deploying them in the beehives. Our NBAIR BtGa strain was tested for its biosafety against honeybees (both larvae and adults) and showed no toxic effects in them. These results indicated that the B. thuringiensis strain NBAIR BtGa was safer for honeybee larvae and adults. Similar investigations were also carried out by Nayimabhanu (2010) [9] where they found non-significant mortality of the honeybee larvae fed with the B. thuringiensis strain. Another similar study carried out by Burges and Bailey (1967) [37], showed that there was no harmful effect on bees (Apis mellifera) when a commercial formulation of B. thuringiensis was incorporated into bee combs to control the wax moths, G.mellonella and Achroia grisella F [37]. Moreover, the activation of insecticidal proteins in the insect gut is significantly influenced by pH, as a pH range of 9.0 to 10.5 is required to activate B. thuringiensis toxins [38]. Lepidopteran larvae typically have a highly alkaline midgut pH of 7–12 [39], whereas honeybees maintain a gut pH of 5.8 to 6.0 [40]. This suggests that B. thuringiensis toxins are unlikely to affect the activity of honeybees within the colony. Thus, NBAIR Bt Ga can be effectively used against the greater wax moth while safeguarding honeybees thus providing a dual benefit.

Conclusion

The study identified highly effective B. thuringiensis isolate NBAIR BtGa which was found biologically safe for honeybees while exhibiting high specificity against greater wax moth. Identification of insecticidal genes through WGS shed light on the molecular mechanisms underlying the biocontrol potential of NBAIR BtGa. The findings offer a promising avenue for environmentally friendly biological management of greater wax moths, suggesting its suitability for developing effective bioinsecticides thus eliminating the need for chemical pesticides.

Author contributions

ANS, RR, and CM conceptualized and designed the study, HSV, and RS conducted experiments, AK performed bioinformatic analysis, HSV, and AK, prepared the original draft, JKS and EG monitored the experiment and edited the manuscript. All authors read and approved the manuscript for submission.

Funding

No funding was received for conducting this study.

Data availability

The data underlying this article is available in the NCBI database under Bioproject ID: PRJNA1000284, SRA data: SRS18458677, and Biosample accession number: SAMN36766633.

Declarations

Ethical approval

This article does not contain any studies conducted on human participants or animals. The authors consent to the publication of the manuscript in its current form.

Consent to participate

Not applicable.

Conflict of interest

The authors declare no competing interests.